Brassinosteroid Enhances Cucumber Stress Tolerance to NaHCO3 by Modulating Nitrogen Metabolism, Ionic Balance and Phytohormonal Response
Abstract
1. Introduction
2. Results
2.1. Effects of Exogenous EBR on Cucumber Seedling Growth Under NaHCO3 Stress
2.2. Effects of Exogenous EBR on Nitrogen Metabolism in Cucumber Seedlings Under NaHCO3 Stress
2.3. Effects of Exogenous EBR on Aminotransferase Activities Under NaHCO3 Stress
2.4. Effects of Exogenous EBR on Ionic Homeostasis in Cucumber Seedlings Under NaHCO3 Stress
2.5. Effects of Exogenous EBR on Ion Homeostasis and Hormonal Balance Under NaHCO3 Stress
2.6. Effects of Exogenous EBR on Aquaporin Gene Expression in Cucumber Roots Under NaHCO3 Stress
3. Discussion
4. Materials and Methods
4.1. Experimental Materials and Design
4.2. Determination of Root Vitality and Active Root Absorption Area
4.3. Determination of Nitrate and Ammonium Nitrogen Content
4.4. Determination of NR, GS, GOGAT, and GDH Activity
4.5. Determination of GOT and GPT Activity
4.6. Plant Nutrient Analysis
4.7. Gene Expression Analysis
4.8. Measurement of Vacuolar Membrane H+-ATPase and H+-PPase Activity
4.9. Measurement of Plasma Membrane H+-ATPase Activity
4.10. Determination of ABA, GA, and IAA Content
4.11. Data Processing
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Abdel Latef, A.A.; Tran, L.-S.P. Impacts of priming with silicon on the growth and tolerance of maize plants to alkaline stress. Front. Plant Sci. 2016, 7, 182842. [Google Scholar] [CrossRef] [PubMed]
- Liu, N.; Gong, B.; Jin, Z.; Wang, X.; Wei, M.; Yang, F.; Li, Y.; Shi, Q. Sodic alkaline stress mitigation by exogenous melatonin in tomato needs nitric oxide as a downstream signal. J. Plant Physiol. 2015, 186, 68–77. [Google Scholar] [CrossRef] [PubMed]
- Fang, S.; Hou, X.; Liang, X. Response mechanisms of plants under saline-alkali stress. Front. Plant Sci. 2021, 12, 667458. [Google Scholar] [CrossRef] [PubMed]
- Andriani, A.; Tachibana, S.; Itoh, K. Effects of saline-alkaline stress on benzo[a]pyrene biotransformation and ligninolytic enzyme expression by Bjerkandera adusta SM46. World J. Microbiol. Biotechnol. 2016, 32, 39. [Google Scholar] [CrossRef] [PubMed]
- Rao, Y.; Peng, T.; Xue, S. Mechanisms of plant saline-alkaline tolerance. J. Plant Physiol. 2023, 281, 153916. [Google Scholar] [CrossRef]
- Lu, X.; Min, W.; Shi, Y.; Tian, L.; Li, P.; Ma, T.; Zhang, Y.; Luo, C. Exogenous melatonin alleviates alkaline stress by removing reactive oxygen species and promoting antioxidant defence in rice seedlings. Front. Plant Sci. 2022, 13, 849553. [Google Scholar] [CrossRef]
- Guo, S.-H.; Niu, Y.-J.; Zhai, H.; Han, N.; Du, Y.-P. Effects of alkaline stress on organic acid metabolism in roots of grape hybrid rootstocks. Sci. Hortic. 2018, 227, 255–260. [Google Scholar] [CrossRef]
