Research on the Physiological Response Mechanism and Expression of Key Leaf Color Genes in ‘Duojiao’ Crabapple Under Partial Shading
Abstract
1. Introduction
2. Results and Analysis
2.1. Effects of Partial Shading Treatment on Physiological Characteristics of Crabapple
2.1.1. Effects on Photosynthetic and Fluorescence Characteristics
2.1.2. Effects on Mineral Element Content
2.1.3. Effects on Chlorophyll Content
2.1.4. Effects on the Antioxidant System and Key Enzymes in Chlorophyll Metabolism
2.1.5. Effects on the Expression of Key Leaf Color Genes
2.2. Cloning and Bioinformatics Analysis of Key Leaf Color Genes
2.3. Functional Validation of Key Leaf Color Genes
2.3.1. Effects of VIGS Silencing on Plant Crabapple and Chlorophyll Content
2.3.2. Effects of Overexpression on Arabidopsis Crabapple and Chlorophyll Content
3. Discussion
4. Materials and Methods
4.1. Experimental Materials
4.2. Experimental Design
4.2.1. Partial Shading Treatment
4.2.2. Gene Functional Validation Experiment
4.3. Experimental Methods
4.3.1. Determination of Physiological Indices
4.3.2. Molecular Biology Determinations
4.4. Data Statistics and Analysis
5. Conclusions
- Partial shading (30% to 35%) increased photosynthetic efficiency and chlorophyll content in ‘Duojiao’ crabapple leaves, improving their light resistance and enabling them to turn green earlier.
- Chlorophyll synthesis and leaf color were regulated by the genes MsCAO, MsCPOX, and MsGLK1, with MsCPOX exhibiting the greatest positive effect on plant growth.
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
| Primer Used in This Study | Primer Sequence (5′-3′) | Purpose |
|---|---|---|
| MsCAO-pRI101-F | ttgatacatatgcccgtcgacATGAGTCTGTCAGCTTCAAACGC | gene cloning |
| MsCAO-pRI101-R | tcagaattcggtacccccgggAGTTGATTTGGTGAAGGGTAGTTGT | |
| MsCPOX-pRI101-F | GttgatacatatgcccgtcgacATGGCGACTGCAGTGCTACC | gene cloning |
| MsCPOX-pRI101-R | tcagaattcggtacccccgggCACAAGATGTTTCACCATGTAAGGT | |
| MsGLK1-pRI101-F | ttgatacatatgcccgtcgacATGCTTATTTTATCACCTTTGCGG | gene cloning |
| MsGLK1-pRI101-R | tcagaattcggtacccccgggGGCACAGGAGAGTGGTATTTTTG | |
| MsCAO-pTRV2-F | taaggttaccgaattcTGATGTGGAGGATCCGAGGT | gene cloning |
| MsCAO-pTRV2-R | agacgcgtgagctcggtaccTCCACGAAAGAGAACCCACG | |
| MsCPOX-pTRV2-F | taaggttaccgaattcTCCGAGCCATAGCCGAAATC | gene cloning |
| MsCPOX-pTRV2-R | agacgcgtgagctcggtaccACGCAAATATTCCCGGTGGT | |
| MsGLK1-pTRV2-F | taaggttaccgaattcTTTCCGGGGGAATGGGAATG | gene cloning |
| MsGLK1-pTRV2-R | AgacgcgtgagctcggtaccAGCTGCTGCCCCATACATTT | |
| RT-MsCAO-F | GCGGCGGGAACTGTTTATTG | semi-quantitative/ qRT-PCR |
| RT-MsCAO-R | ACAACATGTAATTGGGTGGTGGT | |
| RT-MsCPOX-F | CGGATGGAAGACTTGGGCTT | semi-quantitative/ qRT-PCR |
| RT-MsCPOX-R | AGCACTTCCCCATGAGTTCG | |
| RT-GLK1-F | CTCCTGTGCCTGATGGTGT | semi-quantitative/ qRT-PCR |
| RT-GLK1-R | AGGCAGAAGAATGACGGGC | |
| RT-MdActin-F | TGACCGAATGAGCAAGGAAATTACT | semi-quantitative/ qRT-PCR |
