Next Article in Journal
Agave macroacantha Transcriptome Reveals Candidate CNGC Genes Responsive to Cold Stress in Agave
Next Article in Special Issue
Multivariate Adaptability of Tropical Wheat Cultivars to Drought and Salinity Stresses
Previous Article in Journal
Insecticidal Activity of Lectin Preparations from Moringa oleifera Lam. (Moringaceae) Seeds Against Alphitobius diaperinus (Panzer) (Coleoptera: Tenebrionidae)
Previous Article in Special Issue
The Genetics and Breeding of Heat Stress Tolerance in Wheat: Advances and Prospects
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Plant Productivity and Leaf Starch During Grain Fill Is Linked to QTL Containing Flowering Locus T1 (FT1) in Wheat (Triticum aestivum L.)

Department of Plant Sciences and Plant Pathology, Montana State University, 119 Plant Bioscience Building, Bozeman, MT 59717-3150, USA
*
Author to whom correspondence should be addressed.
Plants 2025, 14(4), 512; https://doi.org/10.3390/plants14040512
Submission received: 20 December 2024 / Revised: 24 January 2025 / Accepted: 26 January 2025 / Published: 7 February 2025
(This article belongs to the Special Issue Wheat Breeding for Global Climate Change)

Abstract

Shifts in the environment due to climate change necessitate breeding efforts aimed at adapting wheat to longer, warmer growing seasons. In this study, 21 modern wheat (Triticum aestivum L.) cultivars and 29 landraces were screened for flag leaf starch levels, with the goal of identifying a genetic marker for targeted breeding. The landrace PI 61693 was identified as having exceptionally high flag leaf starch values. Yield trials were carried out in a Berkut × PI 61693 recombinant inbred line (RIL) population and a negative correlation was observed between leaf starch, flowering time, and yield. Genetic mapping identified a Quantitative Trait Loci (QTL) explaining 22–34% variation for leaf starch, flowering time, biomass, and seed yield. The starch synthase TraesCS7D02G117800 (wSsI-1) is located in this region, which possibly accounts for leaf starch variation in this population; also within this QTL is TraesCS7D02G111600 (FT-D1). Sequencing of FT-D1 identified a single base pair deletion in the 3rd exon of the Berkut allele. This indel has recently been shown to significantly impact flowering time and productivity, and likely led to significant variation in flowering date and yield in this population. Here, we illustrate how allelic selection of FT-D1 within breeding programs may aid in adapting wheat to changing environments.

Graphical Abstract

1. Introduction

Global temperatures are on the rise and previously predictable patterns in temperature and precipitation become more confounded every year [1]. The shift in climate brings challenges to agriculture, a practice that relies on a reasonable amount of predictability. It is estimated from wheat (Triticum aestivum L.) cropping models that for every 1 °C increase in temperature globally, the average production of wheat worldwide will decrease by 6% [2]. Cereal breeding efforts focus primarily on increasing grain yield or grain quality traits. In recent years, there has also been an emphasis on focusing on traits that lead to sustainable improvements in the face of a changing climate. It is increasingly difficult to select single genes that lead to crop improvement. A more sustainable approach may be to focus on the interaction of source and sink strength [3].
In cereals, sink strength in the endosperm is largely driven by starch biosynthesis, where starch constitutes 60% or more of seed weight. Starch biosynthesis in the form of source strength is also limiting to plant growth. Leaf starch is accumulated in source tissues during the light period when excess photosynthate is stored as transitory starch. It is then remobilized to sink tissues during the dark period for growth, development, or storage [4]. The starch biosynthesis pathway is controlled primarily by three enzymes: ADP-glucose pyrophosphorylase (AGPase), starch synthase (SS), and starch-branching enzyme (SBE) [5]; each of these enzymes exist as multiple isozymes [6]. The rate-limiting reaction in both source and sink tissues is controlled by AGPase. In this reaction, glucose-1-phosphate and ATP are converted to ADP-glucose and inorganic phosphate [7]. ADP-glucose is then polymerized by SS to produce amylose, a relatively unbranched glucose polymer, and SBEs are responsible for the production of the highly branched glucose polymer amylopectin.
Given that AGPase is the rate limiting factor in the biosynthesis of starch, it has been the focus of most research regarding the interaction of starch and cereal yield. This includes studies that have demonstrated a reduction in AGPase activity at high temperatures in cereals [8]. This supports the hypothesis that selecting for elevated starch levels in cereal leaves may lead to grain yield gains, or at least protect against yield losses as temperatures increase. Wheat genotypes with improved leaf starch biosynthesis may play an important role in maintaining high grain yields in a warming climate.
Many studies have had success in increasing cereal seed size or yield transgenically via overexpression of AGPase under the control of tissue-specific promoters. Increased seed size has been reported in rice (Oryza sativa L.) [9] and maize (Zea mays L.) [10,11] with endosperm-specific overexpression of AGPase. A similar approach, using the large endosperm-specific Sh2 promoter, led to increased seed set, rather than seed size, in wheat (Triticum aestivum L.) [12,13], rice [14], and maize [15]. Increased seed number was shown to be the result of Sh2 promoter-conditioned expression in maternal tissues [15,16]. Increased seed set was accompanied by increased plant biomass in rice and wheat [12,13,14], though biomass was not recorded for maize.
Observations in which both seed yield and biomass were increased simultaneously indicate that source strength, rather than sink strength, might be just as or more limiting to plant productivity. This is supported by the observation that photosynthetic rates were enhanced shortly before and after anthesis in wheat plants with Sh2-conditioned over-expression of AGPase in seeds [17]. To examine this hypothesis, several studies examined the role of leaf AGPase in cereal leaf tissue. In maize plants with the transposon-derived mutant agps-m1, having no leaf starch had a 30% yield reduction compared to wild-type (WT) sister plants, demonstrating that lack of leaf starch is devastating to plant growth [18]. Meanwhile, transgenic studies demonstrated that overexpression of AGPase in leaves often leads to enhanced plant growth and yield. In lettuce, expression of the modified potato (Solanum tuberosum L.) AGPase large subunit, upreg-1, in leaves led to significantly increased fresh weight [19]. Expression of this transgene in rice leaves also led to enhanced plant productivity [20]. Another rice study observed a 9% seed yield increase with expression of the transgene Sh2r6hs in leaves, accompanied by a 30% increase in mature plant biomass [21]. An additional study in rice with simultaneous upregulation of AGPase in both leaf (Sh2r6hs and Bt2 under rbcS promoter) and seed tissue (Sh2r6hs under Sh2 promoter) observed an additive increase in seed yield and biomass compared to overexpression in leaf or seed tissue alone [22].
Most research regarding plant yield linked to starch biosynthesis has focused on AGPase by either modifying AGPase expression levels, manipulating allosteric properties, or altering substrate/product supply [5]. Other starch biosynthesis enzymes have received less attention. In cereals, studies regarding SSs and SBEs have focused on the complex interactions observed within protein complexes, and how they contribute to grain quality. There has been less focus on targeting SS and SBE to increase growth and yield, especially in cereal leaves. However, constitutive overexpression of SSIV in leaves of Arabidopsis thaliana led to both increased starch and biomass [23], and constitutive upregulation of SBEs led to increased leaf starch and seed yield [24]. Although not immediately transferrable to cereal crops, these observations lend support to the hypothesis that transitory starch biosynthesis may boost plant productivity through multiple pathways.
In further support of this hypothesis, recent research into the transcriptional regulation of starch metabolism has shown that transcription factors from many major families directly regulate cereal starch biosynthesis [25,26,27]. These include the bZIP, AP2/ERF, NAC, CUC2, MYB, GRAS, and DOF transcription factor families, where each was shown to influence starch metabolism in rice, wheat, maize, or barley. Several studies have shown altered levels of starch when individual transcription factors were overexpressed [28,29,30,31,32]; however, due to the complex nature of transcriptional regulation, responses often varied depending on the environment. Furthermore, responses vary between species, even within the cereals [27].
The goal of this study was to identify natural sources of flag leaf starch in spring wheat and correlate leaf starch with plant productivity to identify markers for targeted breeding. It is expected that elevated leaf starch levels indicate a more efficient starch biosynthesis pathway that can be exploited to maintain yields under increasing temperatures. Landraces are excellent resources both in terms of introducing genetic diversity to current cultivars as well as for examining the role of individual genes upon specific traits. Here, both modern cultivars and landraces were screened to identify genotypes with high levels of leaf starch at grain fill. Focus was placed on grain fill since this is the ideal stage to optimize the source–sink strength relationship, and variation in leaf starch at grain fill has been shown to be particularly important to yield [22]. After identifying a landrace with exceptionally high levels of leaf starch, a recombinant inbred line (RIL) population was used to identify a marker associated with 22–34% of the variation for leaf starch, flowering time, biomass, and seed yield. Within this QTL, the starch synthase gene TraesCS7D02G117800 (wSsI-1) was identified as a possible candidate gene for leaf starch differences. TraesCS7D2G111600 (FT-D1), a known flowering time gene, is also located within this QTL. Furthermore, an FT-D1 indel was identified that segregated with leaf starch, flowering date, and wheat productivity. These findings add to the body of research indicating that FT1 allelic variation may prove useful in selecting specific flowering dates and yields targeted at specific growing regions and environments. This will be an especially important consideration when selecting sustainable yield traits in a changing climate.

2. Results

2.1. Survey of Leaf and Seed Starch at Grain Fill Identifies High Leaf Starch Landrace

Twenty-nine wheat landraces and twenty-one modern spring wheat cultivars were grown under field conditions and surveyed for starch during grain fill (14 DAF). The average leaf starch value across modern cultivars was 2.60 ± 0.27 µg starch mg−1 DW; the cultivar ‘Rescue’ had the highest leaf starch levels (5.99 ± 0.82 µg mg−1 DW) (Table S1). Compared to the modern cultivars, the wheat landraces surveyed varied substantially for leaf starch levels and ranged from 0.81–20.34 µg mg−1 DW (Table S1). PI 61693 had the highest level (20.34 ± 3.40 µg mg−1 DW). Compared to leaf starch levels, seed starch was less variable within landraces and modern cultivars. The overall average seed starch values for all landraces were 73.6 ± 1.0% seed DW at 14 DAF (and modern cultivars had an average of 73.4 ± 2.5%) (Table S1). For the purpose of this study, attention was focused on the landrace with the highest leaf starch levels, PI 61693. A benefit of this approach was that PI 61693 had previously been crossed to ‘Berkut’, a low leaf starch genotype, and a recombinant inbred line mapping population was developed and genotyped [33,34].

2.2. Starch Breakdown Is Not Impaired in PI 61693

To examine whether increased leaf starch levels in PI 61693 were consistent with a starch excess (sex) mutation, flag leaves were collected at 14 DAF one hour prior to lights on and at 4:00 PM, when transitory starch levels should be high. Starch levels were analyzed for Berkut and PI 61693. For both genotypes, starch levels were high at the end of the afternoon and nearly depleted at the end of the dark period (Figure 1), demonstrating that increased starch levels were not the result of changes in starch breakdown.