- Guo, R.; Zhou, J.; Hao, W.; Gong, D.; Zhong, X.; Gu, F.; Liu, Q.; Xia, X.; Tian, J.; Li, H. Germination, growth, photosynthesis and ionic balance in Setaria viridis seedlings subjected to saline and alkaline stress. Can. J. Plant Sci. 2011, 91, 1077–1088. [Google Scholar] [CrossRef]
- Sharma, A.; Kumar, V.; Kanwar, M.; Thukral, A.; Bhardwaj, R. Ameliorating imidacloprid induced oxidative stress by 24-epibrassinolide in Brassica juncea L. Russ. J. Plant Physiol. 2017, 64, 509–517. [Google Scholar] [CrossRef]
- Shahzad, B.; Tanveer, M.; Che, Z.; Rehman, A.; Cheema, S.A.; Sharma, A.; Song, H.; ur Rehman, S.; Zhaorong, D. Role of 24-epibrassinolide (EBL) in mediating heavy metal and pesticide induced oxidative stress in plants: A review. Ecotoxicol. Environ. Saf. 2018, 147, 935–944. [Google Scholar] [CrossRef]
- Nie, W.; Gong, B.; Geng, B.; Wen, D.; Qiao, P.; Guo, H.; Shi, Q. The Effects of Exogenous 2,4-Epibrassinolide on the Germination of Cucumber Seeds under NaHCO3 Stress. Plants 2024, 13, 394. [Google Scholar] [CrossRef] [PubMed]
- Kolomeichuk, L.V.; Murgan, O.G.K.; Danilova, E.D.; Serafimovich, M.V.; Khripach, V.A.; Litvinovskaya, R.P.; Sauchuk, A.L.; Denisiuk, D.V.; Zhabinskii, V.N.; Kuznetsov, V.V.; et al. Effects of Lactone- and Ketone-Brassinosteroids of the 28-Homobrassinolide Series on Barley Plants under Water Deficit. Plants 2024, 13, 1345. [Google Scholar] [CrossRef] [PubMed]
- Lima, J.V.; Lobato, A.K.S. Brassinosteroids improve photosystem II efficiency, gas exchange, antioxidant enzymes and growth of cowpea plants exposed to water deficit. Physiol. Mol. Biol. Plants 2017, 23, 59–72. [Google Scholar] [CrossRef] [PubMed]
- Eremina, M.; Unterholzner, S.J.; Rathnayake, A.I.; Castellanos, M.; Khan, M.; Kugler, K.G.; May, S.T.; Mayer, K.F.X.; Rozhon, W.; Poppenberger, B. Brassinosteroids participate in the control of basal and acquired freezing tolerance of plants. Proc. Natl. Acad. Sci. USA 2016, 113, E5982–E5991. [Google Scholar] [CrossRef] [PubMed]
- Yin, Y.; Qin, K.; Song, X.; Zhang, Q.; Zhou, Y.; Xia, X.; Yu, J. BZR1 Transcription Factor Regulates Heat Stress Tolerance Through FERONIA Receptor-Like Kinase-Mediated Reactive Oxygen Species Signaling in Tomato. Plant Cell Physiol. 2018, 59, 2239–2254. [Google Scholar] [CrossRef]
- Rajewska, I.; Talarek, M.; Bajguz, A. Brassinosteroids and Response of Plants to Heavy Metals Action. Front. Plant Sci. 2016, 7, 197845. [Google Scholar] [CrossRef]
- Wu, C.; Li, F.; Xu, H.; Zeng, W.; Yu, R.; Wu, X.; Shen, L.; Liu, Y.; Li, J. The Potential Role of Brassinosteroids (BRs) in Alleviating Antimony (Sb) Stress in Arabidopsis thaliana. Plant Physiol. Biochem. 2019, 141, 51–59. [Google Scholar] [CrossRef]
- Ahammed, G.J.; Li, X.; Liu, A.; Chen, S. Brassinosteroids in Plant Tolerance to Abiotic Stress. J. Plant Growth Regul. 2020, 39, 1451–1464. [Google Scholar] [CrossRef]
- Hao, J.; Yin, Y.; Fei, S.-Z. Brassinosteroid Signaling Network: Implications on Yield and Stress Tolerance. Plant Cell Rep. 2013, 32, 1017–1030. [Google Scholar] [CrossRef]
