Effect of Thermospermine on the Growth and Expression of Polyamine-Related Genes in Rice Seedlings
Abstract
:1. Introduction
2. Results
2.1. Thermospermine Suppresses Xylem Vessel Expansion in the Root
2.2. Thermospermine Reduces OsACL5 Expression but Induces Apoplastic PAO Genes
2.3. Expression of Phloem-Specific Genes are Increased by Thermospermine
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Plant Material and Growth Conditions
4.3. Preparation of Sections and Microscopy
4.4. RNA Preparation and RT-PCR
4.5. Phylogenetic Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Knott, J.M.; Römer, P.; Sumper, M. Putative spermine synthases from Thalassiosira pseudonana and Arabidopsis thaliana synthesize thermospermine rather than spermine. FEBS Lett. 2007, 581, 3081–3086. [Google Scholar] [CrossRef] [PubMed]
- Hanzawa, Y.; Takahashi, T.; Komeda, Y. ACL5, an Arabidopsis gene required for internodal elongation after flowering. Plant J. 1997, 12, 863–874. [Google Scholar] [CrossRef] [PubMed]
- Hanzawa, Y.; Takahashi, T.; Michael, A.J.; Burtin, D.; Long, D.; Pineiro, M.; Coupland, G.; Komeda, Y. ACAULIS5, an Arabidopsis gene required for stem elongation, encodes a spermine synthase. EMBO J. 2000, 19, 4248–4256. [Google Scholar] [CrossRef] [PubMed]
- Clay, N.K.; Nelson, T. Arabidopsis thickvein mutation affects vein thickness and organ vascularization, and resides in a provascular cell-specific spermine synthase involved in vein definition and in polar auxin transport. Plant Physiol. 2005, 138, 767–777. [Google Scholar] [CrossRef] [PubMed]
- Muñiz, L.; Minguet, E.G.; Singh, S.K.; Pesquet, E.; Vera-Sirera, F.; Moreau-Courtois, C.L.; Carbonell, J.; Blázquez, M.A.; Tuominen, H. ACAULIS5 controls Arabidopsis xylem specification through the prevention of premature cell death. Development 2008, 135, 2573–2582. [Google Scholar] [CrossRef] [PubMed]
- Kakehi, J.I.; Kuwashiro, Y.; Niitsu, M.; Takahashi, T. Thermospermine is required for stem elongation in Arabidopsis thaliana. Plant Cell Physiol. 2008, 49, 1342–1349. [Google Scholar] [CrossRef] [PubMed]
- Kakehi, J.I.; Kawano, E.; Yoshimoto, K.; Cai, Q.; Imai, A.; Takahashi, T. Mutations in ribosomal proteins, RPL4 and RACK1, suppress the phenotype of a thermospermine-deficient mutant of Arabidopsis thaliana. PLoS ONE 2015, 27, e0117309. [Google Scholar] [CrossRef]
- Imai, A.; Hanzawa, Y.; Komura, M.; Yamamoto, K.T.; Komeda, Y.; Takahashi, T. The dwarf phenotype of the Arabidopsis ACL5-1 mutant is suppressed by a mutation in an upstream ORF of a bHLH gene. Development 2006, 133, 3575–3585. [Google Scholar] [CrossRef]
- Vera-Sirera, F.; Minguet, E.G.; Singh, S.K.; Ljung, K.; Tuominen, H.; Blázquez, M.A.; Carbonell, J. Role of polyamines in plant vascular development. Plant Physiol. Biochem. 2010, 48, 534–539. [Google Scholar] [CrossRef]
- Takano, A.; Kakehi, J.I.; Takahashi, T. Thermospermine is not a minor polyamine in the plant kingdom. Plant Cell Physiol. 2012, 53, 606–616. [Google Scholar] [CrossRef]
- Katayama, H.; Iwamoto, K.; Kariya, Y.; Asakawa, T.; Kan, T.; Fukuda, H.; Ohashi-Ito, K. A negative feedback loop controlling bHLH complexes is involved in vascular cell division and differentiation in the root apical meristem. Curr. Biol. 2015, 25, 3144–3150. [Google Scholar] [CrossRef] [PubMed]