2.3. RIL Starch Frequency Distribution

Leaf starch at grain fill was quantified in a Berkut × PI 61693 NAM population [33]. Leaf starch values were measured in leaves collected during both the 2020 and 2021 field seasons. RIL starch values fell within a range of 8.6–32.7 µg mg−1 DW during the 2020 growing season and 1.7–14.0 in 2021 (Table 1). When compared across years, starch values had a correlation coefficient of 0.25 (p-value = 0.03, Table 1). The combined RIL averages were in the range of 5.5–20.4 µg mg−1 DW (Figure 2). Starch values were distributed such that PI 61693 values were located near the high end of the distribution curve, whereas Berkut values were located near the bottom. The high starch parent, PI 61693, had a combined average leaf starch value of 23.7 ± 4.8 µg mg−1 DW, whereas the low starch parent Berkut had an average leaf starch value of 6.0 ± 0.8 µg mg−1 DW (Table 2).

2.4. Plant Productivity Is Negatively Correlated to Leaf Starch at Grain Fill in the Berkut × PI 61693 RIL Population

RIL parents Berkut and PI 61693 field data are summarized in Table 2. Landrace PI 61693 had very high levels of leaf starch yet flowered ~4 days earlier than Berkut. In the Berkut × PI 61693-derived RIL population, days to anthesis ranged from 61.0–66.0 days in 2020 and 58.0–67.3 days in 2022 (Table 1). Combined data for individual RILs are presented in Table S2. Due to the strong correlations observed for yield traits between the 2020 and 2021 growing seasons (Table 1), data was combined and correlation analysis was used to examine the relationship between growth parameters. In this NAM population, flag leaf starch at grain fill was negatively correlated to every plant growth and yield trait measured except for seed protein, which had a significant positive correlation (Table 3). The negative correlations between leaf starch at grain fill with seed number per plant and with biomass were especially strong with correlation coefficients of −0.38 and −0.39 respectively (p-values ≤ 0.001).

2.5. QTL Analysis Identifies BobWhite_c5970_731 Marker Associated with Variation for Leaf Starch and Plant Productivity

QTL analysis identified three QTLs of interest for plant productivity traits (Table 4). In 2020, the markers BS00110350_51 and RAC875_c8842_724 were associated with grain number and grain protein, respectively. The marker BobWhite_c5970_731 was associated with days to anthesis, leaf starch, plant biomass, leaf length, grain number, and seed weight per plant during the 2020 field season. Analysis of the 2021 field data did not reveal any associations; however, when 2020 and 2021 data were combined, BobWhite_c5970_731 was again associated with biomass, grain number, and seed weight per plant in this population. This marker was associated with a 20–34% variation for these traits (Table 4). The BobWhite_c5970_731 SNP is located at position Chr7D: 68,417,466 of IWGSC RefSeq v.1, which is within the coding region of TraesCS7D02G111600, a well-conserved Flowering Locus T1 (FT-D1) gene.

2.6. Transcript Analysis of Candidate Genes Reveals FT-D1 Is Downregulated in Berkut

To identify candidate genes for leaf starch levels associated with BobWhite_c5970_731 on chromosome 7D, the IWGSC RefSeq map v.1 was used to compose a list of genes located upstream and downstream of BobWhite_c5970_731. Chen et al. (2022) identified 35 genes flanking TraesCS7D02G111600 (FT-D1), in which BobWhite_c5970_731 is located. These genes span a region covering 7D: 66,373,919–69,266,821 [35]. We expanded upon these findings by 4× to identify 165 genes located within 7D: 62,106,312–73,743,194 (Table S3). To further evaluate the likelihood of these candidate genes as causal for starch differences, we carried out transcript expression analysis on the RIL parent material. Expression values as well as protein name and putative function can be found in Table S3. Of the 165 candidate genes, 20 had expression levels ≥ 5.0 (Table 5). Of these, three genes stood out as interesting based on expression levels and/or putative gene function. The first is TraesCS7D02G103500, a 2Fe-2S ferredoxin-type domain-containing protein that is involved in the photosynthesis electron transport chain. However, there was no difference in expression between Berkut (262.43) and PI 61693 (248.63). The second is FT-D1, TraesCS7D02G111600. Berkut, which carries the frameshift mutation, had much lower levels of expression compared to PI 61693 at 50.58 vs. 219.66. The third gene of interest is Starch synthase wSsI-1, TraesCS7D02G117800. For this genotype, Berkut had a 1.5× increase in expression compared to PI 61693 (42.82 vs. 28.37).

2.7. Sequence Differences in FT-D1 (TraesCS7D02G111600) in Berkut vs. PI 61693 RIL Parents

In order to examine TraesCS7D02G111600 as a candidate gene, DNA from RIL parents was sequenced with D-genome-specific TraesCS7D02G111600 primers. A single base pair deletion (G) was identified in Berkut 840 base pairs downstream of the translation start codon. This insertion is described by [35] and termed FT-D1ΔG. The single base pair mutation is located at IWGSC RefSeq v.1 Chr7D: 68,417,122. This indel segregated with starch and plant productivity within this population (Table S2). Furthermore, in addition to flowering later and lower leaf starch, RILs with the FT-D1ΔG allele had significantly higher biomass, seed number, and seed weight per plant compared to those carrying the full-length allele (Table S2).

2.8. Free Sugar Levels in Flag Leaves Were Consistent with the Presence of FT-D1ΔG in Low Starch Lines and the Full Length Allele in High Starch Lines

RILS with the highest and lowest leaf starch phenotypes were identified based on combined 2020 and 2021 starch data (n = 15 for each group). From this set, four representative lines were selected such that height was held constant across starch phenotype. KASP assay results confirmed the presence of the single base pair deletion FT-D1 allele in the low starch phenotypes and the absence of the deletion in the high starch phenotypes. Sucrose, glucose, and fructose all trended in the direction of the parent allele for both high and low starch phenotypes. Low starch lines (FT-D1ΔG) had significantly higher levels of sucrose, whereas high starch lines (full-length allele) had significantly higher levels of glucose and fructose (Figure 3).