- Zhang, D.-W.; Deng, X.-G.; Fu, F.-Q.; Lin, H.-H. Induction of Plant Virus Defense Response by Brassinosteroids and Brassinosteroid Signaling in Arabidopsis thaliana. Planta 2015, 241, 875–885. [Google Scholar] [CrossRef]
- Xia, X.; Liu, Y.; Zhang, L.; Qi, Z.; Zhou, Y.; Yu, J. Overexpression of Brassinosteroid Synthesis Gene DWARF Promotes Resistance to Botrytis cinerea by Inhibiting Gibberellin Synthesis in Solanum lycopersicum L. Plant Stress 2023, 9, 100170. [Google Scholar] [CrossRef]
- Sahni, S.; Prasad, B.D.; Liu, Q.; Grbic, V.; Sharpe, A.; Singh, S.P.; Krishna, P. Overexpression of the Brassinosteroid Biosynthetic Gene DWF4 in Brassica napus Simultaneously Increases Seed Yield and Stress Tolerance. Sci. Rep. 2016, 6, 28298. [Google Scholar] [CrossRef] [PubMed]
- Fàbregas, N.; Lozano-Elena, F.; Blasco-Escámez, D.; Tohge, T.; Martínez-Andújar, C.; Albacete, A.; Osorio, S.; Bustamante, M.; Riechmann, J.L.; Nomura, T. Overexpression of the Vascular Brassinosteroid Receptor BRL3 Confers Drought Resistance Without Penalizing Plant Growth. Nat. Commun. 2018, 9, 4680. [Google Scholar] [CrossRef] [PubMed]
- Yuan, L.; Yuan, Y.; Du, J.; Sun, J.; Guo, S. Effects of 24-Epibrassinolide on Nitrogen Metabolism in Cucumber Seedlings under Ca(NO3)2 Stress. Plant Physiol. Biochem. 2012, 61, 29–35. [Google Scholar] [CrossRef]
- Mu, D.-W.; Feng, N.-J.; Zheng, D.-F.; Zhou, H.; Liu, L.; Chen, G.-J.; Mu, B. Physiological Mechanism of Exogenous Brassinolide Alleviating Salt Stress Injury in Rice Seedlings. Sci. Rep. 2022, 12, 20439. [Google Scholar] [CrossRef]
- Su, Q.; Zheng, X.; Tian, Y.; Wang, C. Exogenous Brassinolide Alleviates Salt Stress in Malus hupehensis Rehd. by Regulating the Transcription of NHX-Type Na+(K+)/H+ Antiporters. Front. Plant Sci. 2020, 11, 38. [Google Scholar] [CrossRef]
- Otie, V.; Udo, I.; Shao, Y.; Itam, M.O.; Okamoto, H.; An, P.; Eneji, E.A. Salinity Effects on Morpho-Physiological and Yield Traits of Soybean (Glycine max L.) as Mediated by Foliar Spray with Brassinolide. Plants 2021, 10, 541. [Google Scholar] [CrossRef]
- Ali, B.; Hayat, S.; Fariduddin, Q.; Ahmad, A. 24-Epibrassinolide Protects Against the Stress Generated by Salinity and Nickel in Brassica juncea. Chemosphere 2008, 72, 1387–1392. [Google Scholar] [CrossRef]
- Amraee, L.; Rahmani, F.; Abdollahi Mandoulakani, B. 24-Epibrassinolide Alters DNA Cytosine Methylation of Linum usitatissimum L. under Salinity Stress. Plant Physiol. Biochem. 2019, 139, 478–484. [Google Scholar] [CrossRef]
- Yue, J.; You, Y.; Zhang, L.; Fu, Z.; Wang, J.; Zhang, J.; Guy, R.D. Exogenous 24-Epibrassinolide Alleviates Effects of Salt Stress on Chloroplasts and Photosynthesis in Robinia pseudoacacia L. Seedlings. J. Plant Growth Regul. 2019, 38, 669–682. [Google Scholar] [CrossRef]
- Vardhini, B.V.; Anjum, N.A. Brassinosteroids Make Plant Life Easier under Abiotic Stresses Mainly by Modulating Major Components of Antioxidant Defense System. Front. Environ. Sci. 2015, 2, 67. [Google Scholar] [CrossRef]