- Ohashi-Ito, K.; Saegusa, M.; Iwamoto, K.; Oda, Y.; Katayama, H.; Kojima, M.; Sakakibara, H.; Fukuda, H. A bHLH complex activates vascular cell division via cytokinin action in root apical meristem. Curr. Biol. 2014, 24, 2053–2058. [Google Scholar] [CrossRef] [PubMed]
- Vera-Sirera, F.; De Rybel, B.; Úrbez, C.; Kouklas, E.; Pesquera, M.; Álvarez-Mahecha, J.C.; Minguet, E.G.; Tuominen, H.; Carbonell, J.; Borst, J.W.; et al. A bHLH-based feedback loop restricts vascular cell proliferation in plants. Dev. Cell 2015, 35, 432–443. [Google Scholar] [CrossRef] [PubMed]
- Baima, S.; Forte, V.; Possenti, M.; Peñalosa, A.; Leoni, G.; Salvi, S.; Felici, B.; Ruberti, I.; Morelli, G. Negative feedback regulation of auxin signaling by ATHB8/ACL5-BUD2 transcription module. Mol. Plant 2014, 7, 1006–1025. [Google Scholar] [CrossRef] [PubMed]
- Yoshimoto, K.; Noutoshi, Y.; Hayashi, K.; Shirasu, K.; Takahashi, T.; Motose, H. A chemical biology approach reveals an opposite action between thermospermine and auxin in xylem development in Arabidopsis thaliana. Plant Cell Physiol. 2012, 53, 635–645. [Google Scholar] [CrossRef] [PubMed]
- Cai, Q.; Fukushima, H.; Yamamoto, M.; Ishii, N.; Sakamoto, T.; Kurata, T.; Motose, H.; Takahashi, T. The SAC51 family plays a central role in thermospermine responses in Arabidopsis. Plant Cell Physiol. 2016, 57, 1583–1592. [Google Scholar] [CrossRef] [PubMed]
- Milhinhos, A.; Prestele, J.; Bollhoner, B.; Matos, A.; Vera-Sirera, F.; Rambla, J.L.; Ljung, K.; Carbonell, J.; Blázquez, M.A.; Tuominen, H.; et al. Thermospermine levels are controlled by an auxin-dependent feedback loop mechanism in Populus xylem. Plant J. 2013, 75, 685–698. [Google Scholar] [CrossRef] [PubMed]
- Mo, H.; Wang, X.; Zhang, Y.; Yang, J.; Ma, Z. Cotton ACAULIS5 is involved in stem elongation and the plant defense response to Verticillium dahliae through thermospermine alteration. Plant Cell Rep. 2015, 34, 1975–1985. [Google Scholar] [CrossRef] [PubMed]
- Do, P.T.; Degenkolbe, T.; Erban, A.; Heyer, A.G.; Kopka, J.; Köhl, K.I.; Hincha, D.K.; Zuther, E. Dissecting rice polyamine metabolism under controlled long-term drought stress. PLoS ONE 2013, 8, e60325. [Google Scholar] [CrossRef]
- Chen, M.; Chen, J.J.; Fang, J.Y.; Guo, Z.F.; Lu, S.Y. Down-regulation of S-adenosylmethionine decarboxylase genes results in reduced plant length, pollen viability, and abiotic stress tolerance. Plant Cell Tissue Org. 2014, 116, 311–322. [Google Scholar] [CrossRef]
- Saha, J.; Giri, K. Molecular phylogenomic study and the role of exogenous spermidine in the metabolic adjustment of endogenous polyamine in two rice cultivars under salt stress. Gene 2017, 609, 88–103. [Google Scholar] [CrossRef] [PubMed]
- Ge, C.; Cui, X.; Wang, Y.; Hu, Y.; Fu, Z.; Zhang, D.; Cheng, Z.; Li, J. BUD2, encoding an S-adenosylmethionine decarboxylase, is required for Arabidopsis growth and development. Cell Res. 2006, 16, 446–456. [Google Scholar] [CrossRef] [PubMed]
- Cui, X.; Ge, C.; Wang, R.; Wang, H.; Chen, W.; Fu, Z.; Jiang, X.; Li, J.; Wang, Y. The BUD2 mutation affects plant architecture through altering cytokinin and auxin responses in Arabidopsis. Cell Res. 2010, 20, 576–586. [Google Scholar] [CrossRef] [PubMed]