3. Discussion

Transitory leaf starch is an important energy source for plant growth and development [4]. Lack of leaf starch is detrimental to cereal growth and yield [18], whereas upregulated leaf starch metabolism has led to enhanced plant growth and yield in transgenic cereal populations [20,21,22]. Results from these studies indicate that cereal yield may be enhanced via the development of selective breeding methods for specific leaf starch levels. To move toward that goal, this study examined starch levels from an array of modern wheat cultivars and landraces to identify natural sources of flag leaf starch variation.
In this study, 21 modern cultivars and 29 landraces were surveyed for flag leaf starch levels at 14 DAF. This stage was selected since transgenic rice plants overexpressing leaf starch biosynthesis had the greatest difference in leaf starch compared to WT sister lines at this stage of development [22]. This is also a critical stage where energy in source tissue is actively mobilized to sink organs. Of the modern cultivars surveyed, ‘Rescue’ had the highest level of flag leaf starch (5.99 ± 0.82 µg mg−1 DW), which was 2.3× that of the average for modern cultivars (2.60 ± 0.27 µg mg−1 DW) (Table S1). Interestingly, Sawtana, Fortuna, and Newana also had higher than average levels of leaf starch (Table S1); these cultivars include Rescue in their pedigrees, indicating that there may be a genetic component to leaf starch phenotype in these varieties.
In order to determine whether the high starch phenotype observed in PI 61693 was due to inefficient starch breakdown during the dark period, leaves were collected at the end of the dark period and compared to leaves collected during the late afternoon, when starch levels should be high (Figure 1). It is well documented that the inability to break down leaf starch, as seen in Arabidopsis starch excess 1 (sex1) mutants, results in stunted, low-yielding plants [36,37]. Furthermore, mutations that lead to leaf starch accumulation resulting from lack of carbohydrate export have also been shown to be detrimental to plant growth and yield in maize [38,39,40]. Here, it was determined that elevated leaf starch levels were not due to the inability to break down starch at night. Starch levels were nearly depleted at the end of the dark period in both RIL parents, PI 61693 and Berkut (Figure 1).
Leaf starch at 14 DAF was measured across two field seasons in the Berkut × PI 61693 RIL population [33]. As expected, PI 61693 segregated at the high end of the distribution curve, while the low starch parent, Berkut, was located near the bottom of all detected values (Figure 2, Table 3). Results from transgenic studies discussed above indicate that improved leaf starch biosynthesis is beneficial to plant growth. Therefore, at the onset of this project, the working hypothesis was that increased leaf starch biosynthesis was likely beneficial to plant growth. However, in this population, there was a strong negative correlation between leaf starch and almost all productivity traits (Table 4).
A large amount of variation in plant height and flowering date was observed in this population (Table 1), despite selection pressure for reduced height (Rht) and day length insensitivity (Ppd) during RIL development [33]. Variation for these two important traits translated to high levels of significance for correlations between all plant-growth-related traits in this population (Table 3). Regardless of this variation, QTL analysis identified the marker BobWhite_c5970_731 to be associated with 20–34% variation for days to anthesis, leaf starch, plant biomass, and grain yield (Table 4). Although this QTL was not identified during the 2021 field season, it was identified in 2020 and when the 2020 and 2021 growing season data were combined. This likely reflects the low number of RILs in this population (n = 68) and differences between growing years. While the 2021 growing season received an extra 5 cm of precipitation compared to 2020, it was also 5 °C warmer during June and July relative to 2019 and 2020 (Table 6). During both the 2020 and 2021 growing seasons, there was a strong negative correlation (p-values ≤ 0.001) between leaf starch at grain fill and plant productivity (Table 3). The lower starch values observed in 2021 may reflect a downregulation of starch by heat stress [26]. As transitory leaf starch is a product of photosynthesis, environmental conditions such as temperature, cloud cover, and humidity influence stomatal conductance and contribute to differences between data sets [41].
A list of candidate genes located upstream and downstream of BobWhite_c5970_731 was created and transcript expression analysis was performed. Based on putative protein function, the immediate gene of interest behind leaf starch differences at grain fill is the starch synthase gene wSsI-1 (TraesCS7D02G117800). Interestingly, Berkut had a 1.5× increase in expression over PI 61693. Considering that PI 61693 had much higher levels of leaf starch, this came as a surprise. Further evaluation of wSsI-1 and experiments designed to specifically address the causal differences in starch between RIL parents will be needed.
Based on expression levels, TraesCS7D02G111600, encoding a flowering locus T protein, is the most likely candidate gene for plant growth differences within this population. There was a 4.34× increase in expression of this gene in RIL parent PI 61693 (219.66) over Berkut (50.58) in flag leaves at grain fill. Furthermore, the BobWhite_c5970_731 SNP marker is located within the coding region of TraesCS7D02G111600. TraesCS7D02G111600 is orthologous to the Arabidopsis thaliana gene FLOWERING LOCUS T (FT) [42]. In wheat, this gene is known as FT1 and sometimes Vrn-3. FT1 is a well-conserved florigen gene across flowering plants that encodes a phosphatidylethanolamine-binding (PEBP) transcription factor involved in both the photoperiod response and vernalization pathways [43].
To examine the likelihood that differences in the FT-D1 sequence were responsible for the phenotypes observed in this RIL population, the FT-D1 coding regions from RIL parents PI 61693 and Berkut were sequenced. A single base G deletion in the third exon of the Berkut allele was identified. These two haplotypes were first described in [44] and are reported as partial cds GenBank accessions EF428113 and EF428114 called FTD-h1 and FTD-h2. Since then, the entire FT-D1 gene, including the upstream and downstream sequences, was published in a study by Chen et al. (2022), in which the authors also identified the same deletion (termed FT-D1ΔG) and determined that FT-D1ΔG was responsible for delayed flowering and increased spikelet number in a RIL population [35]. Chen et al. (2022) further validated their findings with CRISPR/Cas9 FT-D1 knockout mutants and demonstrated that mutant lines flowered later and had significantly increased spikelet numbers. In this Berkut/PI 61693 population, Berkut (carrying FT-D1ΔG) flowered ~ four days later than PI 61693 and had much lower leaf starch at grain fill (Table 2). Furthermore, RILs homozygous for the FT-D1ΔG allele had significantly lower leaf starch, yet significantly higher biomass, seed number, and seed weight per plant (Table S2). These findings support those published by Chen et al. (2022) [35]. More research is needed to determine whether leaf starch differences in this population are directly linked to FT-D1, are from another gene segregating with FT-D1, or are from a downstream pathway mediated by FT-D1.
FT1 is involved in many aspects of plant development. In non-cereal crops, FT1 homologs have been shown to promote bulb formation in onions [45] and are involved with pod number and seeds per plant in soybeans [46]. The rice homolog, HEADING DATE 3a protein (HD3a), is transported to the shoot apical meristem, where it forms an activation complex to promote the expression of genes involved in the transition from vegetative to reproductive growth [47]. Further research in rice demonstrated that Hd3a protein accumulates in the axillary meristem to promote branching [48]. Studies in wheat have shown that FT1 interacts with TB1 to influence tiller formation [49] and there has been a growing body of evidence linking FT1 with wheat spikelet formation [35,49,50,51,52].
Although the underlying cause of leaf starch differences in the Berkut × PI 61693 RIL population remains unknown, there was a strong negative correlation between leaf starch at grain fill with flowering date and most plant productivity traits (Table 3). This inverse relationship suggests that overall carbon metabolism may be more efficient in plants with lower levels of leaf starch in this population. To examine this hypothesis, metabolites were extracted from five RILs carrying the FT-D1ΔG allele and five carrying the full-length FT-D1G allele. In these plants, it was found that levels of glucose and fructose were lower in plants carrying FT-D1ΔG compared to those with the intact FT-D1G allele, whereas sucrose levels were higher (Figure 3). It is possible that FT-D1 variation is directly responsible for the changes in carbon metabolism observed in this study, or from a linked gene segregating with FT-D1. Alternatively, these differences in simple sugars may reflect larger differences in rates of senescence resulting from FT-D1 allele presence. Although rates of senescence and days to maturity were not measured in this study, Chen et al. (2022) reported that this single base pair deletion has an even greater effect on promoting physiological maturity than the heading date in a winter wheat population grown in China [35]. Wang et al. (2015) showed that sucrose levels peak near 10 DAF and declined sharply throughout the rest of the grain fill [53]. In this study, flag leaf samples were collected at 14 DAF. If the time to maturity is altered in lines carrying the FT-D1ΔG allele, levels of flag leaf carbon metabolites may reflect that difference.
It is possible that changes in starch and sugar metabolites reflect differences in sucrose metabolism tied to FT-D1. Significant changes in sucrose levels (Figure 3) are interesting because sucrose is the major long-distance photosynthate transport molecule [54]. Furthermore, sucrose acts as a signaling molecule for flowering in Arabidopsis thaliana [55,56]. However, in this study, increased sucrose is associated with later flowering. An alternative hypothesis is that the altered carbohydrate levels are simply an indicator of sugar transport changes. However, any sugar transporters identified within the candidate region had very low (≤5.0) levels of expression (Table S3).
Research carried out in potatoes (Solanum tuberosum) supports the hypothesis that sucrose transport may be disrupted by FT1 allelic variation. In potatoes, the FT-like protein StSP6A induces tuberization, while another FT-like protein induces flowering [57]. Tuberization is induced by sucrose in vitro [58,59]. Abelanda et al. (2019) investigated the link between sucrose metabolism and StSP6A expression and found that sucrose triggers StSP6A tuber-specific expression [60]. They demonstrated protein–protein interactions between StSWEET11 and StSP6A at the cytosolic face of the plasma membrane. The implication of this is that carbon allocation throughout the plant may be altered via a similar interaction. Therefore, FT-D1 may interact with a sugar transporter influencing flag leaf sugar export, which could affect flag leaf starch levels.
A final possible explanation for starch differences between our RIL parents is that FT-D1 interacts with a transcription factor involved in carbon metabolism such as one belonging to the WRKY family. Wang et al. (2023) examined the transcriptome of winter wheat during vernalization and found that many transcription factors were significantly increased in expression during vernalization; among these were 129 WRKY transcripts [61]. An Arabidopsis study found that AtWRKY75 is a positive regulator of flowering initiation and binds to the FT promoter [62]. There is also evidence that WRKY transcription factors regulate leaf starch metabolism [29,63].
It is well established that FT1 interacts with earliness genes within the photoperiod and vernalization pathways. Epistatic interactions are a likely explanation for why QTL encompassing FT-D1 are not always picked up on association mapping panels even when FT-D1 polymorphism is known to exist within a population [64,65]. In a wheat study in which epistatic interactions for early flowering loci were examined, it was found that vrn-A1 > VRN-B1 > vrn-D3 (aka FT-1D) > PPD-D1 for intensity of effect [66]. As was observed in this study, the G × E effect also plays an important role in whether FT1 QTL will be identified in any individual environment (Table 4 and Table 6). Interestingly, Kiss et al. (2017) reported that the expression of Vrn-3 (FT1) is repressed with increased thermal time [67]. As noted above, the 2021 field season was an average of 5 °C warmer for June and July compared to 2019 and 2020. This provides a reasonable hypothesis for why no QTL associated with FT1 was found using the 2021 field season data.
It was originally hypothesized that higher leaf starch would correlate with plant productivity in wheat. This study demonstrated the contrary, likely confounded by the large difference in flowering time caused by the FT-D1ΔG allele in conjunction with the experimental design. Studies on photoperiod genes demonstrated that earlier flowering times are beneficial to yield in hot and dry growing regions, while later flowering is favorable under cooler and wetter conditions [68]. This is supported by Dreisigacker et al. (2021), who showed wheat yield under irrigation was highest for varieties with delayed flowering [69]. Delayed flowering allows for increased biomass accumulation prior to anthesis and promotes the development of a larger seed head. So long as these larger plants are supported by continuous water delivery during gain fill, their yield is increased appropriately.
In hotter and/or drier environments, with no additional irrigation, earlier flowering is beneficial to yield because anthesis occurs before high heat can decrease pollen germination and water is retained in the soil for grain fill [70,71]. All field experiments in this study were supported by irrigation, thus yield was favored by the considerably later (4 days) flowering allele. However, the high starch allele was associated with the earlier flowering phenotype. The average time from emergence to anthesis for spring wheat is between 40 and 50 days, making the 4-day difference in flowering time observed in this experiment very significant. It could be that the extreme difference in flowering time overcame any potential benefit to yield afforded by higher leaf starch during grain fill. Further studies will be necessary to separate leaf starch from flowering time to determine the potential impact of leaf starch without this interaction. This can be achieved by identifying other QTLs for leaf starch that are not also associated with flowering time, and by carrying out further field trials with this RIL population designed to address heat and/or drought stress.
The impact of FT-D1ΔG on flowering time has major implications for climate change. Control over the timing of floral development at the genetic level can be exploited to adapt wheat cultivars to the direction of temperature and precipitation changes in the target environment. Here, we proposed a generalized model for adapting spring wheat flowering time to different environmental regions for enhanced yield (Figure 4). In growing regions that are becoming warmer, with an extended frost-free day timeline, a longer growing season can be beneficial to irrigated wheat where flowering time has been pushed back. Conversely, in growing regions that are seeing a reduction in rainfall during grain fill, and where irrigation is not practical, wheat yields benefit from an earlier flowering time.
In addition to the FT-D1 polymorphism described here, FT-A1 and FT-B1 polymorphisms have been reported [35,42,44,72]. Identifying allelic variants of FT1 within each wheat genome-specific copy and other earliness genes within breeding populations will allow for pyramiding for target flowering time and maturity to target growing regions. Research utilizing heterogeneous inbred families (HIFs) that vary for one or more FT-1 alleles will provide insight into metabolic mechanisms and the degree to which FT-1 impacts wheat plant growth and productivity in different genetic backgrounds.

4. Materials and Methods

4.1. Starch Survey Plant Material

Twenty-one spring wheat cultivars were released between 1910 and 2005 [73] and 29 landraces [33] were field-grown in 2019 at the Arthur H. Post Farm near Bozeman, MT, and surveyed for native levels of flag leaf and seed starch at grain fill. Origins of plant material may be found in Supplementary Table S1. The landraces were collected from the continents of Africa (7), Asia (13), Europe (4), and South America (5) and are described in Blake et al. (2019) [33].

4.2. Recombinant Inbred Line (RIL) Plant Material

The recombinant inbred line population was developed by crossing landrace parent PI 61693 to the CIMMYT spring wheat cultivar ‘Berkut’ (Irene/Babax//Pastor, released in 2002) and consisted of 68 F5 derived recombinant inbred lines (RILs). The landrace PI 61693 originated in Malawi and has recently been integrated into the USDA WheatCAP Coordinated Agricultural Project, where it is described by Blake et al. (2019) and Jordan et al. (2018) [33,34]. The RIL population used in this study was one of the RIL populations from the NAM population described by Blake et al. (2019) [33]. During development, selection pressure for height and early flowering was applied for each generation. Field trials of RILS were planted with F5-derived F9 (F5:9) seed in 2020 and F5-derived F10 (F5:10) seed in 2021.

