Comparison of Organosulfur and Amino Acid Composition between Triploid Onion Allium cornutum Clementi ex Visiani, 1842, and Common Onion Allium cepa L., and Evidences for Antiproliferative Activity of Their Extracts
Abstract
:1. Introduction
2. Results and Discussion
2.1. Headspace Volatiles of Allium Species
2.2. Amino Acid Composition of Onion Bulbs
2.3. Antiproliferative Activity of A. cornutum and A. cepa Extracts
2.4. DNA Fragmentation Analysis of HeLa Cells
2.5. Morphological Changes of HeLa Cells after Treatment with Onion Extracts
2.6. Gene Expression Analysis in HeLa Cells
3. Materials and Methods
3.1. Plant Material and Preparation of Extracts
3.2. Extraction and Analysis of Volatile Sulfur Compounds
3.3. Analysis of Amino Acid Composition
3.4. Cell Proliferation Assay
3.5. DNA Fragmentation Assay
3.6. DAPI Staining
3.7. Real-Time PCR Analysis
3.8. Statistical Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Onions and Other Allium Plants|Encyclopedia.com. Available online: https://www.encyclopedia.com/food/encyclopedias-almanacs-transcripts-and-maps/onions-and-other-allium-plants (accessed on 26 April 2019).
- Block, E. The chemistry of garlic and onions. Sci. Am. 1985, 252, 114–119. [Google Scholar] [CrossRef]
- Azizi, Z.B.M.M.; Mirmiran, P.; Momenan, A.A.; Azizi, F. Allium vegetable intakes and the incidence of cardiovascular disease, hypertension, chronic kidney disease, and type 2 diabetes in adults. J. Hypertens. 2017, 35, 1909–1916. [Google Scholar]
- Blekkenhorst, L.; Sim, M.; Bondonno, C.; Bondonno, N.; Ward, N.; Prince, R.; Devine, A.; Lewis, J.; Hodgson, J. Cardiovascular Health Benefits of Specific Vegetable Types: A Narrative Review. Nutrients 2018, 10, 595. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bianchini, F.; Vainio, H. Allium vegetables and organosulfur compounds: Do they help prevent cancer? Environ. Health Perspect. 2001, 109, 893–902. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Zhuang, W.; Hu, W.; Liu, G.; Wu, T.; Wu, X. Consumption of Large Amounts of Allium Vegetables Reduces Risk for Gastric Cancer in a Meta-analysis. Gastroenterology 2011, 141, 80–89. [Google Scholar] [CrossRef]
- Guercio, V.; Galeone, C.; Turati, F.; La Vecchia, C. Gastric Cancer and Allium Vegetable Intake: A Critical Review of the Experimental and Epidemiologic Evidence. Nutr. Cancer 2014, 66, 757–773. [Google Scholar] [CrossRef]
- Pourzand, A.; Tajaddini, A.; Pirouzpanah, S.; Asghari-Jafarabadi, M.; Samadi, N.; Ostadrahimi, A.-R.; Sanaat, Z. Associations between Dietary Allium Vegetables and Risk of Breast Cancer: A Hospital-Based Matched Case-Control Study. J. Breast Cancer 2016, 19, 292. [Google Scholar] [CrossRef] [PubMed]
- Nicastro, H.L.; Ross, S.A.; Milner, J.A. Garlic and Onions: Their Cancer Prevention Properties. Cancer Prev. Res. 2015, 8, 181–189. [Google Scholar] [CrossRef] [Green Version]
- Tsai, T.-H.; Tsai, P.-J.; Ho, S.-C. Antioxidant and Anti-inflammatory Activities of Several Commonly Used Spices. J. Food Sci. 2005, 70, C93–C97. [Google Scholar] [CrossRef]
- Upadhyay, R.K. Nutraceutical, pharmaceutical and therapeutic uses of Allium cepa: A review. Int. J. Green Pharm. 2016, 10. [Google Scholar] [CrossRef]