- Ono, Y.; Kim, D.W.; Watanabe, K.; Sasaki, A.; Niitsu, M.; Berberich, T.; Kusano, T.; Takahashi, Y. Constitutively and highly expressed Oryza sativa polyamine oxidases localize in peroxisomes and catalyze polyamine back conversion. Amino Acids 2012, 42, 867–876. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.; Kim, D.W.; Niitsu, M.; Berberich, T.; Kusano, T. Oryza sativa polyamine oxidase 1 back-converts tetraamines, spermine and thermospermine, to spermidine. Plant Cell Rep. 2014, 33, 143–151. [Google Scholar] [CrossRef] [PubMed]
- Chen, B.-X.; Li, W.-Y.; Gao, Y.-T.; Chen, Z.-J.; Zhang, W.-N.; Liu, Q.-J.; Chen, Z. Involvement of polyamine oxidase-produced hydrogen peroxide during coleorhiza-limited germination of rice seeds. Front Plant Sci. 2016, 7, 1219. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.B.; Kim, D.W.; Niitsu, M.; Maeda, S.; Watanabe, M.; Kamio, Y.; Berberich, T.; Kusano, T. Polyamine oxidase 7 is a terminal catabolism-type enzyme in Oryza sativa and is specifically expressed in anthers. Plant Cell Physiol. 2014, 55, 1110–1122. [Google Scholar] [CrossRef] [PubMed]
- Fincato, P.; Moschou, P.N.; Spedaletti, V.; Tavazza, R.; Angelini, R.; Federico, R.; Roubelakis-Angelakis, K.A.; Tavladoraki, P. Functional diversity inside the Arabidopsis polyamine oxidase gene family. J. Exp. Bot. 2011, 62, 1155–1168. [Google Scholar] [CrossRef] [PubMed]
- Fincato, P.; Moschou, P.N.; Ahou, A.; Angelini, R.; Roubelakis-Angelakis, K.A.; Federico, R.; Tavladoraki, P. The members of Arabidopsis thaliana PAO gene family exhibit distinct tissue and organ-specific expression pattern during seedling growth and flower development. Amino Acids 2012, 42, 831–841. [Google Scholar] [CrossRef]
- Ahou, A.; Martignago, D.; Alabdallah, O.; Tavazza, R.; Stano, P.; Macone, A.; Rambla, J.L.; Vera-Sirera, F.; Angelini, R.; Federico, R.; et al. A plant spermine oxidase/dehydrogenase regulated by the proteasome and polyamines. J. Exp. Bot. 2014, 65, 1585–1603. [Google Scholar] [CrossRef] [Green Version]
- Kim, D.W.; Watanabe, K.; Murayama, C.; Izawa, S.; Niitsu, M.; Michael, A.J.; Berberich, T.; Kusano, T. Polyamine oxidase 5 regulates Arabidopsis growth through thermospermine oxidase activity. Plant Physiol. 2014, 165, 1575–1590. [Google Scholar] [CrossRef] [PubMed]
- Alabdallah, O.; Ahou, A.; Mancuso, N.; Pompili, V.; Macone, A.; Pashkoulov, D.; Stano, P.; Cona, A.; Angelini, R.; Tavladoraki, P. The Arabidopsis polyamine oxidase/dehydrogenase 5 interferes with cytokinin and auxin signaling pathways to control xylem differentiation. J. Exp. Bot. 2017, 68, 997–1012. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.; Wook Kim, D.; Niitsu, M.; Berberich, T.; Kusano, T. POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5. Plant Signal Behav. 2014, 9, e29773. [Google Scholar] [CrossRef] [PubMed]
- Tong, W.; Yoshimoto, K.; Kakehi, J.I.; Motose, H.; Niitsu, M.; Takahashi, T. Thermospermine modulates expression of auxin-related genes in Arabidopsis. Front Plant Sci. 2014, 5, 94. [Google Scholar] [CrossRef] [PubMed]