4.3. Field Trial Setup

For each field trial, the seed was planted at the Arthur H. Post Farm near Bozeman, MT in early May once the average soil temperature exceeded 4.4 °C. The soil was tilled and was seed sown with a disk seeder following a fallow rotation from wheat. Yield trials were carried out in a complete randomized block design with three replications. Space plant density consisted of 3m rows with 15 seeds planted per row. At Feekes stage 1, rows were thinned to 10 evenly spaced plants. Weed control was managed each spring with the application of herbicide at the beginning of June. In 2019, the field was sprayed with Huskie Complete Herbidice (Bayer CropScience, LP, St. Louis, MO, USA) at a rate of 1.10 L ha−1. The 2020 field was sprayed with a combination of herbicides Affinity (4.7 mL ha−1; FMC Corporation, Philadelphia, PA, USA), MCP ester 4 (0.58 L ha−1; Loveland Products, Inc., Loveland, CO, USA), Discover (0.58 L ha−1; Syngenta Crop Protection, Greensboro, NC, USA), and the fungicide Propi Star EC (0.29 L ha−1; Albaugh, LLC, Ankeny, IA, USA). The 2021 field was sprayed with 1.75 L ha−1 Vendetta (Wilbur-Ellis Co., Fresno, CA, USA) and 0.077 L ha−1 Parity (Tenkoz Inc. Alpharetta, GA, USA). Irrigation occurred one week prior to and one week after anthesis. Three representative plants were harvested per row and bundled. Bundles were dried and biomass was recorded. Bundles were threshed using a single plant thresher. Yield parameters measured included days to flowering, plant height and tiller number at maturity, seed weight per plant, and kernel characteristics. Grain protein and moisture were measured using a Foss Infratec 1241 Machine in which near-infrared absorption was compared to control reference values to determine protein [74].

4.4. Yield Trial Weather

Here, we define a field season at the Arthur H. Post Farm as running from 1 May to 31 August. During the 2019 field season, the Arthur H. Post Farm received 18.62 cm of precipitation. The lowest air temperature of −4.2 °C was recorded on 1 May, whereas the highest was recorded on 23 July at 32.3 °C. During the 2020 field season, the research center received 13.44 cm of precipitation. The lowest air temperature was recorded on 8 May at −0.03 °C. The highest recorded air temperature was 33.4 °C on 2 August. During the 2021 field season, the research center received 17.0 cm of precipitation. The lowest air temperature of −4.1 °C was recorded on 22 May while the highest air temperature was recorded on 18 July at 35.8 °C. Average temperatures for May-August are reported in Table 6.

4.5. Tissue Collection

Sampling occurred 14 days after flowering (DAF) +/− one day at 4:00 PM. Three replicates were collected, in which each biological replicate consisted of a single row and was the bulk composite of three flag leaves or heads harvested from individual plants. For the original screen of modern cultivars and landraces, entire flag leaves and heads were collected. The tissue was immediately frozen in liquid N2. Heads were threshed while remaining frozen and leaf and seed tissue was ground to a fine powder. Frozen tissue was allocated for starch quantification and molecular experiments. Sampling of the RIL population was carried out as described above, though heads were not collected.

4.6. Starch Quantification

Starch assays were carried out by Oiestad et al. (2019) [63]. Starch was extracted according to Smith and Zeeman (2006) from 10 mg dry weight (DW) samples [75]. Briefly, free glucose was removed from ~40 mg fresh weight (FW) ground powder with the addition of 80% EtOH and heated to 80 °C for 3 min. Ethanol supernatants were discarded, and this step was repeated twice. Pellets were dried and DW (~10 mg) was recorded. Pellets were suspended in 300 µL of 100 mM sodium acetate, pH 5.5. Leaf starch samples were digested with 0.06 U α-amylase and 0.18 U amyloglucosidase mg−1 DW. Seed starch samples were digested with 0.2 U α-amylase and 0.6 U amyloglucosidase mg−1 DW. Samples were assayed for starch according to Rӧsti et al. (2007), in which the change in NADPH (stoichiometric with D-glucose) was observed by the increase in absorbance at 340 nm [76]. Starch concentrations were determined by referencing a standard curve prepared from known amounts of purified wheat seed starch.
To examine leaf starch at the end of the dark period, plants were grown in a greenhouse with conditions consisting of a 16 h photoperiod with 22 °C day and 18 °C night temperatures. Flowering dates were recorded, and flag leaves were collected at 14 DAF +/− one day at one hour prior to lights on (dark morning, DM) and at 4:00 PM (mid-afternoon, A). Leaves were immediately frozen in liquid N2 and ground to a fine powder. Starch was extracted and assayed as described above. For comparisons between dark morning (DM) and afternoon (A) samples, one-tailed, equal variance t-tests were used to determine the significance between starch level harvested at DM vs. A with the hypothesis that starch would be depleted in DM samples.

4.7. Metabolite Analysis

RILs were selected for metabolomic analysis by sorting according to leaf starch level. The RILs with the highest starch values and lowest values that also had average height were selected with n = 4 for high and low starch phenotypes. The presence of the full-length FT-1D allele was confirmed for the high starch lines and the presence of the FT-D1ΔG allele was confirmed for the low starch lines. Samples were collected as described above with three biological replicates for each RIL. Frozen tissue was ground to a fine powder, freeze-dried, and aliquoted into 7 mg DW samples. Metabolites were extracted as per Schmidt et al. (2011), where 350 µL methanol (60 °C) was added to each sample, followed by incubation at 60 °C for 10 min [77]. Samples were vortexed and placed in a sonicating water bath for 10 min. Chloroform (350 µL) was added, and samples were vortexed followed by the addition of 300 µL water. Samples were again vortexed followed by centrifugation at full speed for 5 min. Polar fractions were transferred to GC-MS glass vials (150 µL per 7 mg DW) and dried in a speed-vac concentrator. Sample analysis was carried out using an Agilent 6890 gas chromatograph (Agilent Technologies, Santa Clara, CA, USA). Protocols laid out in Fiehn et al. (2008) were followed for data acquisition, metabolite identification, and sample normalization [78].

4.8. Transcript Analysis

Samples were collected as described above for the original starch screen 14 days after flowering (DAF), +/− one day, at 4:00 PM. Samples were collected from 10 landraces and 10 modern cultivars, representing low, mid, and high levels of leaf starch from the 2019 starch survey. Supplemental Table S1 indicates inclusion in this experiment. Pedigree and country of origin were also given consideration. From each replicate, 30 mg of frozen powder was combined into a single sample, such that samples consisted of a bulk of nine plants for each genotype.
RNA was extracted using an RNeasy Plant Mini Kit (QIAGeN, Germantown, MD, USA) according to the manufacturer’s instructions. RNA integrity was examined using an Agilent 2100 Bioanalyzer and all samples had RINs ≥ 6.8. Samples were sent to LC Sciences (Houston, TX, USA) for RNA-seq analysis. A total of 1 µg RNA was used to create cDNA libraries, and amplicons were sequenced as paired-end, 150 bp reads using an Illumina High Scan-SQ platform with a depth of 6 GB for each sample.
Twenty leaf and twenty seed samples were sent in for sequencing. The average raw reads across the 40 samples were 45,946,206 ± 851,410. LC Sciences used Cutadapt [79] and perl scripts in-house to remove reads that contained adaptor contamination, low-quality bases, and undetermined bases. Sequence quality was then verified using FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/, accessed on 3 December 2019). The average total clean reads across were 42,180,475 ± 840 567. Data was assembled and analyzed using Ngen and ArrayStar within the DNASTAR Lasergene v 17.6.2.9 software suite (DNASTAR, Madison, WI, USA). Reads were aligned to the Triticum astivum genome (iwgsc_refseqv1.0) within the DNA-star software suite using RPKM normalization. All other settings were left at default.

4.9. Data Analysis

Correlation analysis and creation of histograms were carried out using the Data Analysis Toolpak in Microsoft Excel, accessed 7 October 2021. The p-values for correlation coefficients were determined using a p-value calculator for correlation coefficients [80] with n = 68. Analysis of variance was carried out for each response variable using a randomized split-plot model combined over replications in R 4.1.2 [81] with the car [82] and emmeans [83] packages.

4.10. Genotyping, Linkage Map Construction, and QTL Analysis

Genotyping was previously carried out using the Illumina 90K iSelect assay [84] and is described in Jordan et al. (2018) [34]. During analysis, monomorphic markers, markers with >10% missing genotypes, and markers with significantly distorted segregation ratios were discarded. A genetic map was created using protocols described by Varella et al. (2019) [85] using the R/qtl and R/ASMap packages in R [86,87]. Co-segregating markers were discarded and polymorphic markers were excluded if they had >25% missing data or showed significant Mendelian segregation distortion (Chi-square test, p < 1.0 × 10−7, df = 1).

4.11. Amplification of FT-D1 (TraesCS7D02G111600)

Screening for FT-D1 polymorphism between parental lines was assessed with two sets of primers. A 2284-bp fragment of FT-D1 was amplified using forward primer 5′ GATCCATCCATCGGTCTC 3′ and reverse primer 5′ GCTGAATGACAAGAGCTGA 3′, which amplified all exons in the gene. The amplicon was sequenced using both the forward and reverse primer, sequencing both exons and ignoring the large intron between them. The PCR amplification reaction was as follows: one cycle of 96 °C for 5 min, 40 cycles of 96 °C for 30 s, 57 °C for 30 s, 72 °C for 180 s, and one cycle of 72 °C for 7 min with a final hold at 4 °C.
A single base pair deletion (G) was found in Berkut at the 840th base pair. This deletion leads to a frameshift mutation in the amino acid sequence and was first described by Bonnin et al. (2008) [44]. This mutation was termed FT-D1ΔG and its effect on wheat plant development was recently characterized in Chen et al. (2022) [35]. A competitive allele-specific PCR (KASP) assay was developed for the purposes of genotyping the RIL population for FT-D1. The full-length allele, from PI 61693, was amplified with the reverse primer and FAM tag 5′ GAAGGTGACCAAGTTCATGCTGAAGCGATGGATCCCC 3′, while the FT-D1ΔG allele, from Berkut, was amplified with the reverse primer and HEX tag 5′ GAAGGTCGGAGTCAACGGATTGAAGCGATGGATCCCA 3′. A common forward primer, 5′ GGTACAACTGGTGCATCC 3′, was utilized for the assay. The assay produced a 76-bp product that identified the FAM tag for full-length alleles and the HEX tag for alleles containing the deletion. The assay was performed on a BioRad CFX Opus 96 Real-Time qPCR system with the following reaction protocol: one cycle of 94 °C for 15 min, 10 cycles of 94 °C for 20 s, 61 °C for 60 s with a 0.6 °C decrease every cycle, 29 cycles of 94 °C for 20 s, 55 °C for 60 s, 30 °C for 20 s, followed by a single cycle of 30 °C for 5 min with a final hold at 4 °C.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants14040512/s1, Table S1: Leaf and seed starch survey of modern wheat cultivars and landraces at 14 DAF. Table S2: Growth and yield parameters for RILs within a Berkut/PI 61693 population combined over two years. Table S3: Expression of candidate genes located within 7D: 62,106,312–73,745,641 using IWSGC refseqv1.0.

