Expression of miR159 Is Altered in Tomato Plants Undergoing Drought Stress
Abstract
1. Introduction
2. Results and Discussion
2.1. Expression of miR159 in Tomato Plants Undergoing Drought Stress
2.2. Assessment of sly-miR159 Stress-Specific Targeting of SlMYB33
3. Conclusions
4. Materials and Methods
4.1. Plants
4.2. Total RNA Isolation and RT-qPCR Analysis
4.3. Small RNA Isolation and RT-PCR Analysis
4.4. Amino Acids and Polyamines Quantification
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Swann, A.L.S. Plants and drought in a changing climate. Curr. Clim. Chang. Rep. 2018, 4, 192–201. [Google Scholar] [CrossRef]
- Hossain, M.A.; Wani, S.H.; Bhattacharjee, S.; Burritt, D.J.; Tran, L.-S.P. Drought Stress Tolerance in Plants, 1st ed.; Springer International Publishing: Basel, Switzerland, 2016; Volume 2, ISBN 978-3-319-32421-0. [Google Scholar]
- Cutler, S.R.; Rodriguez, P.R.; Finkelstein, R.R.; Abrams, S.R. Abscisic acid: Emergence of a core signaling network. Annu. Rev. Plant Biol. 2010, 61, 651–679. [Google Scholar] [CrossRef] [PubMed]
- Ding, Y.; Tao, Y.; Zhu, C. Emerging roles of microRNAs in the mediation of drought stress response in plants. J. Exp. Bot. 2013, 64, 3077–3086. [Google Scholar] [CrossRef] [PubMed]
- Reyes, J.L.; Chua, N.-H. ABA induction of miR159 controls transcript levels of two MYB factors during Arabidopsis seed germination. Plant J. 2007, 49, 592–606. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.-H.; Tian, X.; Li, Y.-J.; Wu, C.-A.; Zheng, C.-C. Microarray-based analysis of stress-regulated microRNAs in Arabidopsis thaliana. RNA 2008, 14, 836–843. [Google Scholar] [CrossRef]
- Wei, L.; Zhang, D.; Xiang, F.; Zhang, Z. Differentially expressed miRNAs potentially involved in the regulation of defense mechanism to drought stress in maize seedlings. Int. J. Plant Sci. 2009, 170, 979–989. [Google Scholar] [CrossRef]
- Xie, F.; Wang, Q.; Sun, R.; Zhang, B. Deep sequencing reveals important roles of microRNAs in response to drought and salinity stress in cotton. J. Exp. Bot. 2015, 66, 789–804. [Google Scholar] [CrossRef]
- Yang, J.; Zhang, N.; Mi, X.; Wu, L.; Ma, R.; Zhu, X.; Yao, L.; Jin, X.; Si, H.; Wang, D. Identification of miR159s and their target genes and expression analysis under drought stress in potato. Comput. Biol. Chem. 2014, 53, 204–213. [Google Scholar] [CrossRef]
- Hackenberg, M.; Gustafson, P.; Langridge, P.; Shi, B.-J. Differential expression of microRNAs and other small RNAs in barley between water and drought conditions. Plant Biotechnol. J. 2015, 13, 2–13. [Google Scholar] [CrossRef]
- Li, Y.; Wan, L.; Bi, S.; Wan, X.; Li, Z.; Cao, J.; Tong, Z.; Xu, H.; He, F.; Li, X. Identification of drought-responsive microRNAs from roots and leaves of alfalfa by high-throughput sequencing. Genes 2017, 8, 119. [Google Scholar] [CrossRef]
- Pegler, J.L.; Grof, C.P.L.; Eamens, A.L. Profiling of the differential abundance of drought and salt stress-responsive microRNAs across grass crop and genetic model plant species. Agronomy 2018, 8, 118. [Google Scholar] [CrossRef]