- Cui, F.; Liu, L.; Zhao, Q.; Zhang, Z.; Li, Q.; Lin, B.; Wu, Y.; Tang, S.; Xie, Q. Arabidopsis Ubiquitin Conjugase UBC32 is an ERAD Component That Functions in Brassinosteroid-Mediated Salt Stress Tolerance. Plant Cell 2012, 24, 233–244. [Google Scholar] [CrossRef] [PubMed]
- Nie, W.; Gong, B.; Chen, Y.; Wang, J.; Wei, M.; Shi, Q. Photosynthetic Capacity, Ion Homeostasis, and Reactive Oxygen Metabolism Were Involved in Exogenous Salicylic Acid Increasing Cucumber Seedlings’ Tolerance to Alkaline Stress. Scientia Hortic. 2018, 235, 413–423. [Google Scholar] [CrossRef]
- Sun, Z.; Zou, Y.; Xie, C.; Han, L.; Zheng, X.; Tian, Y.; Ma, C.; Liu, X.; Wang, C. Brassinolide Improves the Tolerance of Malus hupehensis to Alkaline Stress. Front. Plant Sci. 2022, 13, 1032646. [Google Scholar] [CrossRef] [PubMed]
- Dubey, R.S.; Srivastava, R.K.; Pessarakli, M. Physiological mechanisms of nitrogen absorption and assimilation in plants under stressful conditions. In Handbook of Plant and Crop Physiology; CRC Press: Boca Raton, FL, USA, 2021; pp. 579–616. [Google Scholar] [CrossRef]
- da Silveira, A.P.D.; Sala, V.M.R.; Cardoso, E.J.B.N.; Labanca, E.G.; Cipriano, M.A.P. Nitrogen metabolism and growth of wheat plant under diazotrophic endophytic bacteria inoculation. Appl. Soil Ecol. 2016, 107, 313–319. [Google Scholar] [CrossRef]
- Kishorekumar, R.; Bulle, M.; Wany, A.; Gupta, K.J. An overview of important enzymes involved in nitrogen assimilation of plants. In Nitrogen Metabolism in Plants: Methods and Protocols; Humana: New York, NY, USA, 2020; pp. 1–13. [Google Scholar] [CrossRef]
- Meng, S.; Su, L.; Li, Y.; Wang, Y.; Zhang, C.; Zhao, Z. Nitrate and ammonium contribute to the distinct nitrogen metabolism of Populus simonii during moderate salt stress. PLoS ONE 2016, 11, e0150354. [Google Scholar] [CrossRef]
- Zhang, H.; Liu, X.-L.; Zhang, R.-X.; Yuan, H.-Y.; Wang, M.-M.; Yang, H.-Y.; Ma, H.-Y.; Liu, D.; Jiang, C.-J.; Liang, Z.-W. Root damage under alkaline stress is associated with reactive oxygen species accumulation in rice (Oryza sativa L.). Front. Plant Sci. 2017, 8, 1580. [Google Scholar] [CrossRef]
- Kaiser, J.; Lewis, O. Nitrate reductase and glutamine synthetase activity in leaves and roots of nitrate-fed Helianthus annuus L. Plant Soil 1984, 77, 127–130. [Google Scholar] [CrossRef]
- Suzuki, A. Glutamate synthase and amino acid synthesis in higher plants. In Advances in Botanical Research; Elsevier: Amsterdam, The Netherlands, 2021; Volume 100, pp. 129–144. [Google Scholar] [CrossRef]
- Robinson, S.A.; Slade, A.P.; Fox, G.G.; Phillips, R.; Ratcliffe, R.G.; Stewart, G.R. The role of glutamate dehydrogenase in plant nitrogen metabolism. Plant Physiol. 1991, 95, 509–516. [Google Scholar] [CrossRef]