Author Contributions

A.J.O., J.P.C. and M.J.G. designed the research. M.J.G. and A.J.O. acquired funding. A.J.O. carried out phenotyping and N.K.B. performed genetic mapping and QTL analysis. A.J.O. and B.J.T. completed starch and molecular experiments. A.J.O. and B.J.T. processed and analyzed data. A.J.O. drafted the manuscript. S.T.O. drafted figures. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Montana Fertilizer Advisory Committee, Multistate Project NC1200: Regulation of Photosynthetic Processes, and the Montana Agricultural Experiment Station.

Data Availability Statement

The data supporting the findings of this study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

AGPase: ADP-glucose pyrophosphorylase; DAF, days after flowering; FT1, Flowering Locus T1; RIL, recombinant inbred line; QTL, quantitative trait loci.

References

  1. Ahmed, M.; Ahmad, S.; Kheir, A.M.S. Climate Change: An Overview. In Global Agricultural Production: Resilience to Climate Change; Ahmed, M., Ed.; Springer: Cham, Switzerland, 2022. [Google Scholar] [CrossRef]
  2. Asseng, S.; Ewert, F.; Martre, P.; Rotter, R.P.; Lobell, D.B.; Cammarano, D.; Kimball, B.A.; Ottman, M.J.; Wall, G.W.; White, J.W.; et al. Rising temperatures reduce global wheat production. Nat. Clim. Change 2015, 5, 143–147. [Google Scholar] [CrossRef]
  3. Fang, L.; Struik, P.C.; Girousse, C.; Yin, X.; Martre, P. Source-sink relationships during grain filling in wheat in response to various temperature, water deficit, and nitrogen deficit regimes. J. Exp. Bot. 2024, 75, 6563–6578. [Google Scholar] [CrossRef] [PubMed]
  4. Smith, A.M.; Zeeman, S.C. Starch: A flexible, adaptable carbon store coupled to plant growth. Ann. Rev. 2020, 17, 2017–2245. [Google Scholar] [CrossRef] [PubMed]
  5. Lloyed, R.; Kossman, J. Starch trek: The search for yield. Front. Plant Sci. 2019, 9, 1930. [Google Scholar] [CrossRef] [PubMed]
  6. MacNeill, G.J.; Mehrpouyan, S.; Minow, M.A.A.; Patterson, J.A.; Tetlow, I.J.; Emes, M.J. Starch as a source, starch as a sink: The bifunctional role of starch in carbon allocation. J. Exp. Bot. 2017, 68, 4433–4453. [Google Scholar] [CrossRef] [PubMed]
  7. Espada, J. Enzymic synthesis of adenosine diphosphate glucose from glucose 1-phosphate and adenosine triphosphate. J. Biol. Chem. 1962, 237, 3577–3581. [Google Scholar] [CrossRef]
  8. Kaur, V.; Madaan, S.; Behl, R.K. ADP-glucose pyrophosphorylase activity in relation to yield potential of wheat: Response to independent and combined high temperature and drought stress. Cer. Res. Comm. 2017, 45, 181–191. [Google Scholar] [CrossRef]
  9. Sakulsingharoj, C.; Choi, S.B.; Hwang, S.K.; Edwards, G.E.; Bork, J.; Meyer, C.R.; Preiss, J.; Okita, T.W. Engineering starch biosynthesis for increasing rice seed weight: The role of the cytoplasmic ADP-glucose pyrophosphorylase. Plant Sci. 2004, 167, 1323–1333. [Google Scholar] [CrossRef]
  10. Wang, Z.; Chen, X.; Wang, J.; Liu, T.; Liu, Y.; Zhao, L.; Wang, G. Increasing maize seed weight by enhancing the cytoplasmic ADP-glucose pyrophosphorylase activity in transgenic plants. Plant Cell Tissue Organ Cult. 2007, 88, 83–92. [Google Scholar] [CrossRef]
  11. Li, N.; Zhang, S.; Zhao, Y.; Li, B.; Zhang, J. Over-expression of AGPase genes enhances seed weight and starch content in transgenic maize. Planta 2011, 233, 241–250. [Google Scholar] [CrossRef] [PubMed]
  12. Smidansky, E.D.; Clancy, M.; Meyer, F.D.; Lanning, S.P.; Blake, N.K.; Talbert, L.E.; Giroux, M.J. Enhanced ADP-glucose pyrophosphorylase activity in wheat endosperm increases seed yield. Proc. Natl. Acad. Sci. USA 2002, 99, 1724–1729. [Google Scholar] [CrossRef] [PubMed]
  13. Meyer, F.D.; Smidansky, E.D.; Beecher, B.; Greene, T.W.; Giroux, M.J. The maize Sh2r6hs ADP-glucose pyrophosphorylase (AGP) large subunit confers enhanced AGP properties in transgenic wheat (Triticum aestivum). Plant Sci. 2004, 167, 899–911. [Google Scholar] [CrossRef]
  14. Smidansky, E.D.; Martin, J.M.; Hannah, L.C.; Fischer, A.M.; Giroux, M.J. Seed yield and plant biomass increases in rice are conferred by deregulation of endosperm ADP-glucose pyrophosphorylase. Planta 2003, 216, 656–664. [Google Scholar] [CrossRef] [PubMed]
  15. Hannah, L.C.; Futch, B.; Bing, J.; Shaw, J.R.; Boehlein, S.; Stewart, J.D.; Beiriger, R.; Georgelis, N.; Greene, T. A shrunken-2 transgene increases maize yield by acting in maternal tissues to increase the frequency of seed development. Plant Cell 2012, 24, 2352–2363. [Google Scholar] [CrossRef] [PubMed]
  16. Hannah, L.C.; Shaw, J.R.; Clancy, M.A.; Georgelis, N.; Boehlein, S.K. A brittle-2 transgene increases maize yield by acting in maternal tissues to increase seed number. Plant Direct 2017, 1, e00029. [Google Scholar] [CrossRef] [PubMed]
  17. Smidansky, E.D.; Meyer, F.D.; Blakeslee, B.; Weglarz, T.E.; Greene, T.W.; Giroux, M.J. Expression of a modified ADP-glucose pyrophosphorylase large subunit in wheat seeds stimulates photosynthesis and carbon metabolism. Planta 2007, 225, 965–976. [Google Scholar] [CrossRef]
  18. Schlosser, A.J.; Martin, J.M.; Hannah, L.C.; Giroux, M.J. The maize leaf starch mutation agps-m1 has diminished field growth and productivity. Crop Sci. 2012, 52, 700–706. [Google Scholar] [CrossRef]
  19. Lee, S.-M.; Ryu, T.-H.; Kim, S.-I.; Okita, T.; Kim, D. Kinetic and regulatory properties of plant ADP-glucose pyrophosphorylase genetically modified by heterologous expression of potato upreg mutants in vitro and in vivo. Plant Cell Tissue Organ Cult. 2009, 96, 161–170. [Google Scholar] [CrossRef]
  20. Gibson, K.; Park, J.-S.; Nagai, Y.; Hwang, S.-K.; Cho, Y.-C.; Roh, K.-H.; Lee, S.-M.; Kim, D.-H.; Choi, S.-B.; Ito, H.; et al. Exploiting leaf starch synthesis as a transient sink to elevate photosynthesis, plant productivity and yields. Plant Sci. 2011, 181, 275–281. [Google Scholar] [CrossRef] [PubMed]
  21. Schlosser, A.J.; Martin, J.M.; Beecher, B.S.; Giroux, M.J. Enhanced rice growth is conferred by increased leaf ADP-glucose pyrophosphorylase activity. J. Plant Physiol. Pathol. 2014, 2, 4. [Google Scholar] [CrossRef]
  22. Oiestad, A.J.; Martin, J.M.; Giroux, M.J. Overexpression of ADP-glucose pyrophosphorylase in both leaf and seed tissue synergistically increase biomass and seed number in rice (Oryza sativa ssp. japonica). Funct. Plant Biol. 2016, 43, 1194–1204. [Google Scholar] [CrossRef] [PubMed]
  23. Gámez-Arjona, F.M.; Li, J.; Raynaud, S.; Baroja-Fernández, E.; Muñoz, F.J.; Ovecka, M.; Ragel, P.; Bahaji, A.; Pozueta-Romero, J.; Mérida, Á. Enhancing the expression of starch synthase class IV results in increased levels of both transitory and long-term storage starch. Plant Biotech. J. 2011, 9, 1049–1060. [Google Scholar] [CrossRef]
  24. Liu, F.; Zhao, Q.; Mano, N.; Ahmed, Z.; Nitschke, F.; Steup, M.; Tetlow, I.J.; Emes, M.J. Modification of starch metabolism in transgenic Arabidopsis thaliana increases plant biomass and doubles oil seed production. Plant Biotech. J. 2016, 14, 976–985. [Google Scholar] [CrossRef] [PubMed]
  25. López-González, C.; Juárez-Colunga, S.; Morales-Elías, N.C.; Tiessen, A. Exploring regulatory networks in plants: Transcription factors of starch metabolism. PeerJ 2019, 7, e6841. [Google Scholar] [CrossRef] [PubMed]
  26. Li, R.; Zheng, W.; Jiang, M.; Zhang, H. A review of starch biosynthesis in cereal crops and its potential breeding applications in rice (Oryza sativa L.). PeerJ 2021, 9, e12678. [Google Scholar] [CrossRef] [PubMed]
  27. Li, R.; Tan, Y.; Zhang, H. Regulators of starch biosynthesis in cereal crops. Molecules 2021, 26, 7092. [Google Scholar] [CrossRef] [PubMed]
  28. Fu, F.F.; Xue, H.W. Coexpression analysis identifies Rice Starch Regulator 1, a rice AP2/EREBP family transcription factor, as a novel rice starch biosynthesis regulator. Plant Physiol. 2010, 154, 927–938. [Google Scholar] [CrossRef]
  29. Nagata, T.; Hara, H.; Saitou, K.; Kobashi, A.; Kojima, K.; Yuasa, T.; Ueno, O. Activation of ADP-glucose pyrophosphorylase gene promoters by a WRKY transcription factor, AtWRKY20, in Arabidopsis thaliana L. and Sweet Potato (Ipomoea batatas Lam.). Plant Prod. Sci. 2012, 15, 10–18. [Google Scholar] [CrossRef]
  30. Wang, J.C.; Xu, H.; Zhu, Y.; Liu, Q.Q.; Cai, X.L. OsbZIP58, a basic leucine zipper transcription factor, regulates starch biosynthesis in rice endosperm. J. Exp. Bot. 2013, 64, 3453–3466. [Google Scholar] [CrossRef] [PubMed]
  31. Ambavaram, M.M.R.; Basu, S.; Krishnan, A.; Ramegowda, V.; Batlang, U.; Rahman, L.; Baisakh, N.; Pereira, A. Coordinated regulation of photosynthesis in rice increases yield and tolerance to environmental stress. Nat. Comm. 2014, 31, 5302. [Google Scholar] [CrossRef] [PubMed]