- López-Galiano, M.J.; González-Hernández, A.I.; Crespo-Salvador, O.; Rausell, C.; Real, M.D.; Escamilla, M.; Camañes, G.; García-Agustín, P.; González-Bosch, C.; García-Robles, I. Epigenetic regulation of the expression of WRKY75 transcription factor in response to biotic and abiotic stresses in Solanaceae plants. Plant Cell Rep. 2018, 37, 167–176. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; Yu, H.; Zhao, G.; Huang, Q.; Lu, Y.; Ouyang, B. Profiling of drought-responsive microRNA and mRNA in tomato using high-throughput sequencing. BMC Genom. 2017, 18, 481. [Google Scholar] [CrossRef]
- Liu, M.; Yu, H.; Zhao, G.; Huang, Q.; Lu, Y.; Ouyang, B. Identification of drought-responsive microRNAs in tomato using high-throughput sequencing. Funct. Integr. Genom. 2018, 18, 67–78. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B. MicroRNA: A new target for improving plant tolerance to abiotic stress. J. Exp. Bot. 2015, 66, 1749–1761. [Google Scholar] [CrossRef]
- Allen, R.S.; Li, J.; Stahle, M.I.; Dubroué, A.; Gubler, F.; Millar, A.A. Genetic analysis reveals functional redundancy and the major target genes of the Arabidopsis miR159 family. Proc. Natl. Acad. Sci. USA 2007, 104, 16371–16376. [Google Scholar] [CrossRef]
- Woodger, F.J.; Millar, A.; Murray, F.; Jacobsen, J.V.; Gubler, F. The role of GAMYB transcription factors in GA-regulated gene expression. J. Plant Growth Regul. 2003, 22, 176–184. [Google Scholar] [CrossRef]
- Dai, X.; Zhao, P.X. psRNATarget: A plant small RNA target analysis server. Nucleic Acids Res. 2011, 39, W155–W159. [Google Scholar] [CrossRef]
- Zheng, Z.; Reichel, M.; Deveson, I.; Wong, G.; Li, J.; Millar, A.A. Target RNA secondary structure is a major determinant of miR159 efficacy. Plant Physiol. 2017, 174, 1764–1778. [Google Scholar] [CrossRef]
- Li, Z.; Peng, R.; Tian, Y.; Han, H.; Xu, J.; Yao, Q. Genome-wide identification and analysis of the MYB transcription factor superfamily in Solanum lycopersicum. Plant Cell Physiol. 2016, 57, 1657–1677. [Google Scholar] [CrossRef]
- Pieczynski, M.; Marczewski, W.; Hennig, J.; Dolata, J.; Bielewicz, D.; Piontek, P.; Wyrzykowska, A.; Krusiewicz, D.; Strzelczyk-Zyta, D.; Konopka-Postupolska, D.; et al. Down-regulation of CBP80 gene expression as a strategy to engineer a drought-tolerant potato. Plant Biotechnol. J. 2013, 11, 459–469. [Google Scholar] [CrossRef] [PubMed]
- Qin, Y.; Wang, M.; Tian, Y.; He, W.; Han, L.; Xia, G. Over-expression of TaMYB33 encoding a novel wheat MYB transcription factor increases salt and drought tolerance in Arabidopsis. Mol. Biol. Rep. 2012, 39, 7183–7192. [Google Scholar] [CrossRef] [PubMed]
- Tonon, G.; Kevers, C.; Faivre-Rampant, O.; Graziani, M.; Gaspar, T. Effect of NaCl and mannitol iso-osmotic stresses on proline and free polyamine levels in embryogenic Fraxinus angustifolia callus. J. Plant Physiol. 2004, 161, 701–708. [Google Scholar] [CrossRef] [PubMed]
- Alcázar, R.; Cuevas, J.C.; Patron, M.; Altabella, T.; Tiburcio, A.F. Abscisic acid modulates polyamine metabolism under water stress in Arabidopsis thaliana. Physiol. Plant 2006, 128, 448–455. [Google Scholar] [CrossRef]
- Pál, M.; Tajti, J.; Szalai, G.; Peeva, V.; Végh, B.; Janda, T. Interaction of polyamines, abscisic acid and proline under osmotic stress in the leaves of wheat plants. Sci. Rep. 2018, 8, 12839. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Reichel, M.; Li, Y.; Millar, A.A. The functional scope of plant microRNA-mediated silencing. Trends Plant Sci. 2014, 19, 750–756. [Google Scholar] [CrossRef] [PubMed]
