An Improved Method for Agrobacterium-Mediated Genetic Transformation of Three Types of Lettuce
Abstract
1. Introduction
2. Results
2.1. Test of the Effects of PGRs on Callus Induction and Shoot Regeneration
2.2. Antibiotic Selection in Shoot Induction Media
2.3. Agrobacterium-Mediated Stable Transformation of the Tested Lettuce Cultivars
3. Discussion
3.1. The Effects of Agrobacterium Strain and Concentration and Co-Cultivation Period on Lettuce Transformation
3.2. Confounding Effects of PGRs, Antibiotic Selection, and Explant Tissues
3.3. The Effects of the 35S Promoter and Agrobacterium Strains on Transgene Expression in Lettuce
4. Materials and Methods
4.1. Plant Materials and Growth Conditions
4.2. Test of PGRs
4.3. Plant Antibiotic Selection
4.4. Vector Construction
4.5. Agrobacterium-Mediated Lettuce Transformation
4.6. PCR Confirmation of the Presence of the Transgene
4.7. Histological GUS Staining
4.8. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Davey, M.R.; McCabe, M.S.; Mohapatra, U.; Power, B.J. Genetic manipulation of lettuce. In Transgenic Plants Crop; George, Y.H.H., Khachatourians, C., Hui, Y.H., Scorza, R., Nip, W.-K., Eds.; CRC Press: Boca Raton, FL, USA, 2002; pp. 612–634. [Google Scholar]
- Curtis, I.S. Lettuce (Lactuca sativa L.). In Methods Mol. Biol., 2nd ed.; Wang, K., Ed.; Humana Press: Totowa, NJ, USA, 2006; pp. 449–458. [Google Scholar]
- Bertier, L.D.; Ron, M.; Huo, H.; Bradford, K.J.; Britt, A.B.; Michelmore, R.W. High-resolution analysis of the efficiency, heritability, and editing outcomes of CRISPR/Cas9-induced modifications of NCED4 in lettuce (Lactuca sativa). G3 Bethesda 2018, 8, 1513–1521. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, C.D.; Li, J.; Mou, B.; Gong, H.; Huo, H.; Nguyen, C.D.; Li, J.; Mou, B.; Gong, H.; Huo, H. A case study of using an efficient CRISPR/Cas9 system to develop variegated lettuce. Veg. Res. 2021, 1, 4. [Google Scholar] [CrossRef]
- Li, Y.; Zhu, J.; Feng, Y.; Li, Z.; Ren, Z.; Liu, N.; Liu, C.; Hao, J.; Han, Y. LsARF3 mediates thermally induced bolting through promoting the expression of LsCO in lettuce (Lactuca sativa L.). Front. Plant Sci. 2022, 13, 958833. [Google Scholar] [CrossRef] [PubMed]
- Pan, W.; Liu, X.; Li, D.; Zhang, H. Establishment of an efficient genome editing system in lettuce without sacrificing specificity. Front. Plant Sci. 2022, 13, 930592. [Google Scholar] [CrossRef]
- Riu, Y.S.; Kim, G.H.; Chung, K.W.; Kong, S.G. Enhancement of the CRISPR/Cas9-based genome editing system in lettuce (Lactuca sativa L.) using the endogenous U6 promoter. Plants 2023, 12, 878. [Google Scholar] [CrossRef]
- Bull, T.; Michelmore, R. Molecular determinants of in vitro plant regeneration: Prospects for enhanced manipulation of lettuce (Lactuca sativa L.). Front. Plant Sci. 2022, 13, 888425. [Google Scholar] [CrossRef]
- Song, D.; Han, Q.; Dong, Z.; He, Z. Genetic transformation of lettuce (Lactuca sativa): A review. Afr. J. Biotechnol. 2014, 13, 1686–1693. [Google Scholar] [CrossRef]
- Dong, H.; Zhao, Y.; Wang, Y.; Li, H. Recombinant proteins expressed in lettuce. Indian J. Biotechnol. 2014, 13, 427–436. [Google Scholar]