  32. Oiestad, A.J.; Estabrooks, H.M.; Martin, J.M.; Giroux, M.J. Overexpression of WRKY76 in leaves leads to increased photosynthesis and plant yield in rice. J. Plant Sci. 2018, 6, 185–197. [Google Scholar] [CrossRef]
  33. Blake, N.K.; Pumphrey, M.; Glover, K.; Chao, S.; Jordan, K.; Jannick, J.-L.; Akhunov, E.A.; Dubcovsky, J.; Bockelman, H.; Talbert, L.E. Registration of the Triticeae-CAP spring wheat nested association mapping population. J. Plant Reg. 2019, 13, 294–297. [Google Scholar] [CrossRef]
  34. Jordan, K.W.; Wang, S.; He, F.; Chao, S.; Lun, Y.; Paux, E.; Sourdille, P.; Sherman, J.; Akhunova, A.; Blake, N.K.; et al. The genetic architecture of genome-wide recombination rate variation in allopolyploid wheat revealed by nested association mapping. Plant J. 2018, 95, 1039–1054. [Google Scholar] [CrossRef]
  35. Chen, Z.; Ke, W.; He, F.; Chai, L.; Cheng, X.; Xu, H.; Wang, X.; Du, D.; Xhao, Y.; Chen, X.; et al. A single nucleotide deletion in the third exon of FT-D1 increases the spikelet number and delays heading date in wheat (Triticum aestivum L.). Plant Biotech. J. 2022, 20, 920–933. [Google Scholar] [CrossRef]
  36. Caspar, T.; Lin, T.P.; Kakefuda, G.; Benbow, L.; Preiss, J.; Somerville, C. Mutants of Arabidopsis with altered regulation of starch degradation. Plant Physiol. 1991, 95, 1181–1188. [Google Scholar] [CrossRef]
  37. Zeeman, S.C.; Northrop, F.; Smith, A.M.; ap Rees, T. A starch-accumulating mutant of Arabidopsis thaliana deficient in a chloroplastic starch-hydrolyzing enzyme. Plant J. 1998, 15, 357–385. [Google Scholar] [CrossRef]
  38. Ma, Y.; Slewinski, T.L.; Baker, R.F.; Braun, D.M. Tie-dyed1 encodes a novel, phloem-expressed transmembrane protein that functions in carbohydrate partitioning. Plant Physiol. 2009, 149, 181–194. [Google Scholar] [CrossRef]
  39. Russin, W.A.; Evert, R.F.; Vanderveer, P.J.; Sharkey, T.D.; Briggs, S.P. Modification of a specific class of plasmodesmata and loss of sucrose export ability in the sucrose export defective1 maize mutant. Plant Cell 1996, 8, 645–658. [Google Scholar] [CrossRef] [PubMed][Green Version]
  40. Slewinski, T.L.; Braun, D.M. The Psychedelic genes of maize redundantly promote carbohydrate export from leaves. Genetics 2010, 185, 221–232. [Google Scholar] [CrossRef] [PubMed]
  41. Farquhar, G.D.; Sharkey, T.D. Stomatal conductance and photosynthesis. Ann. Rev. Plant Phys. 1982, 33, 317–345. [Google Scholar] [CrossRef]
  42. Yan, L.; Fu, D.; Li, C.; Dubcovsky, J. The wheat and barley vernalization gene VRN3 is an orthologue of FT. Proc. Natl. Acad. Sci. USA 2006, 103, 19581–19586. [Google Scholar] [CrossRef] [PubMed]
  43. Tsuji, H.; Taoka, K.I. Chapter Five—Florigen signaling. In The Enzymes; Machida, Y., Lin, C., Tamanoi, E., Eds.; Academic Press: Cambridge, UK, 2014. [Google Scholar] [CrossRef]
  44. Bonnin, I.; Rousset, M.; Madur, D.; Sourdille, P.; Dupuits, C.; Brunel, D.; Goldringer, I. FT genome A and D polymorphisms are associated with the variation of earliness components in hexaploid wheat. Theor. Appl. Genet. 2008, 116, 383–394. [Google Scholar] [CrossRef] [PubMed]
  45. Lee, R.; Baldwin, S.; Kenel, F.; McCallum, J.; Macknight, R. FLOWERING LOCUS T genes control onion bulb formation and flowering. Nat. Comm. 2013, 4, 2884. [Google Scholar] [CrossRef] [PubMed]
  46. Cai, Y.; Wang, L.; Chen, L.; Wu, T.; Liu, L.; Sun, S.; Xu, C.; Yao, W.; Jiang, B.; Yuan, S.; et al. Mutagenesis of GmFT2a and GmFT4a mediated by CRISPR/Cas9 contributes for expanding the regional adaptability of soybean. Plant Biotech. J. 2020, 18, 298–309. [Google Scholar] [CrossRef] [PubMed]
  47. Taoka, K.; Ohki, I.; Tsuji, H.; Furuita, K.; Hayashi, K.; Yanase, T.; Yamaguchi, M.; Nakashima, C.; Purwestri, Y.A.; Tamaki, S.; et al. 14-3-3 proteins act as intracellular receptors for rice Hd3a florigen. Nature 2011, 476, 332–335. [Google Scholar] [CrossRef]
  48. Tsuji, H.; Tachibana, C.; Tamaki, S.; Taoka, K.-I.; Kyozuka, J.; Shimamoto, K. Hd3a promotes lateral branching in rice. Plant J. 2015, 82, 256–266. [Google Scholar] [CrossRef]
  49. Dixon, L.E.; Greenwood, J.R.; Bencivenga, S.; Zhang, P.; Cockram, J.; Mellers, G.; Ramm, K.; Cavanagh, C.; Swain, S.M.; Boden, S.A. TEOSINTE BRANCHED1 regulates inflorescence architecture and development in bread wheat (Triticum aestivum). Plant Cell 2018, 30, 563–581. [Google Scholar] [CrossRef]
  50. Sakuma, S.; Schnurbusch, T. Of floral fortune: Tinkering with the grain yield potential of cereal crops. New Phytol. 2020, 225, 1873–1882. [Google Scholar] [CrossRef]
  51. Finnegan, E.J.; Ford, B.; Wallace, X.; Pettolino, F.; Griffin, P.T.; Schmitz, R.J.; Zhang, P.; Barrero, J.M.; Hayden, M.J.; Boden, S.A.; et al. Zebularine treatment is associated with deletion of FT-B1 leading to an increase in spikelet number in bread wheat. Plant Cell Environ. 2018, 41, 1346–1360. [Google Scholar] [CrossRef] [PubMed]
  52. Isham, K.; Wang, R.; Zhao, W.; Wheeler, J.; Klassen, N.; Akhunov, E.; Chen, J. QTL mapping for grain yield and three yield components in a population derived from two high- yielding spring wheat cultivars. Theor. Appl. Genet. 2021, 134, 2079–2095. [Google Scholar] [CrossRef] [PubMed]
  53. Wang, B.; Ma, M.; Lu, H.; Meng, Q.; Li, G.; Yang, X. Photosynthesis, sucrose metabolism, and starch accumulation in two NILs of winter wheat. Photosynth. Res. 2015, 126, 363–373. [Google Scholar] [CrossRef] [PubMed]
  54. Ward, J.M.; Kühn, C.; Tegeder, M.; Frommer, W.B. Sucrose transport in higher plants. Int. Rev. Cytol. 1998, 178, 41–71. [Google Scholar] [CrossRef] [PubMed]
  55. Corbesier, L.; Lejeune, P.; Bernier, G. The role of carbohydrates in the induction of flowering in Arabidopsis thaliana: Comparison between the wild type and a starchless mutant. Planta 1998, 206, 131–137. [Google Scholar] [CrossRef] [PubMed]
  56. Roldán, M.; Gómez-Mena, C.; Ruiz-García, L.; Salinas, J.; Martínez-Zapater, J.M. Sucrose availability on the aerial part of the plant promotes morphogenesis and flowering of Arabidopsis in the dark. Plant J. 1999, 20, 581–590. [Google Scholar] [CrossRef] [PubMed]
  57. Navarro, C.; Abelenda, J.A.; Cruz-Oró, E.; Cuéllar, C.A.; Tamaki, S.; Silva, J.; Shimamoto, K.; Prat, S. Control of flowering and storage organ formation in potato by FLOWERING LOCUS T. Nature 2011, 478, 119–122. [Google Scholar] [CrossRef] [PubMed]
  58. Chincinska, I.A.; Liesche, J.; Krügel, U.; Michalska, J.; Geigenberger, P.; Grimm, B.; Kühn, C. Sucrose transporter StSUT4 from potato affects flowering, tuberization, and shade avoidance response. Plant Physiol. 2008, 146, 515–528. [Google Scholar] [CrossRef] [PubMed]
  59. Hendriks, T.; Vreugdenhil, D.; Stiekema, W.J. Patatin and four serine ptoteinase inhibitor genes are fdifferentially expressed during potato tuber development. Plant Mol. Biol. 1991, 17, 385–394. [Google Scholar] [CrossRef]
  60. Abelenda, J.A.; Bergonzi, S.; Oortwijm, M.; Sonnewald, S.; Du, M.; Visser, R.G.F.; Sonnewald, W.; Bachem, W.B. Source-Sink regulation is mediated by interaction of an FT homolog with a SWEET protein in potato. Current Biol. 2019, 29, 1178–1186. [Google Scholar] [CrossRef]
  61. Wang, J.; Sun, L.; Zhang, H.; Jiao, B.; Wang, H.; Zhou, S. Transcriptome analysis during vernalization in wheat (Triticum aestivum L.). BMC Genom. Data 2023, 24, 43. [Google Scholar] [CrossRef] [PubMed]
  62. Zhang, L.; Chen, L.; Ciqiu, Y. Transcription factor WRKY75 interacts with DELLA proteins to affect flowering. Plant Physiol. 2018, 176, 790–803. [Google Scholar] [CrossRef]
  63. Oiestad, A.J.; Martin, J.M.; Giroux, M.J. Yield increases resulting from AGPase overexpression in rice are reliant on plant nutritional status. Plant Growth Reg. 2019, 89, 179–190. [Google Scholar] [CrossRef]
  64. Gouis, J.L.; Bordes, J.; Ravel, C.; Heumez, E.; Faure, S.; Praud, S.; Galic, N.; Remoué, C.; Balfourier, F.; Allard, V.; et al. Genome-wide association analysis to identify chromosomal regions determining components of earliness in wheat. Theor. Appl. Genet. 2012, 124, 597–611. [Google Scholar] [CrossRef] [PubMed]
  65. Rousset, M.; Bonnin, I.; Remoué, C.; Falque, M.; Rhoné, B.; Veyrieras, J.-B.; Madur, D.; Murigneus, A.; Balfourier, F.; Le Gouis, J.; et al. Deciphering the genetics of growth habit by an association study on candidate genes in bread wheat (Triticum aestivum L.). Theor. Appl. Genet. 2011, 123, 907–926. [Google Scholar] [CrossRef] [PubMed]