- Liu, L.; Wang, J.; Han, Z.; Sun, X.; Li, H.; Zhang, J.; Lu, Y. Molecular analyses of tomato GS, GOGAT and GDH gene families and their response to abiotic stresses. Acta Physiol. Plant. 2016, 38, 229. [Google Scholar] [CrossRef]
- Liu, X.; Hu, B.; Chu, C. Nitrogen assimilation in plants: Current status and future prospects. J. Genet. Genomics 2022, 49, 394–404. [Google Scholar] [CrossRef]
- Dal Cortivo, C.; Conselvan, G.B.; Carletti, P.; Barion, G.; Sella, L.; Vamerali, T. Biostimulant effects of seed-applied sedaxane fungicide: Morphological and physiological changes in maize seedlings. Front. Plant Sci. 2017, 8, 312336. [Google Scholar] [CrossRef] [PubMed]
- Gong, B.; Wen, D.; Bloszies, S.; Li, X.; Wei, M.; Yang, F.; Shi, Q.; Wang, X. Comparative effects of NaCl and NaHCO3 stresses on respiratory metabolism, antioxidant system, nutritional status, and organic acid metabolism in tomato roots. Acta Physiol. Plant. 2014, 36, 2167–2181. [Google Scholar] [CrossRef]
- Fortunato, S.; Nigro, D.; Lasorella, C.; Marcotuli, I.; Gadaleta, A.; de Pinto, M.C. The Role of Glutamine Synthetase (GS) and Glutamate Synthase (GOGAT) in the Improvement of Nitrogen Use Efficiency in Cereals. Biomolecules 2023, 13, 1771. [Google Scholar] [CrossRef] [PubMed]
- GEDİK, N.P.; Sun, L.; Mishra, N. Defensive manoeuvres of NHX1 and SOS1 co/overexpression in plant salt tolerance. Turk. J. Bot. 2020, 44, 367–376. [Google Scholar] [CrossRef]
- Guo, R.; Shi, L.; Yang, Y. Germination, growth, osmotic adjustment and ionic balance of wheat in response to saline and alkaline stresses. Soil Sci. Plant Nutr. 2009, 55, 667–679. [Google Scholar] [CrossRef]
- Ma, H.; Yang, H.; Lü, X.; Pan, Y.; Wu, H.; Liang, Z.; Ooi, M.K. Does high pH give a reliable assessment of the effect of alkaline soil on seed germination? A case study with Leymus chinensis (Poaceae). Plant Soil 2015, 394, 35–43. [Google Scholar] [CrossRef]
- Jan, R.; Kim, N.; Lee, S.-H.; Khan, M.A.; Asaf, S.; Lubna; Park, J.-R.; Asif, S.; Lee, I.-J.; Kim, K.-M. Enhanced flavonoid accumulation reduces combined salt and heat stress through regulation of transcriptional and hormonal mechanisms. Front. Plant Sci. 2021, 12, 796956. [Google Scholar] [CrossRef]
- Serrano, R.; Rodriguez-Navarro, A. Ion homeostasis during salt stress in plants. Curr. Opin. Cell Biol. 2001, 13, 399–404. [Google Scholar] [CrossRef]
- Rahman, A.; Nahar, K.; Hasanuzzaman, M.; Fujita, M. Calcium supplementation improves Na+/K+ ratio, antioxidant defense and glyoxalase systems in salt-stressed rice seedlings. Front. Plant Sci. 2016, 7, 188581. [Google Scholar] [CrossRef]
- Liang, G.-H.; Hua, Y.-P.; Zhou, T.; Song, H.-X.; Zhang, Z. Research progress on vacuolar H+-ATPase and H+-PPase in plant. J. Agric. Sci. Technol. 2020, 22, 19–27. [Google Scholar] [CrossRef]
- Torabian, S.; Farhangi-Abriz, S.; Rathjen, J. Biochar and lignite affect H+-ATPase and H+-PPase activities in root tonoplast and nutrient contents of mung bean under salt stress. Plant Physiol. Biochem. 2018, 129, 141–149. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.-K. Plant salt tolerance. Trends Plant Sci. 2001, 6, 66–71. [Google Scholar] [CrossRef] [PubMed]