- Prigge, M.J.; Otsuga, D.; Alonso, J.M.; Ecker, J.R.; Drews, G.N.; Clark, S.E. Class III homeodomain-leucine zipper gene family members have overlapping, antagonistic, and distinct roles in Arabidopsis development. Plant Cell 2005, 17, 61–76. [Google Scholar] [CrossRef] [PubMed]
- Itoh, J.; Hibara, K.; Sato, Y.; Nagato, Y. Developmental role and auxin responsiveness of class III homeodomain leucine zipper gene family members in rice. Plant Physiol. 2008, 147, 1960–1975. [Google Scholar] [CrossRef] [PubMed]
- Zheng, L.; Yamaji, N.; Yokosho, K.; Ma, J.F. YSL16 is a phloem-localized transporter of the copper-nicotianamine complex that is responsible for copper distribution in rice. Plant Cell 2012, 24, 3767–3782. [Google Scholar] [CrossRef]
- Kobayashi, N.I.; Yamaji, N.; Yamamoto, H.; Okubo, K.; Ueno, H.; Costa, A.; Tanoi, K.; Matsumura, H.; Fujii-Kashino, M.; Horiuchi, T.; et al. OsHKT1;5 mediates Na+ exclusion in the vasculature to protect leaf blades and reproductive tissues from salt toxicity in rice. Plant J. 2017, 91, 657–670. [Google Scholar] [CrossRef]
- Ishitsuka, S.; Yamamoto, M.; Miyamoto, M.; Kuwashiro, Y.; Imai, A.; Motose, H.; Takahashi, T. Complexity and conservation of thermospermine-responsive uORFs of SAC51 family genes in angiosperms. Front Plant Sci. 2019, 10, 564. [Google Scholar] [CrossRef]
- Ndayiragije, A.; Lutts, S. Do exogenous polyamines have an impact on the response of a salt-sensitive rice cultivar to NaCl? J. Plant Physiol. 2006, 163, 506–516. [Google Scholar] [CrossRef]
- Cona, A.; Rea, G.; Angelini, R.; Federico, R.; Tavladoraki, P. Functions of amine oxidases in plant development and defence. Trends Plant Sci. 2006, 11, 80–88. [Google Scholar] [CrossRef] [PubMed]
- Wimalasekera, R.; Tebartz, F.; Scherer, G.F. Polyamines, polyamine oxidases and nitric oxide in development, abiotic and biotic stresses. Plant Sci. 2011, 181, 593–603. [Google Scholar] [CrossRef] [PubMed]
- Moschou, P.N.; Wu, J.; Cona, A.; Tavladoraki, P.; Angelini, R.; Roubelakis-Angelakis, K.A. The polyamines and their catabolic products are significant players in the turnover of nitrogenous molecules in plants. J. Exp. Bot. 2012, 63, 5003–5015. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Quinet, M.; Ndayiragije, A.; Lefevre, I.; Lambillotte, B.; Dupont, G.C.C.; Lutts, S. Putrescine differently influences the effect of salt stress on polyamine metabolism and ethylene synthesis in rice cultivars differing in salt resistance. J. Exp. Bot. 2010, 61, 2719–2733. [Google Scholar] [CrossRef] [PubMed]
- Zarza, X.; Atanasov, K.E.; Marco, F.; Arbona, V.; Carrasco, P.; Kopka, J.; Fotopoulos, V.; Munnik, T.; Gómez-Cadenas, A.; Tiburcio, A.F.; et al. Polyamine Oxidase 5 loss-of-function mutations in Arabidopsis thaliana trigger metabolic and transcriptional reprogramming and promote salt stress tolerance. Plant Cell Environ. 2017, 40, 527–542. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.F.; Sun, S.S.M.; Yuan, D.Y.; Yu, H.X.; Gu, M.H.; Liu, Q.Q. Validation of candidate reference genes for the accurate normalization of real-time quantitative RT-PCR data in rice during seed development. Plant Mol. Biol. Rep. 2010, 28, 49–57. [Google Scholar] [CrossRef]
Gene Name | Locus ID | MSU ID | Primer Sequence |
---|---|---|---|
OsSPDS | Os07g0408700 | LOC_Os07g22600 | F: CAACATACCCTAGTGGTGTT |