  66. Li, G.; Boontung, R.; Powers, C.; Belamkar, V.; Huang, T.; Miao, F.; Baenziger, P.S.; Yan, L. Genetic basis of the very short life cycle of ‘Apogee’ wheat. MBC Genom. 2017, 18, 838. [Google Scholar] [CrossRef] [PubMed]
  67. Kiss, T.; Dixon, L.E.; Soltész, A.; Bányai, J.; Mayer, M.; Balla, K.; Allard, V.; Galiba, G.; Slafer, G.A.; Griffiths, S.; et al. Effects of ambient temperature in association with photoperiod on phenology and on the expressions of major plant developmental genes in wheat (Triticum aestivum L.). Plant Cell Environ. 2017, 40, 1629–1642. [Google Scholar] [CrossRef]
  68. Snape, J.; Butterworth, K.; Whitechurch, E.; Worland, A.J. Waiting for fine times: Genetics of flowering time in wheat. Euphytica 2001, 119, 185–190. [Google Scholar] [CrossRef]
  69. Dreisigacker, S.; Burgueño, J.; Pacheco, A.; Molero, G.; Sukumaran, S.; Rivera-Amado, C.; Reynolds, M.; Griffiths, S. Effect of Flowering Time-Related Genes on Biomass, Harvest Index, and Grain Yield in CIMMYT Elite Spring Bread Wheat. Biology 2021, 10, 855. [Google Scholar] [CrossRef]
  70. Bheemanahalli, R.; Sunoj, V.S.J.; Saripalli, G.; Prasad, P.V.V.; Balyan, H.S.; Gupta, P.K.; Grant, N.; Gill, K.S.; Jagadish, S.V.K. Quantifying the Impact of Heat Stress on Pollen Germination, Seed Set, and Grain Filling in Spring Wheat. Crop Sci. 2019, 59, 684–696. [Google Scholar] [CrossRef]
  71. Xi, Y.; Wang, D.; Weiner, J.; Du, Y.-L.; Li, F.-M. Time to onset of flowering, water use, and yield in wheat. Agronomy 2023, 13, 1217. [Google Scholar] [CrossRef]
  72. Zhang, X.K.; Xiao, Y.G.; Zhang, Y.; Xia, X.C.; Dubcovsky, J.; He, Z.H. Alleleic variation at the vernalization genes Vrn-A1, Vrn-B1, Vrn-D1, and Vrn-B3 in Chinese wheat cultivars and their association with growth habit. Crop Sci. 2008, 48, 458–470. [Google Scholar] [CrossRef]
  73. Hansen, K.A.; Martin, J.M.; Lanning, S.P.; Talbert, L.E. Correlation of genotype performance for agronomic and physiological traits in space-planted versus densely seeded conditions. Crop Sci. 2005, 45, 1023–1028. [Google Scholar] [CrossRef]
  74. AACC International. Approved Methods of Analysis, 11th ed.; Method 39-11.01; Available Online Only; AACCI: St. Paul, MN, USA, 2010. [Google Scholar]
  75. Smith, A.M.; Zeeman, S.C. Quantification of starch in plant tissues. Nat. Protoc. 2006, 1, 1342–1345. [Google Scholar] [CrossRef]
  76. Rösti, S.; Fahy, B.; Denyer, K. A mutant of rice lacking the leaf large subunit of ADP-glucose pyrophosphorylase has drastically reduced leaf starch content but grows normally. Funct. Plant Biol. 2007, 34, 480–489. [Google Scholar] [CrossRef] [PubMed]
  77. Schmidt, M.A.; Barbazuk, W.B.; Sandford, M.; May, G.; Song, Z.; Zhou, W.; Nikolau, B.J.; Herman, E.M. Silencing of soybean seed storage proteins results in a rebalanced protein composition preserving seed protein content without major collateral changes in the metabolome and transcriptome. Plant Physiol. 2011, 156, 330–345. [Google Scholar] [CrossRef]
  78. Fiehn, O.; Wohlgemuth, G.; Scholz, M.; Kind, T.; Lee, D.; Lu, Y.; Moon, S.; Nikolau, B. Quality control for plant metabolomics: Reporting MSI-compliant studies. Plant J. 2008, 53, 691–704. [Google Scholar] [CrossRef] [PubMed]
  79. Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. Embnet J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
  80. Soper, D.S. p-Value Calculator for Correlation Coefficients [Software]. 2023. Available online: https://www.danielsoper.com/statcalc (accessed on 4 January 2023).
  81. R Core Team. R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing. 2021. Available online: https://www.R-Project.org/ (accessed on 2 December 2022).
  82. Fox, J.; Weisberg, S. An R Companion to Applied Regression, 3rd ed.; Sage: Newcastle upon Tyne, UK, 2019. [Google Scholar]
  83. Lenth, R. emmeans: Estimated Marginal Means, Aka Least-Squares Means. R Package Version 1.8.3. Available online: https://CRAN.R-project.org/package=emmeans (accessed on 19 December 2022).
  84. Wang, S.; Wong, D.; Forrest, K.; Allen, A.; Chao, S.; Huang, B.E.; Maccaferri, M.; Salvi, S.; Milner, S.G.; Cattivelli, L.; et al. Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotech. J. 2014, 12, 787–796. [Google Scholar] [CrossRef] [PubMed]
  85. Varella, A.C.; Weaver, D.K.; Blake, N.K.; Hofland, M.L.; Heo, H.-Y.; Cook, J.P.; Lamb, P.F.; Jordan, K.W.; Akhunov, E.; Chao, S.; et al. Analysis of recombinant inbred line populations derived from wheat landraces to identify new genes for wheat stem sawfly resistance. Theor. Appl. Genet. 2019, 132, 2195–2207. [Google Scholar] [CrossRef] [PubMed]
  86. Broman, K.W.; Sen, S. A Guide to QTL Mapping with R/qtl; Springer: New York, NY, USA, 2009. [Google Scholar] [CrossRef]
  87. Taylor, J.D.; Butler, D. ASMap: Linkage Map Construction Using the MSTmap Algorithm, R Package Version 0.4-7. 2014. Available online: https://cran.r-project.org/web/packages/ASMap/index.html (accessed on 6 September 2021).
Figure 1. Starch levels in flag leaves collected at 14 DAF in the dark morning (DM; one hour prior to lights on) and mid-afternoon (A) with n = 6 of greenhouse-grown plants. *, *** represent significance at p-values ≤ 0.05 and 0.001, respectively, between A and DM measurements within each genotype from one-tailed, equal variance t-tests with the hypothesis that starch would be nearly depleted in DM samples.
Figure 1. Starch levels in flag leaves collected at 14 DAF in the dark morning (DM; one hour prior to lights on) and mid-afternoon (A) with n = 6 of greenhouse-grown plants. *, *** represent significance at p-values ≤ 0.05 and 0.001, respectively, between A and DM measurements within each genotype from one-tailed, equal variance t-tests with the hypothesis that starch would be nearly depleted in DM samples.
Plants 14 00512 g001
Figure 2. Distribution of leaf starch values from RIL flag leaves at 14 DAF combined over the 2020 and 2021 growing seasons. Collection occurred at mid-afternoon with n = 3 for each RIL during the 2020 and 2021 growing seasons. Each rep consisted of a bulk of three flag leaves from individual plants. Leaf starch concentrations for RIL parent plants Berkut (6.0 ± 0.8 µg mg−1 DW) and PI 61693 (23.7 ± 4.8 µg mg−1 DW) are not included within the distribution.
Figure 2. Distribution of leaf starch values from RIL flag leaves at 14 DAF combined over the 2020 and 2021 growing seasons. Collection occurred at mid-afternoon with n = 3 for each RIL during the 2020 and 2021 growing seasons. Each rep consisted of a bulk of three flag leaves from individual plants. Leaf starch concentrations for RIL parent plants Berkut (6.0 ± 0.8 µg mg−1 DW) and PI 61693 (23.7 ± 4.8 µg mg−1 DW) are not included within the distribution.
Plants 14 00512 g002
Figure 3. Flag leaf sugars were measured at 14 DAF in RILs segregating for low leaf starch and the FT-D1ΔG allele versus RILs with high leaf starch and the full-length FT-D1 allele (n = 4). RIL parent Berkut carries FT-D1ΔG, whereas PI 61693 carries the full-length allele. Metabolite data were obtained via GC-MS/MS analysis and values represent relative peak heights. * represent significance at p-values ≤ 0.05, between FT-D1ΔG and FT-D1 genotypes for each sugar using two-tailed, equal variance t-tests.
Figure 3. Flag leaf sugars were measured at 14 DAF in RILs segregating for low leaf starch and the FT-D1ΔG allele versus RILs with high leaf starch and the full-length FT-D1 allele (n = 4). RIL parent Berkut carries FT-D1ΔG, whereas PI 61693 carries the full-length allele. Metabolite data were obtained via GC-MS/MS analysis and values represent relative peak heights. * represent significance at p-values ≤ 0.05, between FT-D1ΔG and FT-D1 genotypes for each sugar using two-tailed, equal variance t-tests.
Plants 14 00512 g003
Figure 4. Model for Flowering Time Breeding Efforts Based on Environment. Warmer, dryer environments (dryland) see increased yield with earlier flowering time while cooler, wetter environments (irrigated) see increased yield with later flowering time.
Figure 4. Model for Flowering Time Breeding Efforts Based on Environment. Warmer, dryer environments (dryland) see increased yield with earlier flowering time while cooler, wetter environments (irrigated) see increased yield with later flowering time.
Plants 14 00512 g004
Table 1. Growth and yield of recombinant inbred lines (RILs) derived from a Berkut × PI 61693 cross-grown during the 2020 and 2021 growing seasons a.
Table 1. Growth and yield of recombinant inbred lines (RILs) derived from a Berkut × PI 61693 cross-grown during the 2020 and 2021 growing seasons a.