- Matvieieva, N.A.; Shakhovskij, A.M.; Kuchuk, M.V. Features of lettuce transgenic plants with the ifn-α2b gene regenerated after Agrobacterium rhizogenes-mediated transformation. Cytol. Genet. 2012, 46, 150–154. [Google Scholar] [CrossRef]
- Vojin, T.; Snežana, M.; Aleksandar, C.; Marija, P.; Milana, T.; Dragana, A.; Jovan, T.; Angelina, S. Production of hairy root cultures of lettuce (Lactuca sativa L.). Cent. Eur. J. Biol. 2014, 9, 1196–1205. [Google Scholar] [CrossRef]
- Joh, L.D.; Wroblewski, T.; Ewing, N.N.; VanderGheynst, J.S. High-level transient expression of recombinant protein in lettuce. Biotechnol. Bioeng. 2005, 91, 861–871. [Google Scholar] [CrossRef] [PubMed]
- Negrouk, V.; Eisner, G.; Lee HIl Han, K.; Taylor, D.; Wong, H.C. Highly efficient transient expression of functional recombinant antibodies in lettuce. Plant Sci. 2005, 169, 433–438. [Google Scholar] [CrossRef]
- Wroblewski, T.; Tomczak, A.; Michelmore, R. Optimization of Agrobacterium-mediated transient assays of gene expression in lettuce, tomato and Arabidopsis. Plant Biotechnol. J. 2005, 3, 259–273. [Google Scholar] [CrossRef] [PubMed]
- Chupeau, M.C.; Bellini, C.; Guerche, P.; Maisonneuve, B.; Vastra, G.; Chupeau, Y. Transgenic plants of lettuce (Lactuca sativa) obtained through electroporation of protoplasts. Nat. Biotechnol. 1989, 7, 503–508. [Google Scholar] [CrossRef]
- Lelivelt, C.L.C.; McCabe, M.S.; Newell, C.A.; De Snoo, C.B.; Van Dun, K.M.P.; Birch-Machin, I.; Gray, J.C.; Mills, K.H.G.; Nugent, J.M. Stable plastid transformation in lettuce (Lactuca sativa L.). Plant Mol. Biol. 2005, 58, 763–774. [Google Scholar] [CrossRef]
- Ichikawa, Y.; Tamoi, M.; Sakuyama, H.; Maruta, T.; Ashida, H.; Yokota, A.; Shigeoka, S. Generation of transplastomic lettuce with enhanced growth and high yield. GM Crops 2010, 1, 322–326. [Google Scholar] [CrossRef]
- Kanamoto, H.; Yamashita, A.; Asao, H.; Okumura, S.; Takase, H.; Hattori, M.; Yokota, A.; Tomizawa, K.I. Efficient and stable transformation of Lactuca sativa L. cv. Cisco (lettuce) plastids. Transgenic Res. 2006, 15, 205–217. [Google Scholar] [CrossRef]
- Davey, M.R.; Anthony, P.; van Hooff, P.; Power, J.B.; Lowe, K.C. Lettuce. Biotechnol. Agric. 2007, 59, 221–249. [Google Scholar]
- Michelmore, R.; Marsh, E.; Seely, S.; Landry, B. Transformation of lettuce (Lactuca sativa) mediated by Agrobacterium tumefaciens. Plant Cell Rep. 1987, 6, 439–442. [Google Scholar] [CrossRef]
- Darqui, F.S.; Radonic, L.M.; Beracochea, V.C.; Hopp, H.E.; López Bilbao, M. Peculiarities of the transformation of Asteraceae family species: The cases of sunflower and lettuce. Front. Plant Sci. 2021, 12, 767459. [Google Scholar] [CrossRef]
- Reyes-Chin-Wo, S.; Wang, Z.; Yang, X.; Kozik, A.; Arikit, S.; Song, C.; Xia, L.; Froenicke, L.; Lavelle, D.O.; Truco, M.-J.; et al. Genome assembly with in vitro proximity ligation data and whole-genome triplication in lettuce. Nat. Commun. 2017, 8, 14953. [Google Scholar] [CrossRef] [PubMed]
- Curtis, I.S.; Power, J.B.; Blackhall, N.W.; de Laat, A.M.M.; Davey, M.R. Genotype-independent transformation of lettuce using Agrobacterium tumefaciens. J. Exp. Bot. 1994, 45, 1441–1449. [Google Scholar] [CrossRef]