- Fredotović, Ž.; Šprung, M.; Soldo, B.; Ljubenkov, I.; Budić-Leto, I.; Bilušić, T.; Čikeš-Čulić, V.; Puizina, J. Chemical Composition and Biological Activity of Allium cepa L. and Allium cornutum (Clementi ex Visiani 1842) Methanolic Extracts. Molecules 2017, 22, 448. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Halliwell, B.; Rafter, J.; Jenner, A. Health promotion by flavonoids, tocopherols, tocotrienols, and other phenols: Direct or indirect effects? Antioxidant or not? Am. J. Clin. Nutr. 2005, 81, 268S–276S. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aziz, A.A.; Edwards, C.A.; Lean, M.E.J.; Crozier, A. Absorption and excretion of conjugated flavonols, including quercetin-4′-O-β-glucoside and isorhamnetin-4′-O-β-glucoside by human volunteers after the consumption of onions. Free Radic. Res. 1998, 29, 257–269. [Google Scholar] [CrossRef] [PubMed]
- Boyle, S.P.; Dobson, V.L.; Duthie, S.J.; Kyle, J.A.; Collins, A.R. Absorption and DNA protective effects of flavonoid glycosides from an onion meal. Eur. J. Nutr. 2000, 39, 213–223. [Google Scholar] [CrossRef] [PubMed]
- Mnayer, D.; Fabiano-Tixier, A.-S.; Petitcolas, E.; Hamieh, T.; Nehme, N.; Ferrant, C.; Fernandez, X.; Chemat, F. Chemical Composition, Antibacterial and Antioxidant Activities of Six Essentials Oils from the Alliaceae Family. Molecules 2014, 19, 20034–20053. [Google Scholar] [CrossRef] [Green Version]
- Ndoye Foe, F.M.-C.; Tchinang, T.F.K.; Nyegue, A.M.; Abdou, J.-P.; Yaya, A.J.G.; Tchinda, A.T.; Essame, J.-L.O.; Etoa, F.-X. Chemical composition, in vitro antioxidant and anti-inflammatory properties of essential oils of four dietary and medicinal plants from Cameroon. BMC Complement. Altern. Med. 2016, 16, 117. [Google Scholar] [CrossRef] [Green Version]
- Kato, H.; Rhue, M.R.; Nishimura, T. Role of Free Amino Acids and Peptides in Food Taste. In Flavor Chemistry: Trends and Developments; American Chemical Society: Washington, DC, USA, 1989; pp. 158–174. [Google Scholar]
- Schuphan, W.; Schwerdtfeger, E. Arginin als Stickstoffreserve bei der Küchenzwiebel (Allium cepa L.). Ernährungs-Umschau 1971, 18, 288. [Google Scholar]
- Lee, J.; Harnly, J.M. Free Amino Acid and Cysteine Sulfoxide Composition of 11 Garlic (Allium sativum L.) Cultivars by Gas Chromatography with Flame Ionization and Mass Selective Detection. J. Agric. Food Chem. 2005, 53, 9100–9104. [Google Scholar] [CrossRef]
- Lawson, L.D. The composition and chemistry of garlic cloves and processed garlic. In Garlic: The Science and Therapeutic Application of Allium sativum L. and Related Species, 2nd ed.; Williams and Wilkins: Baltimore, MD, USA, 1996; pp. 107–307. [Google Scholar]
- Puizina, J.; Papeš, D. Further cytogenetic analyses of the Croatian triploid shallot “Ljutika” (Allium cepa var. viviparum, Alliaceae) and its comparison with the Indian triploid “Pran”. Plant Syst. Evol. 1997, 208, 11–23. [Google Scholar] [CrossRef]
- Puizina, J.; Papeš, D. Cytogenetical evidences for hybrid structure and origin of diploid and triploid shallots (Allium cepa var. viviparum, Liliaceae) from Dalmatia (Croatia). Plant Syst. Evol. 1996, 199, 203–215. [Google Scholar] [CrossRef]
- Puizina, J.; Javornik, B.; Bohanec, B.; Schweizer, D.; Maluszynska, J.; Pape, D. Random amplified polymorphic DNA analysis, genome size, and genomic in situ hybridization of triploid viviparous onions. Genome 1999, 42, 1208–1216. [Google Scholar] [CrossRef] [PubMed]