| RT-MdActin-R | TACTCAGCTTTGGCAATCCACATC |
References
- Tian, D.; Xiao, Y.; Tong, Y.; Fu, N.; Liu, Q.; Li, C. Diversity and conservation of Chinese wild begonias. Plant Divers. 2018, 40, 75–90. [Google Scholar] [CrossRef]
- Ning, K.; Li, B.; Nie, H.; Liao, S.Q.; Chen, S.R.; Yang, X.Q.; Zhang, W.X.; Kassaby, E. Phenotypic Diversity and Ornamental Evaluation Between Introduced and Domestically Bred Crabapple Germplasm. Horticulturae 2025, 11, 1527. [Google Scholar] [CrossRef]
- Zhang, L.; Mao, Y.; Wang, Y.; Yang, L.; Yin, Y.J.; Shen, X. Malus spectabilis ‘Duojiao’: A New Yellow-leaf Cultivar. HortScience 2020, 55, 1155–1158. [Google Scholar] [CrossRef]
- Bai, B.; Wang, Z.; Chen, J. Shaping the solar future: An analysis of policy evolution, prospects and implications in China’s photovoltaic industry. Energy Strategy Rev. 2024, 54, 101474. [Google Scholar] [CrossRef]
- Zhang, H.; Guo, F.; Liu, K.; Wang, J.; Dong, J.; Zhu, P. Spatial differences in thermal comfort in summer in coastal areas: A study on Dalian, China. Front. Public Health 2022, 10, 1024757. [Google Scholar] [CrossRef]
- Hornyák, M.; Dziurka, M.; Kula-Maximenko, M.; Pastuszak, J.; Szczerba, A.; Szklarczyk, M.; Płażek, A. Photosynthetic efficiency, growth and secondary metabolism of common buckwheat (Fagopyrum esculentum Moench) in different controlled-environment production systems. Sci. Rep. 2022, 12, 257. [Google Scholar] [CrossRef]
- Martinez-Garcia, J.F.; Rodriguez-Concepcion, M. Molecular mechanisms of shade tolerance in plants. New Phytol. 2023, 239, 1190–1202. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Jafari, F.; Wang, H. Integration of light and hormone signaling pathways in the regulation of plant shade avoidance syndrome. aBIOTECH 2021, 2, 131–145. [Google Scholar] [CrossRef]
- Zhu, Y.; Yuan, G.; Wang, Y.; An, G.; Li, W.; Liu, J.; Sun, D. Mapping and functional verification of leaf yellowing genes in watermelon during whole growth period. Front. Plant Sci. 2022, 13, 1049114. [Google Scholar] [CrossRef]
- Yang, F.; Fan, Y.; Wu, X.; Cheng, Y.; Liu, Q.; Feng, L.; Chen, J.; Wang, Z.; Wang, X.; Yong, T.; et al. Auxin-to-Gibberellin Ratio as a Signal for Light Intensity and Quality in Regulating Soybean Growth and Matter Partitioning. Front. Plant Sci. 2018, 9, 56. [Google Scholar] [CrossRef]
- Xie, D.; Hao, M.; Zhao, L.; Chen, X.; Chen, X.; Jiang, B.; Ning, S.; Yuan, Z.; Zhang, L.; Shu, K.; et al. Transcriptomic analysis provides insight into the genetic regulation of shade avoidance in Aegilops tauschii. BMC Plant Biol. 2023, 23, 336. [Google Scholar] [CrossRef]
- Wang, T.; Li, L.; Cheng, G.; Shu, X.; Wang, N.; Zhang, F.; Zhuang, W.; Wang, Z. Physiological and Molecular Analysis Reveals the Differences of Photosynthesis between Colored and Green Leaf Poplars. Int. J. Mol. Sci. 2021, 22, 8982. [Google Scholar] [CrossRef]