Days to Anthesis Leaf Starch
(µg mg−1 DW)
Height b
(cm)
Biomass b
(g)
Seed Wt b
(g)
ISW b
(mg)
Seed No b Seed
Protein c
HI c
2020
Range61.0–66.0 4.26–32.7 55.9–92.7 26.5–146 8.9–46.5 31.5–50.5 226–1,099 12.1–18.6 0.28–0.37
Mean62.8 17.3 73.7 66.121.640.554014.4 0.33
F2.60 ***1.95 ***4.50 ***4.01 ***3.63 ***3.63 ***3.58 ***7.74 ***2.57 ***
2021
Range58.0–67.3 1.83–16.3 48.0–94.0 24.3–109 4.8–33.5 22.7–42.3 168–937 12.3–16.2 0.18–0.40
Mean61.5 5.265.7 58.6 17.8 32.455214.0 0.30
F5.83 ***4.10 ***7.704.79 ***3.70 ***3.70 ***3.37 ***5.32 ***1.04
Combined
Range59.7–66.0 5.5–20.4 51.9–87.9 25.4–126 6.9–40.0 27.7–46.4 202–999 12.3–17.1 0.24–0.35
Mean62.2 11.3 69.7 62.4 19.7 36.4 543.7 14.2 0.32
F5.17 ***2.00 ***9.32 ***5.16 ***4.79 ***9.34 ***7.09 ***9.29 ***1.86 ***
2020 v 2021
r0.56 *** 0.25 * 0.71 *** 0.58 *** 0.57 *** 0.72 *** 0.58 *** 0.75 *** 0.21 ***
a Leaf starch was measured in flag leaves collected mid-afternoon at 14 DAF with n = 3. b Three plants per plot were harvested and growth parameters are reported as the average of three plants with n = 2 for each genotype. Days to anthesis is the average of all three plots (n = 3). c ISW represents individual seed weight and HI represents harvest index. Protein is based on 12% moisture. *, *** represent significance at p-values ≤ 0.05, and 0.001, respectively.
Table 2. Growth and yield parameters for RIL parents PI 61693 and Berkut for the 2020 and 2021 field seasons a.
Table 2. Growth and yield parameters for RIL parents PI 61693 and Berkut for the 2020 and 2021 field seasons a.
Days to AnthesisLeaf Starch (µg mg−1 DW)Height (cm)Biomass (g)Seed Wt (g)ISW
(mg)
Seed NoSeed ProteinHarvest Index
2020
Berkut66.0 ± 2.14.3 ± 1.174.9 ± 1.367.3 ± 22.621.2 ± 7.539.4 ± 1.4545 ± 20813.4 ± 1.30.31 ± 0.01
PI 6169362.0 ± 0.631.2 ± 7.772.4 ± 1.337.3 ± 2.612.2 ± 1.440.1 ± 0.6304 ± 3014.2 ± 0.10.33 ± 0.01
p-Value0.140.070.290.320.360.670.370.620.46
2021
Berkut63.0 ± 0.67.2 ± 0.263.7 ± 1.250.6 ± 2.816.8 ± 1.034.9 ± 0.5482 ± 3615.0 ± 0.40.33 ± 0.0
PI 6169359.3 ± 0.316.3 ± 0.965.3 ± 4.561.9 ± 0.820.5 ± 1.035.9 ± 0.4572 ± 3515.1 ± 0.30.33 ± 0.01
p-value0.010.0010.740.060.120.280.210.840.89
Combined
Berkut64.5 ± 1.56.0 ± 0.868.2 ± 2.958.9 ± 10.519.0 ± 3.337.1 ± 1.4513 ± 8814.2 ± 0.70.32 ± 0.01
PI 6169360.7 ± 0.723.7 ± 4.868.2 ± 3.049.6 ± 7.116.3 ± 2.538.0 ± 1.3438 ± 8014.6 ± 0.30.33 ± 0.01
p-Value0.020.011.00.490.550.670.550.600.57
a Values represent average ± SE with n = 2 for each genotype except days to anthesis and leaf starch where n = 3. Leaf starch was measured in flag leaves collected mid-afternoon at 14 DAF. Growth parameters such as biomass and seed weight are reported on an individual plant basis. ISW represents individual seed weight. Protein is based on 12% moisture. p-Values are from 2-tailed t-tests with equal variance.
Table 3. Correlation coefficients for plant growth and yield for a Berkut × PI 61693 RIL population grown under irrigated field conditions combined over the 2020 and 2021 field seasons a.
Table 3. Correlation coefficients for plant growth and yield for a Berkut × PI 61693 RIL population grown under irrigated field conditions combined over the 2020 and 2021 field seasons a.
Days to AnthesisLeaf Starch Height BiomassSeed WtIndividual Seed WeightSeed No Seed ProteinHarvest Index
Days to Anthesis--
Leaf Starch −0.25 *--
Height 0.38 ***−0.13--
Biomass 0.60 ***−0.39 ***0.65 ***--
Seed Wt 0.57 ***−0.40 ***0.58 ***0.99 ***--
Individual Seed Weight 0.10-0.010.45 ***0.190.13--
Seed No0.51 ***−0.38 ***0.41 ***0.90 ***0.94 ***-0.19--
Seed Protein−0.110.24 *0.02−0.27 **−0.35 **0.23 *−0.41 ***--
Harvest Index−0.01−0.24 *−0.190.210.33 **−0.160.39 ***−0.51 ***--
a Plants were grown under space plant density and each genotype was replicated within a complete randomized block design. *, **, *** indicate 2-tailed probability at p-values ≤ 0.05, 0.01, 0.001, respectively.
Table 4. Quantitative trait loci (QTL) identified for plant productivity and leaf starch at grain fill in a Berkut × PI 61693 RIL population.
Table 4. Quantitative trait loci (QTL) identified for plant productivity and leaf starch at grain fill in a Berkut × PI 61693 RIL population.
TraitPeak MarkerChrQTL Position (cM)LODSource EffectPercent Effect
2020
Days to AnthesisBobWhite_c5970_7317D764.6PI 61693Earlier26.6
Leaf StarchBobWhite_c5970_7317D773.9PI 61693Increase22.9
BiomassBobWhite_c5970_7317D766.3PI 61693Decrease34.2
Seed NoBobWhite_c5970_7317D796PI 61693Decrease20.6
Seed NoBS00110350_51 3A1113.8PI 61693Decrease9.9
Seed WeightBobWhite_c5970_7317D765.7PI 61693Decrease31.5
ProteinRAC875_c8842_7247D374.2PI 61693Increase24.3
2021
None detected
Combined
BiomassBobWhite_c5970_7317D764.6PI 61693Decrease26.4
Seed NoBobWhite_c5970_7317D774.8PI 61693Decrease27.3
Seed WeightBobWhite_c5970_7317D764.3PI 61693Decrease25.2
ProteinRAC875_c8842_7247D373.8PI 61693Increase22.4
Table 5. Expression of candidate genes in 14 DAF flag leaves located within 7D: 62,106,312–73,745,641 of IWSGC refseqv1.0 a.
Table 5. Expression of candidate genes in 14 DAF flag leaves located within 7D: 62,106,312–73,745,641 of IWSGC refseqv1.0 a.
GeneProtein Name (Uniprot)BerkutPI 61693
TraesCS7D02G103300B box-type domain-containing protein22.9918.18
TraesCS7D02G1035002Fe-2S ferredoxin-type domain-containing protein262.43248.63
TraesCS7D02G103800Transcription elongation factor 1 homolog18.1164.31
TraesCS7D02G104400Bacterial surface antigen (D15) domain-containing protein17.7713.59
TraesCS7D02G105500Proteasome subunit beta53.6859.18
TraesCS7D02G105700DUF676 domain-containing protein9.3512.57
TraesCS7D02G105900Thiol methyltransferase 215.9225.63
TraesCS7D02G106400Mitogen-activated protein kinase13.9511.48
TraesCS7D02G106500Uncharacterized protein5.598.98
TraesCS7D02G107500RING-type domain-containing protein9.2715.53
TraesCS7D02G107600Uncharacterized protein22.6537.82
TraesCS7D02G108200AAA+ ATPase domain-containing protein8.186.70
TraesCS7D02G111300Succinate dehydrogenase assembly factor 4, mitochondrial11.4418.07
TraesCS7D02G111500Phytochromobilin:ferredoxin oxidoreductase, chloroplastic4.4211.04
TraesCS7D02G111600Putative kinase inhibitor WFT, Flowering locus T protein50.58219.66
TraesCS7D02G111800GDSL esterase/lipase26.4882.82
TraesCS7D02G113200PIN domain-containing protein9.3810.93
TraesCS7D02G115400Histone H3.26.025.92
TraesCS7D02G117800Starch synthase wSsI-1, chloroplastic/amyloplastic42.8228.37
TraesCS7D02G118100UBA domain-containing protein9.8713.88
a 165 candidate genes were identified within 7D: 62,106,312–73,743,194. Candidate genes were only included within this table if they had expression values ≥ 5.0. Tissue was collected in the 2019 Original Starch Survey Field Trial. Samples consist of composites of three biological reps, where each biological rep was the bulk of three flag leaves collected from individual plants. Therefore, values are from single samples, but represent a composite of nine plants for each genotype. The putative protein function may be found in Table S3.
Table 6. Average temperatures (°C) for the 2019–2021 growing seasons.
Table 6. Average temperatures (°C) for the 2019–2021 growing seasons.
MayJuneJulyAugust
201925.421.525.927.0
202017.321.226.928.5
202115.626.631.226.2
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Oiestad, A.J.; Blake, N.K.; Tillett, B.J.; O’Sullivan, S.T.; Cook, J.P.; Giroux, M.J. Plant Productivity and Leaf Starch During Grain Fill Is Linked to QTL Containing Flowering Locus T1 (FT1) in Wheat (Triticum aestivum L.). Plants 2025, 14, 512. https://doi.org/10.3390/plants14040512

AMA Style

Oiestad AJ, Blake NK, Tillett BJ, O’Sullivan ST, Cook JP, Giroux MJ. Plant Productivity and Leaf Starch During Grain Fill Is Linked to QTL Containing Flowering Locus T1 (FT1) in Wheat (Triticum aestivum L.). Plants. 2025; 14(4):512. https://doi.org/10.3390/plants14040512

Chicago/Turabian Style

Oiestad, Alanna J., Nancy K. Blake, Brandon J. Tillett, Sergei T. O’Sullivan, Jason P. Cook, and Michael J. Giroux. 2025. "Plant Productivity and Leaf Starch During Grain Fill Is Linked to QTL Containing Flowering Locus T1 (FT1) in Wheat (Triticum aestivum L.)" Plants 14, no. 4: 512. https://doi.org/10.3390/plants14040512

APA Style

Oiestad, A. J., Blake, N. K., Tillett, B. J., O’Sullivan, S. T., Cook, J. P., & Giroux, M. J. (2025). Plant Productivity and Leaf Starch During Grain Fill Is Linked to QTL Containing Flowering Locus T1 (FT1) in Wheat (Triticum aestivum L.). Plants, 14(4), 512. https://doi.org/10.3390/plants14040512

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop