Life Cycle and Genetic Diversity of Symplocarpus nipponicus (Araceae), an Endangered Species in Japan
Abstract
1. Introduction
2. Results
2.1. Life Cycle and Morphology of S. nipponicus
2.2. Genetic Variation of S. nipponicus in Kyoto
3. Discussion
4. Materials and Methods
4.1. Populations of S. nipponicus
4.2. DNA Extraction and Development of Microsatellite Markers
4.3. Phylogenetic Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Otsuka, K.; Watanabe, R.; Inoue, K. A new species of Symplocarpus (Araceae) from Nagano prefecture, central Japan. J. Jpn. Bot. 2002, 77, 96–100. [Google Scholar]
- Nie, Z.L.; Sun, H.; Li, H.; Wen, J. Intercontinental biogeography of subfamily Orontioideae (Symplocarpus, Lysichiton, and Orontium) of Araceae in eastern Asia and North America. Mol. Phylogenet. Evol. 2006, 40, 155–165. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, S.; Lee, S.; Heo, K.; Kim, S.C. Palynological insights of the eastern Asian and eastern North American disjunct genus Symplocarpus (Araceae). J. Plant Res. 2010, 123, 723–729. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wen, J. Evolution of the Eastern Asian and Eastern North American disjunct genus Symplocarpus (Araceae): Insights from chloroplast DNA restriction site data. Biochem. Syst. Ecol. 1996, 24, 735–747. [Google Scholar] [CrossRef]
- Kitano, S.; Otsuka, K.; Uesugi, R.; Goka, K. Molecular phylogenetic analysis of the genus Symplocarpus (Araceae) from Japan based on chloroplast DNA sequences. J. Jpn. Bot. 2005, 80, 334–339. [Google Scholar]
- Toro, M.A.; Caballero, A. Characterization and conservation of genetic diversity in subdivided populations. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2005, 360, 1367–1378. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zane, L.; Bargelloni, L.; Patarnello, T. Strategies for microsatellite isolation: A review. Mol. Ecol. 2002, 11, 1–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arif, I.A.; Bakir, M.A.; Khan, H.A.; Al Farhan, A.H.; Al Homaidan, A.A.; Bahkali, A.H.; Al Sadoon, M.; Shobrak, M. A brief review of molecular techniques to assess plant diversity. Int. J. Mol. Sci. 2010, 11, 2079–2096. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wada, N.; Uemura, S. Seed dispersal and predation by small rodents on the herbaceous understory plant Symplocarpus renifolius. Am. Midl. Nat. 1994, 132, 320–327. [Google Scholar] [CrossRef] [Scilit]
- Nei, M.; Tajima, F.; Tateno, Y. Accuracy of estimated phylogenetic trees from molecular data. II. Gene frequency data. J. Mol. Evol. 1983, 19, 153–170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seymour, R.S.; Ito, Y.; Onda, Y.; Ito, K. Effects of floral thermogenesis on pollen function in Asian skunk cabbage Symplocarpus renifolius. Biol. Lett. 2009, 5, 568–570. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ito-Inaba, Y. Thermogenesis in skunk cabbage (Symplocarpus renifolius): New insights from the ultrastructure and gene expression profiles. Adv. Hortic. Sci. 2014, 28, 73–78. [Google Scholar]