- Armas, I.; Pogrebnyak, N.; Raskin, I. A rapid and efficient in vitro regeneration system for lettuce (Lactuca sativa L.). Plant Methods 2017, 13, 58. [Google Scholar] [CrossRef] [PubMed]
- Ampomah-Dwamena, C.; Conner, A.J.; Fautrier, A.G.; Ampomah-Dwamena, C.; Conner, A.J.; Fautrier, A.G. Genotypic response of lettuce cotyledons to regeneration in vitro. Sci. Hortic. 1997, 71, 137–145. [Google Scholar] [CrossRef]
- Van de Wiel, C.; Arens, P.; Vosman, B. Microsatellite fingerprinting in lettuce (Lactuca sativa L.) and wild relatives. Plant Cell Rep. 1998, 17, 837–842. [Google Scholar] [CrossRef]
- Dinant, S.; Maisonneuve, B.; Albouy, J.; Chupeau, Y.; Chupeau, M.-C.C.; Bellec, Y.; Gaudefroy, F.; Kusiak, C.; Souche, S.; Robaglia, C.; et al. Coat protein gene-mediated protection in Lactuca sativa against lettuce mosaic potyvirus strains. Mol. Breed. 1997, 3, 75–86. [Google Scholar] [CrossRef]
- Martínez-González, L.; Rosales-Mendoza, S.; Soria-Guerra, R.E.; Moreno-Fierros, L.; López-Revilla, R.; Korban, S.S.; Guevara-Arauza, J.C.; Alpuche-Solís, Á.G. Oral immunization with a lettuce-derived Escherichia coli heat-labile toxin B subunit induces neutralizing antibodies in mice. Plant Cell Tissue Organ. Cult. 2011, 107, 441–449. [Google Scholar] [CrossRef]
- Zhang, X.; Conner, A.J. Genotypic effects on tissue culture response of lettuce cotyledons. J. Genet. Breed. 1992, 46, 287–290. [Google Scholar]
- Mazier, M.; Botton, E.; Flamain, F.; Bouchet, J.-P.; Courtial, B.; Chupeau, M.-C.; Chupeau, Y.; Maisonneuve, B.; Lucas, H. Successful gene tagging in lettuce using the Tnt1 retrotransposon from tobacco. Plant Physiol. 2007, 144, 18–31. [Google Scholar] [CrossRef]
- Kim, D.H.; Xu, Z.-Y.Y.; Hwang, I. AtHSP17.8 overexpression in transgenic lettuce gives rise to dehydration and salt stress resistance phenotypes through modulation of ABA-mediated signaling. Plant Cell Rep. 2013, 32, 1953–1963. [Google Scholar] [CrossRef]
- Wroblewski, T.; Piskurewicz, U.; Tomczak, A.; Ochoa, O.; Michelmore, R.W. Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities. Plant J. 2007, 51, 803–818. [Google Scholar] [CrossRef] [PubMed]
- Seabrook, J.E.A.; Douglass, L.K. Somatic embryogenesis of lettuce from mature tissues. Acta Hortic. 2003, 625, 217–223. [Google Scholar] [CrossRef]
- Brown, C.; Lucas, J.A.; Crute, I.R.; Walkey, D.G.A.; Power, J.B. An assessment of genetic variability in somacloned lettuce plants (Lactuca sativa) and their offspring. Ann. Appl. Biol. 1986, 109, 391–407. [Google Scholar] [CrossRef]
- Hunter, D.C.; Burritt, D.J. Improved adventitious shoot production from cotyledon explants of lettuce (Lactuca sativa L.). Sci. Hortic. 2002, 95, 269–276. [Google Scholar] [CrossRef]
- Gómez-Montes, E.O.; Oliver-Salvador, C.; Durán-Figueroa, N.; Badillo-Corona, J.A.; Salas, C.E. Optimization of direct shoot regeneration using cotyledonary explants and true leaves from lettuce cv. Romaine (Lactuca sativa L.) by surface response methodology. Plant Growth Regul. 2015, 77, 327–334. [Google Scholar] [CrossRef]