- Cao, H.; Li, H.; Lu, L.; Ji, Y.; Ma, L.; Li, S. Screening and Validation of Internal Reference Genes for Quantitative Real-Time PCR Analysis of Leaf Color Mutants in Dendrobium officinale. Genes 2023, 14, 1112. [Google Scholar] [CrossRef] [PubMed]
- Kunugi, M.; Takabayashi, A.; Tanaka, A. Evolutionary changes in chlorophyllide a oxygenase (CAO) structure contribute to the acquisition of a new light-harvesting complex in micromonas. J. Biol. Chem. 2013, 288, 19330–19341. [Google Scholar] [CrossRef]
- Wang, J.; Yu, Q.; Xiong, H.; Wang, J.; Chen, S.; Yang, Z.; Dai, S. Proteomic Insight into the Response of Arabidopsis Chloroplasts to Darkness. PLoS ONE 2016, 11, e0154235. [Google Scholar] [CrossRef]
- Kobayashi, K.; Fujii, S.; Sasaki, D.; Baba, S.; Ohta, H.; Masuda, T.; Wada, H. Transcriptional regulation of thylakoid galactolipid biosynthesis coordinated with chlorophyll biosynthesis during the development of chloroplasts in Arabidopsis. Front. Plant Sci. 2014, 5, 272. [Google Scholar] [CrossRef] [PubMed]
- Wu, W.; Chen, L.; Liang, R.; Huang, S.; Li, X.; Huang, B.; Luo, H.; Zhang, M.; Wang, X.; Zhu, H. The role of light in regulating plant growth, development and sugar metabolism: A review. Front. Plant Sci. 2025, 15, 1507628. [Google Scholar] [CrossRef]
- Babst-Kostecka, A.; Przybyłowicz, W.J.; Seget, B.; Mesjasz-Przybyłowicz, J. Zinc allocation to and within Arabidopsis halleri seeds: Different strategies of metal homeostasis in accessions under divergent selection pressure. Plant Environ. Interact. 2020, 1, 207–220. [Google Scholar] [CrossRef] [PubMed]
- Jing, X.; Chen, P.; Jin, X.; Lei, J.; Wang, L.; Chai, S.; Yang, X. Physiological, Photosynthetic, and Transcriptomics Insights into the Influence of Shading on Leafy Sweet Potato. Genes 2023, 14, 2112. [Google Scholar] [CrossRef]
- Liang, X.G.; Gao, Z.; Shen, S.; Paul, M.J.; Zhang, L.; Zhao, X.; Lin, S.; Wu, G.; Chen, X.M.; Zhou, S.L. Differential ear growth of two maize varieties to shading in the field environment: Effects on whole plant carbon allocation and sugar starvation response. J. Plant Physiol. 2020, 251, 153194. [Google Scholar] [CrossRef]
- Ntawuhiganayo, E.B.; Uwizeye, F.K.; Zibera, E.; Dusenge, M.E.; Ziegler, C.; Ntirugulirwa, B.; Nsabimana, D.; Wallin, G.; Uddling, J. Traits controlling shade tolerance in tropical montane trees. Tree Physiol. 2020, 40, 183–197. [Google Scholar] [CrossRef]
- Wu, Y.; Gong, W.; Wang, Y.; Yong, T.; Yang, F.; Liu, W.; Wu, X.; Du, J.; Shu, K.; Liu, J.; et al. Leaf area and photosynthesis of newly emerged trifoliolate leaves are regulated by mature leaves in soybean. J. Plant Res. 2018, 131, 671–680. [Google Scholar] [CrossRef]
- Brouwer, B.; Gardeström, P.; Keech, O. In response to partial plant shading, the lack of phytochrome A does not directly induce leaf senescence but alters the fine-tuning of chlorophyll biosynthesis. J. Exp. Bot. 2014, 65, 4037–4049. [Google Scholar] [CrossRef] [PubMed]