- Karron, J.D. A comparison of levels of genetic polymorphism and self-compatibility in geographically restricted and widespread plant congeners. Evol. Ecol. 1987, 1, 47–58. [Google Scholar] [CrossRef] [Scilit]
- Aguilar, R.; Quesada, M.; Ashworth, L.; Herrerias-Diego, Y.; Lobo, J. Genetic consequences of habitat fragmentation in plant populations: Susceptible signals in plant traits and methodological approaches. Mol. Ecol. 2008, 17, 5177–5188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nunome, T.; Negoro, S.; Miyatake, K.; Yamaguchi, H.; Fukuoka, H. A protocol for the construction of microsatellite enriched genomic library. Plant Mol. Biol. Rep. 2006, 24, 305–312. [Google Scholar] [CrossRef] [Scilit]
- Rousset, F. GENEPOP’007: A complete re-implementation of the GENEPOP software for Windows and Linux. Mol. Ecol. Resour. 2008, 8, 103–106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peakall, R.; Smouse, P.E. GenALEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hubisz, M.J.; Falush, D.; Stephens, M.; Pritchard, J.K. Inferring weak population structure with the assistance of sample group information. Mol. Ecol. Resour. 2009, 9, 1322–1332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Locus | Primer Sequence (5′→3′) | Tm (°C) | Repeat Motif | Allelic Size Range (bp) | NA | HE | HO | FIS | Accession Number |
|---|---|---|---|---|---|---|---|---|---|
| SniAlu_CA08-1 | F:TAAGGGAGTTGATATCACTACC R:CACCTTCATGATAATAGTATAGGGT | 55 | (CT)15 | 145–149 | 2.000 | 0.180 | 0.126 | 0.301 | LC342874 * |
| SniAlu_CA08-2 | F:TAAGGGAGTTGATATCACTACC R:CACCTTCATGATAATAGTATAGGGT | 55 | (CT)15 | 153–193 | 2.333 | 0.198 | 0.167 | 0.160 | |
| SniAlu_CA12 | F:ATCCTGACATTGACATCCCAC R:ATACATTGCGTACAGAACACAAATAC | 56 | (CA)16 | 173–187 | 2.667 | 0.294 | 0.192 | 0.345 | LC342875 |
| SniAlu_CA14 | F:ATGTGTGCATGTGCCCTTTAAC R:GTGTTCTTCTATGCACATGTAGG | 57 | (TG)14 | 202–217 | 2.667 | 0.268 | 0.192 | 0.282 | LC342876 |
| SniAlu_CA15 | F:GACTTTGCTTTGTGAACACATGG R:TGGTGATACTTTATGTGGTGCCT | 57 | (AG)24 | 142–171 | 2.667 | 0.257 | 0.184 | 0.284 | LC342877 |
| SniAlu_CA28 | F:GGCCTTCTCCACGCTAAAAT R:TAAGCCATAATTGCCGACAC | 56 | (CT)16 | 142–155 | 1.667 | 0.133 | 0.109 | 0.187 | LC342878 |
| SniAlu_CA36 | F:CTTCCAAATAACAAAGAGTGTCCAC R:CTTCCATCGCCATCATCATATC | 57 | (GA)23 | 163–189 | 2.667 | 0.376 | 0.177 | 0.530 | LC342879 |
| SniAlu_GA02 | F:GGGTAGGACAAGGCATCAATA R:CAATGGGGGATCTTTTTTAGGG | 57 | (AG)25(CCCCATCAC)1(AG)28 | 175–231 | 5.333 | 0.585 | 0.243 | 0.585 | LC342880 |
| SniAlu_GA04 | F:TTCTGGAGGCTTTCTCTTCATG R:GCAATTCCTGTCAAGGTATCAATG | 57 | (CT)9(GTCTGT)1(CT)2(T)1(CT)7 | 207–213 | 1.667 | 0.207 | 0.200 | 0.032 | LC342881 |
| SniAlu_GA08 | F:GGAAGGGTATAGGCAATTTGTAGG R:TGATCGTTAAGGTCGTCAACCA | 57 | (GA)9,AA(GA)10 | 144–152 | 2.333 | 0.195 | 0.102 | 0.478 | LC342882 |