- Fredotović, Ž.; Šamanić, I.; Weiss-Schneeweiss, H.; Kamenjarin, J.; Jang, T.-S.; Puizina, J. Triparental origin of triploid onion, Allium cornutum (Clementi ex Visiani, 1842), as evidenced by molecular, phylogenetic and cytogenetic analyses. BMC Plant Biol. 2014, 14, 24. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Poojary, M.M.; Putnik, P.; Bursać Kovačević, D.; Barba, F.J.; Lorenzo, J.M.; Dias, D.A.; Shpigelman, A. Stability and extraction of bioactive sulfur compounds from Allium genus processed by traditional and innovative technologies. J. Food Compos. Anal. 2017, 61, 28–39. [Google Scholar] [CrossRef]
- Rose, P.; Whiteman, M.; Moore, P.K.; Zhu, Y.Z. Bioactive S-alk(en)yl cysteine sulfoxide metabolites in the genus Allium: The chemistry of potential therapeutic agents. Nat. Prod. Rep. 2005, 22, 351. [Google Scholar] [CrossRef]
- Martín-Lagos, R.A.; Serrano, M.F.O.; Ruiz-López, M.D. Comparative study by gas chromatography-mass spectrometry of methods for the extraction of sulfur compounds in Allium cepa L. Food Chem. 1992, 44, 305–308. [Google Scholar]
- Corzo-Martínez, M.; Corzo, N.; Villamiel, M. Biological properties of onions and garlic. Trends Food Sci. Technol. 2007, 18, 609–625. [Google Scholar] [CrossRef]
- D’Auria, M.; Racioppi, R. HS-SPME-GC-MS Analysis of onion (Allium cepa L.) and shallot (Allium ascalonicum L.). Food Res. 2017, 1, 161–165. [Google Scholar] [CrossRef]
- Colina-Coca, C.; González-Peña, D.; Vega, E.; De Ancos, B.; Sánchez-Moreno, C. Novel approach for the determination of volatile compounds in processed onion by headspace gas chromatography-mass spectrometry (HS GC-MS). Talanta 2013, 103, 137–144. [Google Scholar] [CrossRef]
- Liu, M.; Su, Y.; Guo, Y. Determination of highly volatile compounds in fresh onion (Allium cepa L.) by room-temperature enrichment headspace-trap coupled to cryotrapping GC-MS. Sep. Sci. Plus 2018, 1, 530–538. [Google Scholar] [CrossRef]
- Teshika, J.D.; Zakariyyah, A.M.; Zaynab, T.; Zengin, G.; Rengasamy, K.R.; Pandian, S.K.; Fawzi, M.M. Traditional and modern uses of onion bulb (Allium cepa L.): A systematic review. Crit. Rev. Food Sci. Nutr. 2018, 59 (Suppl. 1), S39–S70. [Google Scholar] [CrossRef]
- Flaig, M.; Granvogl, M. Quantitation of cis- and trans-3,5-Diethyl-1,2,4-trithiolanes in Cooked Allium Varieties Using a Stable Isotope Dilution Assay. In ACS Symposium Series; American Chemical Society: Washington, DC, USA, 2015; Volume 1212, pp. 109–122. ISBN 9780841231146. [Google Scholar]
- Pareek, S.; Sagar, N.A.; Sharma, S.; Yadav, V. Onion (Allium cepa L.). In Fruit and Vegetable Phytochemicals: Chemistry and Human Health; Elhadi, Y., Yahia, M., Eds.; John Wiley & Sons Ltd.: Hoboken, NJ, USA, 2018; Volume 2. [Google Scholar]
- Keusgen, M.; Schulz, H.; Glodek, J.; Krest, I.; Krüger, H.; Herchert, N.; Keller, J. Characterization of some Allium hybrids by aroma precursors, aroma profiles, and alliinase activity. J. Agric. Food Chem. 2002, 50, 2884–2890. [Google Scholar] [CrossRef]
- Storsberg, J.; Schulz, H.; Keusgen, M.; Tannous, F.; Dehmer, K.J.; Keller, E.R.J. Chemical Characterization of Interspecific Hybrids between Allium cepa L. and Allium kermesinum Rchb. J. Agric. Food Chem. 2004, 52, 5499–5505. [Google Scholar] [CrossRef] [PubMed]