- Kim, J.H.; Botella, J.R. Etr1-1 gene expression alters regeneration patterns in transgenic lettuce stimulating root formation. Plant Cell Tissue Organ. Cult. 2004, 78, 69–73. [Google Scholar] [CrossRef]
- Torres, A.C.; Cantliffe, D.J.; Laughner, B.; Bienick, M.; Nagata, R.; Ashraf, M.; Ferl, R.J. Stable transformation of lettuce cultivar South Bay from cotyledon explants. Plant Cell Tissue Organ. Cult. 1993, 34, 279–285. [Google Scholar] [CrossRef]
- Ibrahim, A.B.; Monteiro, T.R.; Cabral, G.B.; Aragão, F.J.L. RNAi-mediated resistance to whitefly (Bemisia tabaci) in genetically engineered lettuce (Lactuca sativa). Transgenic Res. 2017, 26, 613–624. [Google Scholar] [CrossRef]
- Pniewski, T.; Kapusta, J.; Bociąg, P.; Wojciechowicz, J.; Kostrzak, A.; Gdula, M.; Fedorowicz-Strońska, O.; Wójcik, P.; Otta, H.; Samardakiewicz, S.; et al. Low-dose oral immunization with lyophilized tissue of herbicide-resistant lettuce expressing hepatitis B surface antigen for prototype plant-derived vaccine tablet formulation. J. Appl. Genet. 2011, 52, 125–136. [Google Scholar] [CrossRef]
- Pileggi, M.; Pereira, A.A.M.; Suva, J.D.S.; Pileggi, S.A.V.; Verma, D.P.S. An improved method for transformation of lettuce by Agrobacterium tumefaciens with a gene that confers freezing resistance. Braz. Arch. Biol. Technol. 2001, 44, 191–196. [Google Scholar] [CrossRef]
- Vafaee, Y.; Alizadeh, H. Heterologous production of recombinant anti-HIV microbicide griffithsin in transgenic lettuce and tobacco lines. Plant Cell Tissue Organ. Cult. 2018, 135, 85–97. [Google Scholar] [CrossRef]
- Sharma, S.; Gautam, N.; Thakur, A.K.; Srivastava, D.K. Transgenic lettuce (Lactuca sativa L.) harboring chitinase gene expressed resistance against a devastating fungus, Sclerotinia sclerotiorum. Vegetos 2022, 36, 1265–1274. [Google Scholar] [CrossRef]
- Cui, L.; Chen, Y.; Shen, G.; Zhao, L.; Tang, K. Expression of bioactive thymosin alpha 1 (Tα1) in marker-free transgenic lettuce (Lactuca sativa). Plant Mol. Biol. Rep. 2011, 29, 466–472. [Google Scholar] [CrossRef]
- Liu, S.; Hu, Y.; Wang, X.; Zhong, J.; Lin, Z. High content of resveratrol in lettuce transformed with a stilbene synthase gene of Parthenocissus henryana. J. Agric. Food Chem. 2006, 54, 8082–8085. [Google Scholar] [CrossRef]
- Ren, W.; Zhao, L.; Wang, Y.; Cui, L.; Tang, Y.; Sun, X.; Tang, K. Overexpression of homogentisate phytyltransferase in lettuce results in increased content of vitamin E. Afr. J. Biotechnol. 2011, 10, 14046–14051. [Google Scholar]
- Kim, Y.S.; Kim, B.G.; Kim, T.G.; Kang, T.J.; Yang, M.S. Expression of a cholera toxin B subunit in transgenic lettuce (Lactuca sativa L.) using Agrobacterium-mediated transformation system. Plant Cell Tissue Organ. Cult. 2006, 87, 203–210. [Google Scholar] [CrossRef]
- Liu, C.W.; Chen, J.J.; Kang, C.C.; Wu, C.H.; Yiu, J.C. Transgenic lettuce (Lactuca sativa L.) expressing H1N1 influenza surface antigen (neuraminidase). Sci. Hortic. 2012, 139, 8–13. [Google Scholar] [CrossRef]
- Mohebodini, M.; Jalali-Javaran, M.; Alizadeh, H.; Mahboudi, F.; Yarbakht, M. Agrobacterium-mediated transformation of lettuce (Lactuca sativa L.) to express IgG-binding protein A and human pro-insulin as a fusion protein. J. Hortic. Sci. Biotechnol. 2014, 89, 719–725. [Google Scholar] [CrossRef]