R: CTAGTTGGCCTTGGATCCAA | |||
OsSPMS1 | Os06g0528600 | LOC_Os06g33710 | F: CCTGAAGGGAAATATGATGC |
R: AATGACACCACTAGGATAGG | |||
OsSPMS2 | Os02g0254700 | LOC_Os02g15550 | F: CGACATATCCCAGTGGTGTG |
R: CAATACGCCTCTAGCTCTCT | |||
OsACL5 | Os02t0237100 | LOC_Os02g14190 | F: AAGAGTAGGGAGAAGTTCGA |
R: GTGTATGCTTTGACATACTTGA | |||
OsSAMDC1 | Os04g0498600 | LOC_Os04g42095 | F: ACTCCAACTGCGCGAAGAAG |
R: CAGCAGCAGACAAGACACCC | |||
OsSAMDC2 | Os02g0611200 | LOC_Os02g39795 | F: GCTTACTCCAACTGCGCGAG |
R: CGCCGAGACCGGTGGAGAGT | |||
OsSAMDC3 | Os05g0141800 | LOC_Os05g04990 | F: GTGGTGGACGAGAATGACCC |
R: CTAGTTGTCATGCTCATGCT | |||
OsSAMDC4 | Os09g0424300 | LOC_Os09g25625 | F: TGCTTACTCCAACTGCGCTC |
R: CATAGCCTTCAAACCCAATG | |||
OsPAO1 | Os01g0710200 | LOC_Os01g51320 | F: TTCCTCGGGTCATACAGCTA |
R: CTACGTGGTGTGATTCGCTC | |||
OsPAO2 | Os03g0193400 | LOC_Os03g09810 | F: CCCAGATTCCAATGTTCTTC |
R: GCAGAGTCAATACCTGCAAG | |||
OsPAO3 | Os04g0623300 | LOC_Os04g53190 | F: CTGCCGAGCCGATACATTAC |
R: CATCTCCAGCATGTCCAGCT | |||
OsPAO4 | Os04g0671200 | LOC_Os04g57550 | F: CCACTGAACCTACGAAGTAT |
R: ATCTCCTCGTAGGCCTTGAC | |||
OsPAO5 | Os04g0671300 | LOC_Os04g57560 | F: GCTACTGAACCGGTCCAGTA |
R: GGAAAAGGTCGGAGATGCCT | |||
OsPAO6 | Os09g0368200 | LOC_Os09g20260 | F: ACGGAGTCTGGCAGGAGTTT |
R: CGCCCTGAGCTGGTCATAC | |||
OsPAO7 | Os09g0368500 | LOC_Os09g20284 | F: ACGGAGTCTGGCAGGAGTTT |
R: CGCCCTGAGCTGGTCATGT |
Gene Name | Locus ID | MSU ID | Primer Sequence |
---|---|---|---|
OsHB3 | Os12g0612700 | LOC_Os12g41860 | F: GATCATGCAGCAGGGTTTCA |
R: ATACGGTGGTGGTATTCAGG | |||
OsHB4 | Os03g0640800 | LOC_Os03g43930 | F: CTGCTCCCTGAAGGCTGCTC |
R: ATGACCAGTTGACGAACATG | |||
OsHB5 | Os01g0200300 | LOC_Os01g10320 | F: CAACATCATGGAGCAGGGGA |
R: TGTACACGCTGTTTCATGAG | |||
OsYSL16 | Os04g0542800 | LOC_Os04g45900 | F: CTTAACAACAGAGTGGCGGA |
R: AGAGCGCGATCTTGCCGTAG | |||
OsHKT1;5 | Os01g0307500 | LOC_Os01g20160 | F: CGAGGTTATCAGTGCGTATG |
R: GCATGGGTGCTTGCAGTTAG | |||
OsSACL2 | Os03g0391700 | LOC_Os03g27390 | F: CCCAAGATTGCCAGGCCGAG |
R: GGATCCCATCAAGAAACAACCA | |||
OsSACL3A | Os03g0591300 | LOC_Os03g39432 | F: GCAAGTGTGCCAGGCCGAAT |
R: AGATCTGGGAAAGCAGGAAATG | |||
OsSACL3B | Os02g0315600 | LOC_Os02g21090 | F: GTCATCGTGTGAGAGCAAG |
R: ACGTCACGGGCTTGAGAAG | |||
OsSACL3C | Os01g0626900 | LOC_Os01g43680 | F: CAAGTGTGCCAGGCTGAGTA |
R: GGATCCTCTACCTGATCTGATG | |||
OsACT1 | Os03g0718100 | LOC_Os03g50885 | F: CTCCCCCATGCTATCCTTCG |
R: CCATCAGGAAGCTCGTAGCT |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Miyamoto, M.; Shimao, S.; Tong, W.; Motose, H.; Takahashi, T. Effect of Thermospermine on the Growth and Expression of Polyamine-Related Genes in Rice Seedlings. Plants 2019, 8, 269. https://doi.org/10.3390/plants8080269
Miyamoto M, Shimao S, Tong W, Motose H, Takahashi T. Effect of Thermospermine on the Growth and Expression of Polyamine-Related Genes in Rice Seedlings. Plants. 2019; 8(8):269. https://doi.org/10.3390/plants8080269
Chicago/Turabian StyleMiyamoto, Minaho, Satoshi Shimao, Wurina Tong, Hiroyasu Motose, and Taku Takahashi. 2019. "Effect of Thermospermine on the Growth and Expression of Polyamine-Related Genes in Rice Seedlings" Plants 8, no. 8: 269. https://doi.org/10.3390/plants8080269