- Fritsch, R.M.; Friesen, N. Evolution, Domestication and Taxonomy. In Allium Crop Science: Recent Advances; Rabinowitch, H.D., Currah, L., Eds.; CAB International: Wallingford, UK, 2002; pp. 5–30. [Google Scholar]
- Randle, W.M.; Lancaster, J.E. Sulphur Compounds in Alliums in Relation to Flavour Quality. In Allium Crop Science: Recent Advances; Rabinowitch, H.D., Currah, L., Eds.; CAB International: Wallingford, UK, 2002; pp. 329–356. [Google Scholar]
- Block, E. Biological activity of Allium compounds: Recent results. In IV International Symposium on Edible Alliaceae 688; Acta Horticulturae: Beijing, China, 2005; pp. 41–58. [Google Scholar]
- Beretta, H.V.; Bannoud, F.; Insani, M.; Berli, F.; Hirschegger, P.; Galmarini, C.R.; Cavagnaro, P.F. Relationships among Bioactive Compounds Content and the Antiplatelet and Antioxidant Activities of Six Allium Vegetable Species. Food Technol. Biotechnol. 2017, 55, 266–275. [Google Scholar] [CrossRef] [PubMed]
- Pan, Y.; Zheng, Y.M.; Ho, W.S. Effect of quercetin glucosides from Allium extracts on HepG2, PC-3 and HT-29 cancer cell lines. Oncol. Lett. 2018, 15, 4657–4661. [Google Scholar] [CrossRef] [PubMed]
- Albishi, T.; John, J.A.; Al-Khalifa, A.S.; Shahidi, F. Antioxidant, anti-inflammatory and DNA scission inhibitory activities of phenolic compounds in selected onion and potato varieties. J. Funct. Foods 2013, 5, 930–939. [Google Scholar] [CrossRef]
- Lanzotti, V.; Scala, F.; Bonanomi, G. Compounds from Allium species with cytotoxic and antimicrobial activity. Phytochem. Rev. 2014, 13, 769–791. [Google Scholar] [CrossRef]
- Lee, E.J.; Yoo, K.S.; Jifon, J.; Patil, B.S. Characterization of shortday onion cultivars of 3 pungency levels with flavor precursor, free amino acid, sulfur, and sugar contents. J. Food Sci. 2009, 74, C475–C480. [Google Scholar] [CrossRef]
- Dini, I.; Tenore, G.C.; Dini, A. Chemical composition, nutritional value and antioxidant properties of Allium caepa L. Var. tropeana (red onion) seeds. Food Chem. 2008, 107, 613–621. [Google Scholar] [CrossRef]
- Hansen, S.L. Content of free amino acids in onion (Allium cepa L.) as influenced by the stage of development at harvest and long-term storage. Acta Agric. Scand. Sect. B Soil Plant Sci. 2001, 51, 77–83. [Google Scholar] [CrossRef]
- Hu, G.; Lu, Y.; Wei, D. Chemical characterization of Chinese chive seed (Allium tuberosum Rottl.). Food Chem. 2006, 99, 693–697. [Google Scholar] [CrossRef]
- Kurihara, K.; Perticone, F. Umami the Fifth Basic Taste: History of Studies on Receptor Mechanisms and Role as a Food Flavor. BioMed Res. Int. 2015. [Google Scholar] [CrossRef] [Green Version]
- Cho, Y.H.; Lee, J.W.; Woo, H.D.; Lee, S.; Kim, Y.J.; Lee, Y.; Shin, S.; Joung, H.; Chung, H.W. Protective effect of onion extract on bleomycin-induced cytotoxicity and genotoxicity in human lymphocytes. Int. J. Environ. Res. Public Health 2016, 13, 227. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Gu, L.; Zhang, B.; Wang, A.; Duan, S. The Antioxidation of Extracts from Allium macrostemon. J. Chin. Med. Mater. 1994, 17, 34. [Google Scholar]
- Özkan, O.; Gül, S.; Kart, A.; Çiçek, B.A.; Kiliç, K. In Vitro Antimutagenicity of Allium Tuncelianum Ethanol Extract Against Induction of Chromosome Aberration by Mutagenic Agent Mitomycine, C. Kafkas Univ. Vet. Fak. Derg. 2013, 19, 259–262. [Google Scholar] [CrossRef]