- Huber, M.; Nieuwendijk, N.M.; Pantazopoulou, C.K.; Pierik, R. Light signalling shapes plant-plant interactions in dense canopies. Plant Cell Environ. 2021, 44, 1014–1029. [Google Scholar] [CrossRef]
- Liu, C.; Guo, X.; Wang, K.; Sun, Y.; Li, W.; Liu, Q.; Liu, Q. Nitrogen deposition does not alleviate the adverse effects of shade on Camellia japonica (Naidong) seedlings. PLoS ONE 2018, 13, e0201896. [Google Scholar] [CrossRef]
- Chen, S.; Zou, Y.; Qi, Q.; Zhao, C.; Liu, S.; Qiao, J.; Yu, Y.; Zhao, J.; Li, S.; Zou, Y.; et al. Moderate Shading Improves Growth, Photosynthesis, and Physiological Traits in Spuriopinella brachycarpa (Kom.) Kitag. Plants 2025, 14, 3824. [Google Scholar] [CrossRef] [PubMed]
- Iram, S.; Sajad, H.; Ali, M.R.; Feng, Y. Crop photosynthetic response to light quality and light intensity. J. Integr. Agric. 2021, 20, 4–23. [Google Scholar] [CrossRef]
- Wang, Y.N.; Dong, L.N.; Ding, Y.F.; Li, H.; Song, P.; Cai, H.; Xu, Z.H. Effects of shading on photosynthetic characteristics and chlorophyll fluorescence parameters of four Corydalis species. Ying Yong Sheng Tai Xue Bao 2020, 31, 769–777. [Google Scholar]
- Li, Z.; Zhao, T.; Liu, J.; Li, H.; Liu, B. Shade-Induced Leaf Senescence in Plants. Plants 2023, 12, 1550. [Google Scholar] [CrossRef]
- Shen, S.; Xu, G.; Li, D.; Yang, S.; Jin, G.; Liu, S.; Clements, D.R.; Chen, A.; Rao, J.; Wen, L.; et al. Potential use of Helianthus tuberosus to suppress the invasive alien plant Ageratina adenophora under different shade levels. BMC Ecol. Evol. 2021, 21, 85. [Google Scholar] [CrossRef]
- Peavey, M.; Scalisi, A.; Islam, S.M.; Goodwin, I. Fruit Position, Light Exposure and Fruit Surface Temperature Affect Colour Expression in a Dark-Red Apple Cultivar. Horticulturae 2024, 10, 725. [Google Scholar] [CrossRef]
- Juillion, P.; Lopez, G.; Fumey, D.; Lesniak, V.; Génard, M.; Vercambre, G. Combining field experiments under an agrivoltaic system and a kinetic fruit model to understand the impact of shading on apple carbohydrate metabolism and quality. Agrofor. Syst. 2024, 98, 2829–2846. [Google Scholar] [CrossRef]
- Edrisi, B.; Khalaj, M.A.; Esmaeili, S.; Sayyad-Amin, P. Study of the effects of photoselective shades on growth quality, nutrient absorption and biochemical indices of Polianthes. Sci. Rep. 2026, 16, 10377. [Google Scholar] [CrossRef]
- Jeong, K.Y.; Pasian, C.C.; Tay, D. Response of Six Begonia Species to Different Shading Levels. Acta Hortic. 2007, 761, 215–220. [Google Scholar] [CrossRef]
- Ruberti, I.; Sessa, G.; Ciolfi, A.; Possenti, M.; Carabelli, M.; Morelli, G. Plant adaptation to dynamically changing environment: The shade avoidance response. Biotechnol. Adv. 2012, 30, 1047–1058. [Google Scholar] [CrossRef]
- Gao, L.L.; Dong, Y.; Cun, Z.; Zhang, J.Y.; Chen, J.W. Moderate shading elicits succinic acid accumulation aligning with simultaneous expression of genes involved in TCA cycle and photosynthetic pathway in a medicinal plant Pinellia ternata. Plant Physiol. Biochem. 2025, 224, 109911. [Google Scholar] [CrossRef] [PubMed]