- Mousavi, S.H.; Hassandokht, M.R.; Choukan, R.; Ghanbari, A.; Papini, A. Genetic diversity of Iranian lettuce (Lactuca sativa L.) accessions revealed by cytological traits. Caryologia 2013, 66, 41–48. [Google Scholar] [CrossRef]
- Enomoto, S.; Itoh, H.; Ohshima, M.; Ohashi, Y. Induced expression of a chimeric gene construct in transgenic lettuce plants using tobacco pathogenesis-related protein gene promoter region. Plant Cell Rep. 1990, 9, 6–9. [Google Scholar] [CrossRef]
- Fallah-Ziarani, M.; Haddad, R.; Garoosi, G.; Jalali, M. Agrobacterium-mediated transformation of cotyledonary leaf of lettuce (Lactuca sativa L.) by the GCHI gene. Iran. J. Genet. Plant Breed. 2013, 2, 47–55. [Google Scholar]
- Paez-Valencia, J.; Sanchez-Lares, J.; Marsh, E.; Dorneles, L.T.; Santos, M.P.; Sanchez, D.; Winter, A.; Murphy, S.; Cox, J.; Trzaska, M.; et al. Enhanced proton translocating pyrophosphatase activity improves nitrogen use efficiency in Romaine lettuce. Plant Physiol. 2013, 161, 1557–1569. [Google Scholar] [CrossRef] [PubMed]
- Huang, D.; Gao, L.; McAdams, J.; Zhao, F.; Lu, H.; Wu, Y.; Martin, J.; Sherif, S.M.; Subramanian, J.; Duan, H.; et al. Engineered cleistogamy in Camelina sativa for bioconfinement. Hortic. Res. 2023, 10, uhac280. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Mazarei, M.; Rudis, M.R.; Fethe, M.H.; Stewart, C.N. Rapid in vivo analysis of synthetic promoters for plant pathogen phytosensing. BMC Biotechnol. 2011, 11, 108. [Google Scholar] [CrossRef] [PubMed]
- Ohta, S.; Mita, S.; Hattori, T.; Nakamura, K. Construction and expression in tobacco of a β-glucuronidase (GUS) reporter gene containing an intron within the coding sequence. Plant Cell Physiol. 1990, 31, 805–813. [Google Scholar]
- Vancanneyt, G.; Schmidt, R.; O’Connor-Sanchez, A.; Willmitzer, L.; Rocha-Sosa, M. Construction of an intron-containing marker gene: Splicing of the intron in transgenic plants and its use in monitoring early events in Agrobacterium-mediated plant transformation. Mol. Gen. Genet. 1990, 220, 245–250. [Google Scholar] [CrossRef]
- Frankin, G.; Oliveria, A.L.; Dias, A.C.P. In vitro flowering and viable seed setting of transgenic lettuce cultures. Plant Biotechnol. 2011, 28, 63–68. [Google Scholar]
- Chen, Z.; Zhao, W.; Ge, D.; Han, Y.; Ning, K.; Luo, C.; Wang, S.; Liu, R.; Zhang, X.; Wang, Q. LCM-seq reveals the crucial role of LsSOC1 in heat-promoted bolting of lettuce (Lactuca sativa L.). Plant J. 2018, 95, 516–528. [Google Scholar] [CrossRef]
- Dubois, V.; Botton, E.; Meyer, C.; Rieu, A.; Bedu, M.; Maisonneuve, B.; Mazier, M. Systematic silencing of a tobacco nitrate reductase transgene in lettuce (Lactuca sativa L.). J. Exp. Bot. 2005, 56, 2379–2388. [Google Scholar] [CrossRef]
- Park, B.J.; Liu, Z.; Kanno, A.; Kameya, T. Increased tolerance to salt- and water-deficit stress in transgenic lettuce (Lactuca sativa L.) by constitutive expression of LEA. Plant Growth Regul. 2005, 45, 165–171. [Google Scholar] [CrossRef]