- Millet, A.; Lamy, E.; Jonas, D.; Stintzing, F.; Mersch-Sundermann, V.; Merfort, I. Fermentation Enhances the Biological Activity of Allium cepa Bulb Extracts. J. Agric. Food Chem. 2012, 60, 2148–2156. [Google Scholar] [CrossRef]
- Milena, G.C.; Milan, S.S.; Ivana, D.R.; Olgica, D.S.; Ljiljana, R.C.; Marina, D.T.; Dragana, S.D.; Snezana, D.M. Biological Effects, Total Phenolic Content and Flavonoid Concentrations of Fragrant Yellow Onion (Allium flavum L.). Med. Chem. 2012, 8, 46–51. [Google Scholar]
- Simin, N.; Orcic, D.; Cetojevic-Simin, D.; Mimica-Dukic, N.; Anackov, G.; Beara, I.; Mitic-Culafic, D.; Bozin, B. Phenolic profile, antioxidant, anti-inflammatory and cytotoxic activities of small yellow onion (Allium flavum L. subsp. flavum, Alliaceae). LWT Food Sci. Technol. 2013, 54, 139–146. [Google Scholar] [CrossRef]
- Pandurangan, V.; Amanulla, S.S.D.; Ramanathan, K. Anticancer efficacy of dry and fresh Allium ascalonicum (shallot) against HepG2 cell line. Natl. J. Physiol. Pharm. Pharmacol. 2016, 6, 196–199. [Google Scholar] [CrossRef]
- Khazaei, S.; Ramachandran, V.; Abdul hamid, R.; Mohd Esa, N.; Etemad, A.; Moradipoor, S.; Ismail, P. Flower extract of Allium atroviolaceum triggered apoptosis, activated caspase-3 and down-regulated antiapoptotic Bcl-2 gene in HeLa cancer cell line. Biomed. Pharmacother. 2017, 89, 1216–1226. [Google Scholar] [CrossRef]
- Ackland, M.; van de Waarsenburg, S.; Jones, R. Synergistic Antiproliferative Action of the Flavonols Quercetin and Kaempferol in Cultured Human Cancer Cell Lines. In Vivo 2005, 19, 69–76. [Google Scholar]
- Guyonnet, D.; Siess, M.-H.; Le Bon, A.-M.; Suschetet, M. Modulation of Phase II Enzymes by Organosulfur Compounds from Allium Vegetables in Rat Tissues. Toxicol. Appl. Pharmacol. 1999, 154, 50–58. [Google Scholar] [CrossRef] [PubMed]
- Dirsch, V.M.; Gerbes, A.L.; Vollmar, A.M. Ajoene, a Compound of Garlic, Induces Apoptosis in Human Promyeloleukemic Cells, Accompanied by Generation of Reactive Oxygen Species and Activation of Nuclear Factor kB. Mol. Pharmacol. 1993, 53, 402–407. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sigounas, G.; Hooker, J.L.; Li, W.; Anagnostou, A.; Steiner, M. S-Allylmercaptocysteine, a stable thioallyl compound, induces apoptosis in erythroleukemia cell lines. Nutr. Cancer 1997, 28, 153–159. [Google Scholar] [CrossRef]
- Sakamoto, K.; Lavvson, L.D.; Milner, J.A. Allyl sulfides from garlic suppress the in vitro proliferation of human a549 lung tumor cells. Nutr. Cancer 1997, 29, 152–156. [Google Scholar] [CrossRef] [PubMed]
- Yun, H.-M.; Ban, J.O.; Park, K.-R.; Lee, C.K.; Jeong, H.-S.; Han, S.B.; Hong, J.T. Potential therapeutic effects of functionally active compounds isolated from garlic. Pharmacol. Ther. 2014, 142, 183–195. [Google Scholar] [CrossRef] [PubMed]
- Borkowska, A.; Knap, N.; Antosiewicz, J. Diallyl Trisulfide is More Cytotoxic to Prostate Cancer Cells PC-3 than to Noncancerous Epithelial Cell Line PNT1A: A Possible Role of p66Shc signaling Axis. Nutr. Cancer 2013, 65, 711–717. [Google Scholar] [CrossRef]
- Filomeni, G.; Aquilano, K.; Rotilio, G.; Ciriolo, M.R. Reactive oxygen species-dependent c-Jun NH2-terminal kinase/c-Jun signaling cascade mediates neuroblastoma cell death induced by diallyl disulfide. Cancer Res. 2003, 63, 5940–5949. [Google Scholar]