- Mehlmer, N.; Wurzinger, B.; Stael, S.; Hofmann-Rodrigues, D.; Csaszar, E.; Pfister, B.; Bayer, R.; Teige, M. The Ca2+-dependent protein kinase CPK3 is required for MAPK-independent salt-stress acclimation in Arabidopsis. Plant J. 2010, 63, 484–498. [Google Scholar] [CrossRef] [PubMed]
- Läuchli, A.; Lüttge, U. Salinity: Environment-Plants-Molecules; Springer: Berlin/Heidelberg, Germany, 2002. [Google Scholar] [CrossRef]
- Parida, A.K.; Das, A.B. Salt tolerance and salinity effects on plants: A review. Ecotoxicol. Environ. Saf. 2005, 60, 324–349. [Google Scholar] [CrossRef]
- Munns, R.; Tester, M. Mechanisms of salinity tolerance. Annu. Rev. Plant Biol. 2008, 59, 651–681. [Google Scholar] [CrossRef]
- Farhat, N.; Elkhouni, A.; Zorrig, W.; Smaoui, A.; Abdelly, C.; Rabhi, M. Effects of magnesium deficiency on photosynthesis and carbohydrate partitioning. Acta Physiol. Plant. 2016, 38, 145. [Google Scholar] [CrossRef]
- Luo, S.; Luo, T.; Peng, P.; Li, Y.; Li, X. Disturbance of chlorophyll biosynthesis at Mg branch affects the chloroplast ROS homeostasis and Ca 2+ signaling in Pisum sativum. Plant Cell Tissue Organ Cult. (PCTOC) 2016, 127, 729–737. [Google Scholar] [CrossRef]
- Briskin, D.P.; Poole, R.J. Role of magnesium in the plasma membrane ATPase of red beet. Plant Physiol. 1983, 71, 969–971. [Google Scholar] [CrossRef]
- Meng, K.; Wu, Y. Footprints of divergent evolution in two Na+/H+ type antiporter gene families (NHX and SOS1) in the genus Populus. Tree Physiol. 2018, 38, 813–824. [Google Scholar] [CrossRef]
- Nehrke, K.; Melvin, J.E. The NHX family of Na+-H+ exchangers in Caenorhabditis elegans. J. Biol. Chem. 2002, 277, 29036–29044. [Google Scholar] [CrossRef]
- Gu, W.-T.; Zhou, L.-B.; Liu, R.-Y.; Jin, W.-J.; Qu, Y.; Dong, X.-C.; Li, W.-J. Synergistic responses of NHX, AKT1, and SOS1 in the control of Na+ homeostasis in sweet sorghum mutants induced by 12C6+-ion irradiation. Nucl. Sci. Tech. 2018, 29, 10. [Google Scholar] [CrossRef]
- Zhao, X.; Wei, P.; Liu, Z.; Yu, B.; Shi, H. Soybean Na+/H+ antiporter GmsSOS1 enhances antioxidant enzyme activity and reduces Na+ accumulation in Arabidopsis and yeast cells under salt stress. Acta Physiol. Plant. 2017, 39, 19. [Google Scholar] [CrossRef]
- Maach, M.; Akodad, M.; Rodríguez-Rosal, M.P.; Venema, K.; Skalli, A.; Hmeid, H.A.; Gueddari, H.; Baghour, M. Strategies of NHX antiporters to deal with salt stress. Plant Sci. Today 2024, 10, 329–335. [Google Scholar] [CrossRef]
- Ohnishi, M.; Fukada-Tanaka, S.; Hoshino, A.; Takada, J.; Inagaki, Y.; Iida, S. Two NHX genes encoding Na+/H+ antiporters and blue flower coloration in the Japanese morning glory (Ipomoea nil). Plant Cell Physiol. 2005, 46, S156. Available online: http://hdl.handle.net/2433/6605 (accessed on 25 September 2024).