- Hoagland, D.R.; Arnon, D.I. The water-culture method for growing plants without soil. Circ. Calif. Agric. Exp. Sta. 1950, 347, 1–32. [Google Scholar]
- Balcells, I.; Cirera, S.; Busk, P.K. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers. BMC Biotechnol. 2011, 11, 70. [Google Scholar] [CrossRef] [PubMed]
- Untergasser, A.; Nijveen, H.; Rao, X.; Bisseling, T.; Geurts, R.; Leunissen, J.A.M. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res. 2007, 35, W71–W74. [Google Scholar] [CrossRef]
- Ruijter, J.M.; Ramakers, C.; Hoogaars, W.M.H.; Karlen, Y.; Bakker, O.; van den Hoff, M.J.B.; Moorman, A.F.M. Amplification efficiency: Linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res. 2009, 37, e45. [Google Scholar] [CrossRef]
- Sánchez-López, J.; Camañes, G.; Flors, V.; Vicent, C.; Pastor, V.; Vicedo, B.; Cerezo, M.; García-Agustín, P. Underivatized polyamine analysis in plant samples by ion pair LC coupled with electrospray tandem mass spectrometry. Plant Physiol. Biochem. 2009, 47, 592–598. [Google Scholar] [CrossRef]





| Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Product Size (bp) |
|---|---|---|---|
| sly-miR159 | CGCAGTTTGGATTGAAGGGAG | CAGGTCCAGTTTTTTTTTTTTTTTTAGAG | 50 |
| SlMYB33 | TATGGGCATCCAGTCTCTCC | TGGGACTGGAAAAGATCGTC | 199 |
| SlMYB65 | TCTGCTGCATCGGTGTTTAG | TCTGGCCTGGGACAGATAAG | 164 |
| SlMYB104 | TTTCGGAATTGTTTGGAAGC | TGAAGAAGTTGCCGACAATG | 110 |
| SlMYB97 | CATGTCCCCTTGGAAGATTTAG | CTAGTGGCAAAGCAAAGTCATC | 181 |
| SlMYB120 | CACATTCCAGTCCAAACCAAC | CCTAGGTCGGAAGCACTGAG | 116 |
| SlP5CS | TGCTCAACAGGCCGGATATG | AAAGTGTGACCAAGGGGCTC | 126 |
| U6 snRNA | GGGGACATCCGATAAAATTGGAAC | TGGACCATTTCTCGATTTGTGC | 88 |
| RPS18 | GGGCATTCGTATTTCATAGTCAGAG | CGGTTCTTGATTAATGAAAACATCCT | 105 |
| Primer Pair | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Product Size (bp) |
|---|---|---|---|
| OFw, ORv | TATGGGCATCCAGTCTCTCC | TGGGACTGGAAAAGATCGTC | 199 |
| FFw, FRv | ATGACGGTTCTTTGCTTGCT | CTGTCTGGTTTTGGAGTGAAGG | 200 |
| RPS18FW, RPS18RV | GGGCATTCGTATTTCATAGTCAGAG | CGGTTCTTGATTAATGAAAACATCCT | 105 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
López-Galiano, M.J.; García-Robles, I.; González-Hernández, A.I.; Camañes, G.; Vicedo, B.; Real, M.D.; Rausell, C. Expression of miR159 Is Altered in Tomato Plants Undergoing Drought Stress. Plants 2019, 8, 201. https://doi.org/10.3390/plants8070201
López-Galiano MJ, García-Robles I, González-Hernández AI, Camañes G, Vicedo B, Real MD, Rausell C. Expression of miR159 Is Altered in Tomato Plants Undergoing Drought Stress. Plants. 2019; 8(7):201. https://doi.org/10.3390/plants8070201
Chicago/Turabian StyleLópez-Galiano, María José, Inmaculada García-Robles, Ana I. González-Hernández, Gemma Camañes, Begonya Vicedo, M. Dolores Real, and Carolina Rausell. 2019. "Expression of miR159 Is Altered in Tomato Plants Undergoing Drought Stress" Plants 8, no. 7: 201. https://doi.org/10.3390/plants8070201
APA StyleLópez-Galiano, M. J., García-Robles, I., González-Hernández, A. I., Camañes, G., Vicedo, B., Real, M. D., & Rausell, C. (2019). Expression of miR159 Is Altered in Tomato Plants Undergoing Drought Stress. Plants, 8(7), 201. https://doi.org/10.3390/plants8070201