- Cheng, H.; Wang, X.; Wang, J.; Li, Q. Key photoprotective pathways of a shade-tolerant plant (Alpinia oxyphylla) for precipitation patterns change during the dry season: Thermal energy dissipation and water-water cycle. Plant Stress 2021, 2, 100016. [Google Scholar] [CrossRef]
- Yamatani, H.; Ito, T.; Nishimura, K.; Yamada, T.; Sakamoto, W.; Kusaba, M. Genetic analysis of chlorophyll synthesis and degradation regulated by Balance of Chlorophyll Metabolism. Plant Physiol. 2022, 189, 419–432. [Google Scholar] [CrossRef]
- Yue, C.; Wang, Z.; Yang, P. Review: The effect of light on the key pigment compounds of photosensitive etiolated tea plant. Bot. Stud. 2021, 62, 21. [Google Scholar] [CrossRef]
- Sekhar, S.; Panda, D.; Kumar, J.; Mohanty, N.; Biswal, M.; Baig, M.J.; Kumar, A.; Umakanta, N.; Samantaray, S.; Pradhan, S.K.; et al. Comparative transcriptome profiling of low light tolerant and sensitive rice varieties induced by low light stress at active tillering stage. Sci. Rep. 2019, 9, 5753. [Google Scholar] [CrossRef]
- Wang, P.; Grimm, B. Connecting Chlorophyll Metabolism with Accumulation of the Photosynthetic Apparatus. Trends Plant Sci. 2021, 26, 484–495. [Google Scholar] [CrossRef]
- Chen, J.; Wu, S.; Dong, F.; Li, J.; Zeng, L.; Tang, J.; Gu, D. Mechanism Underlying the Shading-Induced Chlorophyll Accumulation in Tea Leaves. Front. Plant Sci. 2021, 12, 779819. [Google Scholar] [CrossRef]
- Therby-Vale, R.; Lacombe, B.; Rhee, S.Y.; Nussaume, L.; Rouached, H. Mineral nutrient signaling controls photosynthesis: Focus on iron deficiency-induced chlorosis. Trends Plant Sci. 2022, 27, 502–509. [Google Scholar] [CrossRef]
- Amerian, M.; Palangi, A.; Gohari, G.; Ntatsi, G. Enhancing salinity tolerance in cucumber through Selenium biofortification and grafting. BMC Plant Biol. 2024, 24, 24. [Google Scholar] [CrossRef]
- Petrillo, E.; Godoy Herz, M.A.; Barta, A.; Kalyna, M.; Kornblihtt, A.R. Let there be light: Regulation of gene expression in plants. RNA Biol. 2014, 11, 1215–1220. [Google Scholar] [CrossRef]
- Poirier, M.C.; Wright, R.; Cvetkovska, M. Chlorophyllide a Oxygenase (CAO) Gene Duplication Across the Viridiplantae. J. Mol. Evol. 2025, 93, 620–635. [Google Scholar] [CrossRef]
- Li, X.; Zhang, W.; Niu, D.; Liu, X. Effects of abiotic stress on chlorophyll metabolism. Plant Sci. 2024, 342, 112030. [Google Scholar] [CrossRef] [PubMed]
- Tachibana, R.; Abe, S.; Marugami, M.; Yamagami, A.; Akema, R.; Ohashi, T.; Nishida, K.; Nosaki, S.; Miyakawa, T.; Tanokura, M.; et al. BPG4 regulates chloroplast development and homeostasis by suppressing GLK transcription factors and involving light and brassinosteroid signaling. Nat. Commun. 2024, 15, 370. [Google Scholar] [CrossRef]