- Kwon, K.-B.; Yoo, S.-J.; Ryu, D.-G.; Yang, J.-Y.; Rho, H.-W.; Kim, J.-S.; Park, J.-W.; Kim, H.-R.; Park, B.-H. Induction of apoptosis by diallyl disulfide through activation of caspase-3 in human leukemia HL-60 cells. Biochem. Pharmacol. 2002, 63, 41–47. [Google Scholar] [CrossRef]
- Knowles, L.M.; Milner, J.A. Diallyl disulfide inhibits p34cdc2 kinase activity through changes in complex formation and phosphorylation. Carcinogenesis 2000, 21, 1129–1134. [Google Scholar] [CrossRef]
- Yang, C.S.; Chhabra, S.K.; Hong, J.-Y.; Smith, T.J. Mechanisms of Inhibition of Chemical Toxicity and Carcinogenesis by Diallyl Sulfide (DAS) and Related Compounds from Garlic. J. Nutr. 2001, 131, 1041S–1045S. [Google Scholar] [CrossRef] [Green Version]
- Steller, H. Mechanisms and genes of cellular suicide. Science 1995, 267, 1445–1449. [Google Scholar] [CrossRef] [PubMed]
- Rello, S.; Stockert, J.C.; Moreno, V.; Gámez, A.; Pacheco, M.; Juarranz, A.; Cañete, M.; Villanueva, A. Morphological criteria to distinguish cell death induced by apoptotic and necrotic treatments. Apoptosis 2005, 10, 201–208. [Google Scholar] [CrossRef] [PubMed]
- Troyano, A.; Sancho, P.; Fernández, C.; de Blas, E.; Bernardi, P.; Aller, P. The selection between apoptosis and necrosis is differentially regulated in hyrdrogen peroxide-treated and glutathione-depleted human promonocytic cells. Cell Death Differ. 2003, 10, 889–898. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saraste, A.; Pulkki, K. Morphologic and biochemical hallmarks of apoptosis. Cardiovasc. Res. 2000, 45, 528–537. [Google Scholar] [CrossRef]
- Mondal, A.; Bennett, L.L. Resveratrol enhances the efficacy of sorafenib mediated apoptosis in human breast cancer MCF7 cells through ROS, cell cycle inhibition, caspase 3 and PARP cleavage. Biomed. Pharmacother. 2016, 84, 1906–1914. [Google Scholar] [CrossRef]
- Ma, S.P.; Ju, F.; Zhang, Y.P.; Shi, X.; Zhuang, R.J.; Xue, H.; Ma, J.; Wang, L.; Cheng, B.F.; Cao, H.; et al. Cold-inducible protein RBM3 protects neuroblastoma cells from retinoic acid-induced apoptosis via AMPK, p38 and JNK signaling. J. Funct. Foods 2017, 35, 175–184. [Google Scholar] [CrossRef]
- Mohammadi-Motlagh, H.-R.; Yarani, R.; Sadeghalvad, M.; Adham, E.; Rasouli, H.; Mostafaie, A. 2-Methylpyridine-1-ium-1-sulfonate as an Inducer of Apoptosis and Cell Cycle Arrest: A comparative in vitro and Computational Study. Nutr. Cancer 2019, 71, 643–656. [Google Scholar] [CrossRef]
- Wu, X.; Shen, Y. PMN inhibits colorectal cancer cells through inducing mitotic arrest and p53-dependent apoptosis via the inhibition of tubulin polymerization. Biochem. Biophys. Res. Commun. 2018, 499, 927–933. [Google Scholar] [CrossRef]
- Pandurangan, M.; Mistry, B.; Enkhataivan, G.; Kim, D.H. Efficacy of carnosine on activation of caspase 3 and human renal carcinoma cell inhibition. Int. J. Biol. Macromol. 2016, 92, 377–382. [Google Scholar] [CrossRef]
- Twiddy, D.; Cain, K. Caspase-9 cleavage, do you need it? Biochem. J. 2007, 405, e1. [Google Scholar] [CrossRef] [Green Version]
- The Pherobase: Database of Pheromones and Semiochemicals. Available online: http://www.pherobase.com/ (accessed on 27 October 2019).