- Lim, W.; Park, J.; Park, S. Re-evaluation of the effects of growth regulators on callus induction and shoot regeneration in Agrobacterium-mediated transformation of lettuce. Acta Physiol. Plant 2011, 33, 1631–1637. [Google Scholar] [CrossRef]
- Ma, Q.; Grones, P.; Robert, S. Auxin signaling: A big question to be addressed by small molecules. J. Exp. Bot. 2018, 69, 313–328. [Google Scholar] [CrossRef] [PubMed]
- Vylíčilová, H.; Bryksová, M.; Matušková, V.; Doležal, K.; Plíhalová, L.; Strnad, M. Naturally occurring and artificial N9-Cytokinin conjugates: From synthesis to biological activity and back. Biomolecules 2020, 10, 832. [Google Scholar] [CrossRef]
- Dias, B.B.A.; Cunha, W.G.; Morais, L.S.; Vianna, G.R.; Rech, E.L.; Capdeville, G.; Aragao, F.J.L. Expression of an oxalate decarboxylase gene from Flammulina sp. in transgenic lettuce (Lactuca sativa) plants and resistance to Sclerotinia sclerotiorum. Plant Pathol. 2006, 55, 187–193. [Google Scholar] [CrossRef]
- Okumura, A.; Shimada, A.; Yamasaki, S.; Horino, T.; Iwata, Y.; Koizumi, N.; Nishihara, M.; Mishiba, K.I. CaMV-35S promoter sequence-specific DNA methylation in lettuce. Plant Cell Rep. 2016, 35, 43–51. [Google Scholar] [CrossRef]
- Vanjildorj, E.; Bae, T.W.; Riu, K.Z.; Kim, S.Y.; Lee, H.Y. Overexpression of Arabidopsis ABF3 gene enhances tolerance to drought and cold in transgenic lettuce (Lactuca sativa). Plant Cell Tissue Organ. Cult. 2005, 83, 41–50. [Google Scholar] [CrossRef]
- Murashige, T.; Skoog, F. A revised medium for rapid growth and bioassay with tobacco tissue cultures. Physiol. Plant 1962, 15, 473–479. [Google Scholar] [CrossRef]
- Inoue, H.; Nojima, H.; Okayama, H. High efficiency transformation of Escherichia coli with plasmids. Gene 1990, 96, 23–28. [Google Scholar] [CrossRef]
- Weigel, D.; Glazebrook, J. Transformation of Agrobacterium using the freeze-thaw method. Cold Spring Harb. Protoc. 2006, 2006, pdb.prot4666. [Google Scholar] [CrossRef]
- Jefferson, R.A.; Kavanagh, T.A.; Bevan, M.W. GUS fusions: Beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 1987, 6, 3901–3907. [Google Scholar] [CrossRef]
- Bříza, J.; Růžičková, N.; Niedermeierová, H.; Dusbábková, J.; Vlasák, J. Phosphomannose isomerase gene for selection in lettuce (Lactuca sativa L.) transformation. Acta Biochim. Pol. 2010, 57, 63–68. [Google Scholar] [CrossRef] [PubMed]
- Curtis, I.S.; He, C.; Power, J.B.; Mariotti, D.; de Laat, A.; Davey, M.R. The effects of Agrobacterium rhizogenes rolAB genes in lettuce. Plant Sci. 1996, 115, 123–135. [Google Scholar] [CrossRef]
- Curtis, I.S.; He, C.; Jordi, W.J.R.M.; Davelaar, E.; Power, J.B.; De Laat, A.M.M.; Davey, M.R. Promoter deletions are essential for transformation of lettuce by the T-cyt gene: The phenotypes of transgenic plants. Ann. Bot. 1999, 83, 559–567. [Google Scholar] [CrossRef]
- Webster, D.E.; Smith, S.D.; Pickering, R.J.; Strugnell, R.A.; Dry, I.B.; Wesselingh, S.L. Measles virus hemagglutinin protein expressed in transgenic lettuce induces neutralising antibodies in mice following mucosal vaccination. Vaccine 2006, 24, 3538–3544. [Google Scholar] [CrossRef] [PubMed]