- Zhang, D.; Tan, W.; Yang, F.; Han, Q.; Deng, X.; Guo, H.; Liu, B.; Yin, Y.; Lin, H. A BIN2-GLK1 Signaling Module Integrates Brassinosteroid and Light Signaling to Repress Chloroplast Development in the Dark. Dev. Cell 2021, 56, 310–324. [Google Scholar] [CrossRef] [PubMed]
- Jia, L.; Xiao, Z.; Yang, S.; Yang, Y.; Wu, D.; Zhang, H. Comprehensive genomic identification and expression analysis of the U-box gene family and its association with pigment biosynthesis in pepper. Sci. Hortic. 2026, 357, 114626. [Google Scholar] [CrossRef]
- Li, G.; Chen, X.; Zhao, Y.; Zhao, D. Gene expression regulation of the effect of shading on chlorophyll content in Fuding white tea (Camellia sinensis L.). Tree Physiol. 2025, 45, tpae049. [Google Scholar] [CrossRef]
- Wang, P.; Richter, A.S.; Kleeberg, J.R.W.; Geimer, S.; Grimm, B. Post-translational coordination of chlorophyll biosynthesis and breakdown by BCMs maintains chlorophyll homeostasis during leaf development. Nat. Commun. 2020, 11, 1254. [Google Scholar] [CrossRef]
- Proß, T.; Bruelheide, H.; Haider, S. Within-individual leaf trait response to local light availability and biodiversity in a subtropical forest experiment. Ecology 2025, 106, 70160. [Google Scholar] [CrossRef]
- Yu, L.; Bu, L.; Li, D.; Zhu, K.; Zhang, Y.; Wu, S.; Chang, L.; Ding, X.; Jiang, Y. Effects of Far-Red Light and Ultraviolet Light-A on Growth, Photosynthesis, Transcriptome, and Metabolome of Mint (Mentha haplocalyx Briq.). Plants 2024, 13, 3495. [Google Scholar] [CrossRef]
- Xiao, X.; Duan, B.; Huang, F.; Zhi, X.; Jiang, Z.; Ma, N. Analysis of canopy light utilization efficiency in high-yielding rapeseed varieties. Sci. Rep. 2024, 14, 31243. [Google Scholar] [CrossRef]
- Yan, Q.; Li, X.; Xiao, X.; Chen, J.; Liu, J.; Lin, C.; Guan, R.; Wang, D. Arbuscular mycorrhizal fungi improve the growth and drought tolerance of Cinnamomum migao by enhancing physio-biochemical responses. Ecol. Evol. 2022, 12, e9091. [Google Scholar] [CrossRef]
- Liu, S.C.; Huang, T.L.; He, Y.X.; Liang, W.J.; Yin, M.B.; Zhang, R.; Li, N. CaNAC014 transcription factor enhances salt stress tolerance in pepper by regulating the activity of the CaSOS1 promoter. Plant Stress 2025, 18, 101025. [Google Scholar]
- Zhu, X.L.; Du, X.F.; Sang, B.W.; We, X.H. Functional characterization of the quinoa transcription factor CqBBX28 in drought stress response. Int. J. Biol. Macromol. 2026, 351, 151072. [Google Scholar] [CrossRef]
- Wang, Y.; Huang, N.; Ye, N.; Qiu, L.; Li, Y.; Ma, H. An Efficient Virus-Induced Gene Silencing System for Functional Genomics Research in Walnut (Juglans regia L.) Fruits. Front. Plant Sci. 2021, 12, 661633. [Google Scholar] [CrossRef]
- Velásquez, A.C.; Chakravarthy, S.; Martin, G.B. Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato. J. Vis. Exp. 2009, 28, 1292. [Google Scholar] [CrossRef]
- Lindsey, B.E.; Rivero, L.; Calhoun, C.S.; Grotewold, E.; Brkljacic, J. Standardized Method for High-throughput Sterilization of Arabidopsis Seeds. J. Vis. Exp. 2017, 128, 56587. [Google Scholar]