No. | Compound | RI | A. cornutum (Area %) ± SD | A. cepa L. (Area %) ± SD |
---|---|---|---|---|
1 | Sulfur dioxide | <900 | 0.3 ± 0.01 | 0.4 ± 0.02 |
2 | Methanethiol | <900 | 0.9 ± 0.04 | 0.8 ± 0.03 |
3 | Propanal | <900 | 0.2 ± 0.01 | 0.2 ± 0.01 |
4 | Carbon disulfide | <900 | 0.5 ± 0.02 a | 0.2 ± 0.01 b |
5 | Prop-2-en-1-thiol | <900 | 0.3 ± 0.02 | 0.3 ± 0.03 |
6 | 1-Propanethiol | <900 | 14.1 ± 0.20 | 13.1 ± 0.31 |
7 | Dimethyl disulfide | <900 | 0.1 ± 0.01 | 0.0 ± 0.00 |
8 | 2-Methylpentanal | <900 | 0.1 ± 0.01 | 0.1 ± 0.01 |
9 | (E)-Hex-2-enal | <900 | 0.3 ± 0.02 | 0.2 ± 0.01 |
10 | (Z)-Hex-3-en-1-ol | <900 | 0.2 ± 0.01 | 0.2 ± 0.01 |
11 | Propyl hydrosulfide | <900 | 0.3 ± 0.02 | 0.4 ± 0.03 |
12 | (E)-Hex-3-en-1-ol | <900 | 0.9 ± 0.04 a | 0.5 ± 0.02 b |
13 | S-Propyl ethanetihoate | <900 | 1.5 ± 0.10 | 1.3 ± 0.15 |
14 | 2,5-Dimethylthiophene ** | 912 | 0.1 ± 0.01 b | 0.2 ± 0.01 a |
15 | Methyl propyl disulfide | 938 | 0.8 ± 0.01 b | 0.9 ± 0.01 a |
16 | Methyl (E)-prop-1-enyl disulfide | 947 | 0.0 ± 0.00 b | 0.1 ± 0.01 a |
17 | Ally propyl disulfide | 1095 | 0.6 ± 0.01 b | 0.9 ± 0.01 a |
18 | Dipropyl disulfide | 1111 | 45.5 ± 0.01 a | 31.9 ± 0.01 b |
19 | (E)-prop-1-enyl propyl disulfide | 1119 | 0.1 ± 0.01 b | 3.8 ± 0.20 a |
20 | Methyl methylthiomethyl disulfide | 1130 | 2.8 ± 0.10 a | 0.5 ± 0.04 b |
21 | Methyl propyl trisulfide | 1155 | 0.2 ± 0.01 | 0.2 ± 0.01 |
22 | Diisopropyl trisulfide | 1328 | 18.3 ± 0.21 b | 24.6 ± 0.41 a |
23 | (Z)-Prop-1-enyl propyl trisulfide | 1336 | 3.1 ± 0.11 | 2.8 ± 0.10 |
24 | (E)-Prop-1-enyl propyl trisulfide | 1339 | 0.7 ± 0.05 | 1.7 ± 0.10 |
25 | Dipropyl tetrasulfide | 1565 | 0.7 ± 0.02 a | 0.0 ± 0.00 b |
26 | cis-3,6-Diethyl-1,2,4,5-tetrathiane * | 1582 | 0.4 ± 0.01 b | 1.7 ± 0.12 a |
27 | trans-3,6-Diethyl-1,2,4,5-tetrathiane * | 1584 | 1.8 ± 0.10 b | 4.8 ± 0.21 a |
Amino Acids | A. cornutum (mg/g DW) * ± SD | A. cepa L. (mg/g DW) * ± SD |
---|---|---|
Asp (Aspartic acid) | 4.941 ± 0.043 b | 6.100 ± 0.083 a |
Ser (Serine) | 2.921 ± 0.004 | 2.846 ± 0.031 |
Glu (Glutamic acid) | 14.964 ± 0.008 a | 11.238 ± 0.096 b |
Gly (Glycine) | 2.042 ± 0.013 | 2.217 ± 0.015 |