| SniAlu_GA15 | F:CATGATATCACTCTCCCTGTTC R:CACTAGTTACATGCTTCCACTTG | 57 | (CT)27 | 123–153 | 2.667 | 0.322 | 0.218 | 0.323 | LC342883 |
| Mean | 2.606 | 0.274 | 0.174 | 0.319 |
| Locus | Ayabe (n = 39) | Momoi (n = 13) | Hanase (n = 10) | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| NA | HE | HO | FIS | NA | HE | HO | FIS | NA | HE | HO | FIS | |
| SniAlu_CA08-1 | 1.000 | 0.000 | 0.000 | N.A. a | 2.000 | 0.077 | 0.077 | 0.000 | 3.000 | 0.500 | 0.300 | 0.400 |
| SniAlu_CA08-2 | 1.000 | 0.000 | 0.000 | N.A. a | 1.000 | 0.000 | 0.000 | N.A. a | 5.000 | 0.633 | 0.500 | 0.211 |
| SniAlu_CA12 | 1.000 | 0.000 | 0.000 | N.A. a | 2.000 | 0.333 | 0.077 | 0.769 | 5.000 | 0.606 | 0.500 | 0.174 |
| SniAlu_CA14 | 1.000 | 0.000 | 0.000 | N.A. a | 2.000 | 0.077 | 0.077 | 0.000 | 5.000 | 0.783 | 0.500 | 0.362 |
| SniAlu_CA15 | 2.000 | 0.051 | 0.051 | −0.013 | 1.000 | 0.000 | 0.000 | N.A. a | 5.000 | 0.772 | 0.500 | 0.353 |
| SniAlu_CA28 | 2.000 | 0.026 | 0.026 | 0.000 | 1.000 | 0.000 | 0.000 | N.A. a | 2.000 | 0.400 | 0.300 | 0.250 |
| SniAlu_CA36 | 1.000 | 0.000 | 0.000 | N.A. a | 4.000 | 0.785 | 0.231 | 0.706 *** | 3.000 | 0.422 | 0.300 | 0.290 |
| SniAlu_GA02 | 4.000 | 0.279 | 0.051 | 0.816 *** | 5.000 | 0.731 | 0.077 | 0.895 *** | 7.000 | 0.861 | 0.600 | 0.303 |
| SniAlu_GA04 | 1.000 | 0.000 | 0.000 | N.A. a | 1.000 | 0.000 | 0.000 | N.A. a | 3.000 | 0.656 | 0.600 | 0.085 |
| SniAlu_GA08 | 3.000 | 0.192 | 0.051 | 0.733 *** | 2.000 | 0.147 | 0.154 | −0.044 | 2.000 | 0.278 | 0.100 | 0.640 |
| SniAlu_GA15 | 1.000 | 0.000 | 0.000 | N.A. a | 2.000 | 0.455 | 0.154 | 0.662 | 5.000 | 0.572 | 0.500 | 0.126 |
| K | Reps | Mean LnP (K) | Stdev LnP (K) | Delta K |
|---|---|---|---|---|
| 1 | 10 | −1393.9200 | 0.5073 | N.A. a |
| 2 | 10 | −731.0800 | 1.5194 | 303.032579 |
| 3 | 11 | −528.6545 | 64.19127 | 3.247736 |
| 4 | 10 | −534.7100 | 10.7532 | 1.580497 |
| 5 | 10 | −523.7700 | 12.5947 | NA |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Takeda, S.; Onishi, Y.; Fukui, Y.; Ohsako, T.; Kubo, N. Life Cycle and Genetic Diversity of Symplocarpus nipponicus (Araceae), an Endangered Species in Japan. Plants 2018, 7, 73. https://doi.org/10.3390/plants7030073
Takeda S, Onishi Y, Fukui Y, Ohsako T, Kubo N. Life Cycle and Genetic Diversity of Symplocarpus nipponicus (Araceae), an Endangered Species in Japan. Plants. 2018; 7(3):73. https://doi.org/10.3390/plants7030073
Chicago/Turabian StyleTakeda, Seiji, Yusuke Onishi, Yoshio Fukui, Takanori Ohsako, and Nakao Kubo. 2018. "Life Cycle and Genetic Diversity of Symplocarpus nipponicus (Araceae), an Endangered Species in Japan" Plants 7, no. 3: 73. https://doi.org/10.3390/plants7030073
APA StyleTakeda, S., Onishi, Y., Fukui, Y., Ohsako, T., & Kubo, N. (2018). Life Cycle and Genetic Diversity of Symplocarpus nipponicus (Araceae), an Endangered Species in Japan. Plants, 7(3), 73. https://doi.org/10.3390/plants7030073