- Rivero, L.; Scholl, R.; Holomuzki, N.; Crist, D.; Grotewold, E.; Brkljacic, J. Handling Arabidopsis plants: Growth, preservation of seeds, transformation, and genetic crosses. In Arabidopsis Protocols; Humana Press: Totowa, NJ, USA, 2014; Volume 10, pp. 3–25. [Google Scholar]
- Prabhu, S.A.; Ndlovu, B.; Engelbrecht, J.; van den Berg, N. Generation of composite Persea americana (Mill.) (avocado) plants: A proof-of-concept-study. PLoS ONE 2017, 12, 0185896. [Google Scholar] [CrossRef]
- Hou, Q.L.; Luo, J.X.; Zhang, B.C.; Jiang, G.F.; Ding, W.; Zhang, Y.Q. 3D-QSAR and Molecular Docking Studies on the TcPMCA1-Mediated Detoxification of Scopoletin and Coumarin Derivatives. Int. J. Mol. Sci. 2017, 18, 1380. [Google Scholar] [CrossRef]
- Gong, Q.; Xiong, F.; Zheng, Y.; Guo, Y. Tea-derived exosome-like nanoparticles prevent irritable bowel syndrome induced by water avoidance stress in rat model. J. Gastroenterol. Hepatol. 2024, 39, 2690–2699. [Google Scholar] [CrossRef]







| Date | Dispose | Plant Glutamyl-tRNA Reductase | Plant δ-Aminolevulinic Acid Dehydratase | Plant Uroporphyrinogen III Synthase | Chlorophyllase | Plant Mg-Dechelatase |
|---|---|---|---|---|---|---|
| 31 May | Dck | 45.98 ± 0.5 c | 392.66 ± 7.99 c | 142.5 ± 3.6 c | 171.48 ± 2.83 bc | 2046.02 ± 26.08 c |
| D1 | 45.64 ± 0.41 cd | 392.4 ± 7.01 c | 148.81 ± 2.26 b | 167.14 ± 3.76 cd | 2040.22 ± 3.24 c | |
| D2 | 44.85 ± 0.37 d | 392.4 ± 6.99 c | 150.23 ± 2.34 b | 164.69 ± 3.71 de | 1928.38 ± 34.26 d | |
| D4 | 43.57 ± 0.91 e | 368.05 ± 7.52 d | 150.8 ± 1.28 b | 160.98 ± 3.72 e | 1908.74 ± 33.37 d | |
| Xck | 52.43 ± 0.63 a | 417.26 ± 5.75 a | 165.34 ± 3.03 a | 175.81 ± 2.26 ab | 2075.57 ± 31.2 bc | |
| X1 | 51.69 ± 0.49 b | 414.63 ± 2.02 a | 154.49 ± 1.13 b | 176.01 ± 3.28 ab | 2084.17 ± 30.02 bc | |
| X2 | 51.3 ± 1.08 b | 408.55 ± 6.25 ab | 153.59 ± 2.69 b | 176.98 ± 4.85 ab | 2111.29 ± 20.82 ab | |
| X4 | 50.61 ± 0.75 b | 400.86 ± 6.65 bc | 152.8 ± 3.16 b | 180.08 ± 0.64 a | 2154.12 ± 37.76 a | |
| 7 June | Dck | 46.85 ± 0.57 b | 393.01 ± 2.29 a | 143.02 ± 1.09 de | 174.61 ± 1.44 c | 1963.32 ± 41.63 d |
| D1 | 46.48 ± 0.26 bc | 388.55 ± 4.92 ab | 149.52 ± 3.86 c | 162.65 ± 2.72 de | 1761.36 ± 0.07 e | |
| D2 | 45.11 ± 0.84 cd | 382.77 ± 4.08 bc | 156.18 ± 2.95 b | 159.67 ± 2.59 e | 1750.73 ± 23.19 e | |
| D4 | 43.29 ± 1.02 e | 347.38 ± 8.03 e | 160.83 ± 0.78 a | 158.69 ± 4.14 e | 1649.7 ± 15.99 f | |
| Xck | 50.06 ± 0.8 a | 394.63 ± 4.09 a | 163.33 ± 2.32 a | 179.53 ± 0.71 bc | 2072.25 ± 15.36 c | |
| X1 | 48.94 ± 0.97 a | 375.7 ± 2.65 c | 146.23 ± 0.37 cd | 180.55 ± 2.11 bc | 2111.07 ± 12.83 c | |
| X2 | 48.88 ± 0.73 a | 363.57 ± 4.61 d | 139.01 ± 2.41 e | 182.86 ± 5.14 ab | 2259.25 ± 54.1 b | |
| X4 | 43.82 ± 1.09 de | 348.53 ± 2.46 e | 137.65 ± 3.9 e | 186.55 ± 0.68 a | 2319.97 ± 14.87 a | |