His (Histidine) | 1.758 ± 0.015 | 1.667 ± 0.052 |
Arg (Arginine) | 16.492 ± 0.256 a | 12.213 ± 0.094 b |
Thr (Threonine) | 3.324 ± 0.013 b | 4.003 ± 0.076 a |
Ala (Alanine) | 1.675 ± 0.002 b | 2.027 ± 0.023 a |
Pro (Proline) | 1.434 ± 0.024 b | 1.702 ± 0.128 a |
Cys (Cysteine) | 0.144 ± 0.002 | 0.023 ± 0.005 |
Tyr (Tyrosine) | 1.719 ± 0.010 b | 2.277 ± 0.049 a |
Val (Valine) | 2.005 ± 0.003 b | 2.375 ± 0.072 a |
Met (Methionine) | 0.013 ± 0.005 | 0.010 ± 0.005 |
Lys (Lysine) | 2.322 ± 0.010 | 2.328 ± 0.018 |
Ileu (Isoleucine) | 1.426 ± 0.006 b | 1.818 ± 0.007 a |
Leu (Leucine) | 2.284 ± 0.014 b | 2.949 ± 0.026 a |
Phe (Phenylalanine) | 2.198 ± 0.014 | 2.378 ± 0.006 |
Gene | Primer | Sequence (5′-3′) |
---|---|---|
GAPDH | Forward | TCGACAGTCAGCCGCATCTT |
Reverse | GCCCAATACGACCAAATCCGT | |
p53 | Forward | GCTCACTCCAGCCACCTGAA |
Reverse | CCAAAATGGCAGGGGAGGGA | |
Caspase-3 | Forward | CATACTCCACAGCACCTGGTTA |
Reverse | CAGCATGGCACAAAGCGACT | |
Bax | Forward | CAAACTGGTGCTCAAGGCCC |
Reverse | GCACTCCCGCCACAAAGATG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fredotović, Ž.; Soldo, B.; Šprung, M.; Marijanović, Z.; Jerković, I.; Puizina, J. Comparison of Organosulfur and Amino Acid Composition between Triploid Onion Allium cornutum Clementi ex Visiani, 1842, and Common Onion Allium cepa L., and Evidences for Antiproliferative Activity of Their Extracts. Plants 2020, 9, 98. https://doi.org/10.3390/plants9010098
Fredotović Ž, Soldo B, Šprung M, Marijanović Z, Jerković I, Puizina J. Comparison of Organosulfur and Amino Acid Composition between Triploid Onion Allium cornutum Clementi ex Visiani, 1842, and Common Onion Allium cepa L., and Evidences for Antiproliferative Activity of Their Extracts. Plants. 2020; 9(1):98. https://doi.org/10.3390/plants9010098
Chicago/Turabian StyleFredotović, Željana, Barbara Soldo, Matilda Šprung, Zvonimir Marijanović, Igor Jerković, and Jasna Puizina. 2020. "Comparison of Organosulfur and Amino Acid Composition between Triploid Onion Allium cornutum Clementi ex Visiani, 1842, and Common Onion Allium cepa L., and Evidences for Antiproliferative Activity of Their Extracts" Plants 9, no. 1: 98. https://doi.org/10.3390/plants9010098