- Yokoi, S.; Quintero, F.J.; Cubero, B.; Ruiz, M.T.; Bressan, R.A.; Hasegawa, P.M.; Pardo, J.M. Differential expression and function of Arabidopsis thaliana NHX Na+/H+ antiporters in the salt stress response. Plant J. 2002, 30, 529–539. [Google Scholar] [CrossRef]
- Cui, J.-q.; Hua, Y.-p.; Zhou, T.; Liu, Y.; Huang, J.-y.; Yue, C.-p. Global landscapes of the Na+/H+ antiporter (NHX) family members uncover their potential roles in regulating the rapeseed resistance to salt stress. Int. J. Mol. Sci. 2020, 21, 3429. [Google Scholar] [CrossRef]
- Roy, P.; Niyogi, K.; Sengupta, D.N.; Ghosh, B. Spermidine treatment to rice seedlings recovers salinity stress-induced damage of plasma membrane and PM-bound H+-ATPase in salt-tolerant and salt-sensitive rice cultivars. Plant Sci. 2005, 168, 583–591. [Google Scholar] [CrossRef]
- Zhu, J.-K. Regulation of ion homeostasis under salt stress. Curr. Opin. Plant Biol. 2003, 6, 441–445. [Google Scholar] [CrossRef]
- Menegassi, A.; Da Silva e Silva, R.; Carlini, C.R.; Mithöfer, A.; Becker-Ritt, A.B. Analysis of herbivore stress-and phytohormone-mediated urease expression in soybean (Glycine max). J. Plant Growth Regul. 2018, 37, 419–425. [Google Scholar] [CrossRef]
- Wilkinson, S.; Kudoyarova, G.R.; Veselov, D.S.; Arkhipova, T.N.; Davies, W.J. Plant hormone interactions: Innovative targets for crop breeding and management. J. Exp. Bot. 2012, 63, 3499–3509. [Google Scholar] [CrossRef]
- Zörb, C.; Geilfus, C.-M.; Mühling, K.H.; Ludwig-Müller, J. The influence of salt stress on ABA and auxin concentrations in two maize cultivars differing in salt resistance. J. Plant Physiol. 2013, 170, 220–224. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Wang, J.; Yang, T.; Wang, J.; Dai, Q.; Zhang, F.; Xi, R.; Yu, Q.; Li, N. The transcriptional regulatory network of hormones and genes under salt stress in tomato plants (Solanum lycopersicum L.). Front. Plant Sci. 2023, 14. [Google Scholar] [CrossRef]
- Azaizeh, H.; Steudle, E. Effects of salinity on water transport of excised maize (Zea mays L.) roots. Plant Physiol. 1991, 97, 1136–1145. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Martínez-Ballesta, M.C.; Martínez, V.; Carvajal, M. Aquaporin functionality in relation to H+-ATPase activity in root cells of Capsicum annuum grown under salinity. Physiol. Plant. 2003, 117, 413–420. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.K.; Deshmukh, R.; Muthamilarasan, M.; Rani, R.; Prasad, M. Versatile roles of aquaporin in physiological processes and stress tolerance in plants. Plant Physiol. Biochem. 2020, 149, 178–189. [Google Scholar] [CrossRef] [PubMed]
- Marulanda, A.; Azcón, R.; Chaumont, F.; Ruiz-Lozano, J.M.; Aroca, R. Regulation of plasma membrane aquaporins by inoculation with a Bacillus megaterium strain in maize (Zea mays L.) plants under unstressed and salt-stressed conditions. Planta 2010, 232, 533–543. [Google Scholar] [CrossRef]
- Chaumont, F.; Moshelion, M.; Daniels, M.J. Regulation of plant aquaporin activity. Biol. Cell 2005, 97, 749–764. [Google Scholar] [CrossRef]
- Li, G.; Chen, T.; Zhang, Z.; Li, B.; Tian, S. Roles of aquaporins in plant-pathogen interaction. Plants 2020, 9, 1134. [Google Scholar] [CrossRef]
- Vandeleur, R.K.; Mayo, G.; Shelden, M.C.; Gilliham, M.; Kaiser, B.N.; Tyerman, S.D. The role of plasma membrane intrinsic protein aquaporins in water transport through roots: Diurnal and drought stress responses reveal different strategies between isohydric and anisohydric cultivars of grapevine. Plant Physiol. 2009, 149, 445–460. [Google Scholar] [CrossRef]