| 14 June | Dck | 48.38 ± 0.13 b | 398.7 ± 4.17 b | 148.52 ± 0.19 c | 173.51 ± 0.62 c | 1876.29 ± 4.21 d |
| D1 | 40.25 ± 0.62 d | 382.58 ± 7.3 c | 163.56 ± 1.21 b | 161.67 ± 1.63 d | 1855.81 ± 39.31 de | |
| D2 | 38.62 ± 0.38 e | 373.99 ± 4.53 cd | 165.86 ± 1.33 b | 160.07 ± 2.55 d | 1813.23 ± 38.72 ef | |
| D4 | 35.63 ± 0.74 f | 326.02 ± 7.9 f | 169.1 ± 2.44 a | 157.63 ± 0.8 e | 1775.21 ± 16.43 f | |
| Xck | 50.25 ± 0.06 a | 400.45 ± 5.2 a | 164.86 ± 1.24 b | 180.48 ± 2.63 b | 2273.12 ± 12.23 c | |
| X1 | 47.71 ± 1.14 c | 372.98 ± 3.69 d | 143.32 ± 1.43 d | 183.48 ± 2.98 b | 2297.25 ± 32.13 c | |
| X2 | 47.38 ± 0.18 c | 346.24 ± 4.05 e | 141.39 ± 1.28 d | 210.22 ± 3.06 a | 2436.52 ± 16.67 b | |
| X4 | 39.12 ± 0.8 e | 323.93 ± 1.45 f | 138.62 ± 0.87 e | 212.74 ± 2.95 a | 2505.28 ± 40.99 a | |
| 21 June | Dck | 49.55 ± 0.55 a | 397.38 ± 8.19 a | 161.65 ± 2.04 ab | 172.24 ± 4.04 cd | 2231.36 ± 36.65 c |
| D1 | 37.99 ± 0.81 c | 380.33 ± 4.19 bc | 134.06 ± 1.4 d | 160.09 ± 4.24 de | 2173.75 ± 35.54 d | |
| D2 | 35.1 ± 0.4 e | 369.6 ± 6.3 c | 138.44 ± 0.8 c | 158.58 ± 4.03 ef | 2085.48 ± 17.17 e | |
| D4 | 31.9 ± 0.19 f | 323.73 ± 6.11 e | 164.51 ± 0.98 a | 155.66 ± 2.13 f | 2025.07 ± 34.89 f | |
| Xck | 50.66 ± 1.02 a | 381.35 ± 4.19 b | 159.37 ± 0.8 b | 175.71 ± 1.08 c | 2380.04 ± 16.67 b | |
| X1 | 45.8 ± 0.51 b | 340.44 ± 6.23 d | 135.48 ± 2.84 cd | 190.87 ± 1.62 b | 2425.3 ± 31.73 b | |
| X2 | 43.65 ± 1.13 c | 327.8 ± 5.1 e | 126.37 ± 3.36 e | 220.31 ± 1.79 a | 2493.38 ± 32.58 a | |
| X4 | 36.98 ± 0.38 d | 318.73 ± 3.22 f | 121.02 ± 0.93 f | 223.97 ± 2.32 a | 2526.67 ± 20.77 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Chen, B.; Wang, M.; Yang, Y.; Li, L.; Fan, Y.; Zong, X.; Guo, X.; Zou, F.; Lin, Q.; Yu, H.; et al. Research on the Physiological Response Mechanism and Expression of Key Leaf Color Genes in ‘Duojiao’ Crabapple Under Partial Shading. Plants 2026, 15, 1552. https://doi.org/10.3390/plants15101552
Chen B, Wang M, Yang Y, Li L, Fan Y, Zong X, Guo X, Zou F, Lin Q, Yu H, et al. Research on the Physiological Response Mechanism and Expression of Key Leaf Color Genes in ‘Duojiao’ Crabapple Under Partial Shading. Plants. 2026; 15(10):1552. https://doi.org/10.3390/plants15101552
Chicago/Turabian StyleChen, Bingyuan, Min Wang, Yuhan Yang, Luoya Li, Yuwei Fan, Xiajing Zong, Xiaoqian Guo, Feiran Zou, Qiankun Lin, Hongyan Yu, and et al. 2026. "Research on the Physiological Response Mechanism and Expression of Key Leaf Color Genes in ‘Duojiao’ Crabapple Under Partial Shading" Plants 15, no. 10: 1552. https://doi.org/10.3390/plants15101552
APA StyleChen, B., Wang, M., Yang, Y., Li, L., Fan, Y., Zong, X., Guo, X., Zou, F., Lin, Q., Yu, H., Yu, J., Zhang, M., Mao, Y., & Shen, X. (2026). Research on the Physiological Response Mechanism and Expression of Key Leaf Color Genes in ‘Duojiao’ Crabapple Under Partial Shading. Plants, 15(10), 1552. https://doi.org/10.3390/plants15101552