- Mohebodini, M.; Jalali-Javaran, M.; Mahboudi, F.; Alizadeh, H. Effects of genotype, explant age and growth regulators on callus induction and direct shoot regeneration of Lettuce (Lactuca sativa L.). Aust. J. Crop Sci. 2011, 5, 92–95. [Google Scholar]
Media | Present Study | Published Studies | ||||
---|---|---|---|---|---|---|
Auxin (mg/L) | Cytokinin (mg/L) | Auxin (mg/L) | Cytokinin (mg/L) | Refs. | ||
#1 | 0.00 | 0.00 | 0.00 | 0.00 | ||
IAA (mg/L) | Kinetin (mg/L) | IAA (mg/L) | Kinetin (mg/L) | |||
#2 | 2.00 | 1.00 | 5.60 | 0.68 | [38] | |
#3 | 1.00 | 0.50 | - | - | [21] | |
NAA (mg/L) | BA (mg/L) | NAA (mg/L) | BA (mg/L) | |||
#4 | 0.05 | 0.25 | 0.05 | 0.20 | [39,40,41,42,43] | |
#5 | 0.05 | 0.50 | - | - | [35] | |
#6 | 0.05 | 1.00 | - | - | [25] | |
#7 | 0.10 | 0.25 | - | - | [44,45] | |
#8 | 0.10 | 0.50 | - | - | [46,47,48,49] | |
#9 | 0.10 | 1.00 | 0.10 | 2.00 | [25] |
Media # | Hygromycin (mg/L) | Cultivar | Cultivar Type | ||||
---|---|---|---|---|---|---|---|
0 | 10 | 15 | 20 | 25 | |||
#3 | +++ | ++ | + | - | -- | Kahu (N.T.) | Romaine |
#7 | ++ | ++ | + | -- | -- | Kahu (N.T.) | Romaine |
Media # | Kanamycin (mg/L) | Cultivar | Cultivar Type | ||||
0 | 40 | 80 | 120 | 200 | |||
#3 | +++ | - | - | -- | -- | Red Sails (N.T.) | Leaf |
#3 | +++ | + | + | - | - | Red Sails (T.) | Leaf |
#3 | ++ | - | - | -- | -- | Girelle (N.T.) | Butterhead |
#3 | ++ | ++ | + | - | - | Girelle (T.) | Butterhead |
Cultivar | Plasmid | Regenerated Plants /Initial Seedlings | Regeneration Efficiency (%) | Transformation Efficiency (%) |
---|---|---|---|---|
Kahu | pGFP-GUSPlus | 10/25 | 40.0 | 50.0 |
Rosalita | pGFP-GUSPlus | 38/25 | 152.0 | 24.3 |
Red Sails | pGFP-GUSPlus | 53/25 | 212.0 | 69.8 |
Green Wave | pGFP-GUSPlus | 15/25 | 60.0 | 100.0 |
Royal Oak Leaf | pGFP-GUSPlus | 20/25 | 80.0 | 50.0 |
Cocarde | pGFP-GUSPlus | 0/25 | 0.0 | 0.0 |
Girelle | pGFP-GUSPlus | 0/25 | 0.0 | 0.0 |
Cobham Green | pGFP-GUSPlus | 2/25 | 8.0 | 50.0 |
Lollo Biondo | pGFP-GUSPlus | 7/25 | 28.0 | 71.4 |
Bronze Mignonette | pGFP-GUSPlus | 0/25 | 0.0 | 0.0 |
Mariska | pGFP-GUSPlus | 0/25 | 0.0 | 0.0 |
Kahu | pGUSPlus | 8/25 | 32.0 | 42.9 |
Mariska | pGUSPlus | 15/25 | 60.0 | 64.3 |
Primer Name | Primer Sequence (5′ > 3′) |
---|---|
M13F | TGTAAAACGACGGCCAGT |
M13R | CAGGAAACAGCTATGAC |
GusPlus-F | GACTGACCATCGATGTCTATG |
GusPlus-R | GCCGAAATCTGGAATGTTGGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Roche, M.C.; Liu, W.; Hernández, R. An Improved Method for Agrobacterium-Mediated Genetic Transformation of Three Types of Lettuce. Plants 2025, 14, 620. https://doi.org/10.3390/plants14040620
Roche MC, Liu W, Hernández R. An Improved Method for Agrobacterium-Mediated Genetic Transformation of Three Types of Lettuce. Plants. 2025; 14(4):620. https://doi.org/10.3390/plants14040620
Chicago/Turabian StyleRoche, Meghan C., Wusheng Liu, and Ricardo Hernández. 2025. "An Improved Method for Agrobacterium-Mediated Genetic Transformation of Three Types of Lettuce" Plants 14, no. 4: 620. https://doi.org/10.3390/plants14040620
APA StyleRoche, M. C., Liu, W., & Hernández, R. (2025). An Improved Method for Agrobacterium-Mediated Genetic Transformation of Three Types of Lettuce. Plants, 14(4), 620. https://doi.org/10.3390/plants14040620