- Wang, Y.; Zhao, Z.; Liu, F.; Sun, L.; Hao, F. Versatile roles of aquaporins in plant growth and development. Int. J. Mol. Sci. 2020, 21, 9485. [Google Scholar] [CrossRef]
- Ruf, M.; Brunner, I. Vitality of tree fine roots: Reevaluation of the tetrazolium test. Tree Physiol. 2003, 23, 257–263. [Google Scholar] [CrossRef]
- Shu-ying, Z.; Gui-xin, C.H.U.; Yong-chao, L. Effects of enhancing ammonium nutrition on the nitrogenous metabolisms of cotton seedlings grown hydroponically under low-temperature stress. J. Plant Nutr. Fertil. 2017, 23, 983–990. [Google Scholar] [CrossRef]
- Yu, X.-Z.; Zhang, F.-Z.J. Activities of nitrate reductase and glutamine synthetase in rice seedlings during cyanide metabolism. Hazard. Mater. 2012, 225–226, 190–194. [Google Scholar] [CrossRef] [PubMed]
- Liang, C.-g.; Chen, L.-p.; Wang, Y.; Liu, J.; Xu, G.-l.; Li, T. High Temperature at Grain-filling Stage Affects Nitrogen Metabolism Enzyme Activities in Grains and Grain Nutritional Quality in Rice. Rice Sci. 2011, 18, 210–216. [Google Scholar] [CrossRef]
- Singh, R.P.; Srivastava, H. Regulation of glutamate dehydrogenase activity by amino acids in maize seedlings. Physiol. Plant. 1983, 57, 549–554. [Google Scholar] [CrossRef]
- Zhao, S.; Li, D. Experiment Guide of Modern Plant Physiology; Science Press: Beijing, China, 1999. [Google Scholar]
- Balandrán-Valladares, M.I.; Cruz-Alvarez, O.; Jacobo-Cuellar, J.L.; Hernández-Rodríguez, O.A.; Flores-Córdova, M.A.; Parra-Quezada, R.Á.; Ojeda-Barrios, D.L. Changes in nutrient concentration and oxidative metabolism in pecan leaflets at different doses of zinc. Plant Soil Environ. 2021, 67, 33–39. [Google Scholar] [CrossRef]
- Wang, D.; Shi, Q.; Wang, X.; Wei, M.; Hu, J.; Liu, J.; Yang, F. Influence of cow manure vermicompost on the growth, metabolite contents, and antioxidant activities of Chinese cabbage (Brassica campestris ssp. chinensis). Biol. Fertil. Soils 2010, 46, 689–696. [Google Scholar] [CrossRef]
- Wang, B. Comparison of extractive methods of Na+, K+ in wheat leaves. Plant Physiol. Commun. 1995, 31, 50–52. [Google Scholar] [CrossRef]
- Wang, Y.; Sze, H. Similarities and differences between the tonoplast-type and the mitochondrial H+-ATPases of oat roots. J. Biol. Chem. 1985, 260, 10434–10443. Available online: https://www.jbc.org/article/S0021-9258(19)85101-3/fulltext (accessed on 25 September 2024). [CrossRef]
Gene Name | Primer Sequences |
---|---|
Actin | F:CCCCGATGGGCAGGTAATA |
R:AAGAGCAGGACGAACAGCAGA | |
SOS1 | F: ATCCAACGGAGTGGTAAA |
R: AACAACGGAATCTGTAATC | |
NHX | F: AGGGTGTAGTGAATGACG |
R: GAGAATGCCACTCAAATC | |
PIP1:2 | F: CATTATTTACAACCACGACGAAGCA |
R: GGATTGAAGAAGCATCATGGATTTAGA | |
PIP2:4 | F: GCTGCTCTGCTCTCATCTTGCC |
R: GAAAAATACATGAATAACAGGAGCCCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nie, W.; Gong, B.; Wen, D.; Qiao, P.; Guo, H.; Shi, Q. Brassinosteroid Enhances Cucumber Stress Tolerance to NaHCO3 by Modulating Nitrogen Metabolism, Ionic Balance and Phytohormonal Response. Plants 2025, 14, 80. https://doi.org/10.3390/plants14010080
Nie W, Gong B, Wen D, Qiao P, Guo H, Shi Q. Brassinosteroid Enhances Cucumber Stress Tolerance to NaHCO3 by Modulating Nitrogen Metabolism, Ionic Balance and Phytohormonal Response. Plants. 2025; 14(1):80. https://doi.org/10.3390/plants14010080
Chicago/Turabian StyleNie, Wenjing, Biao Gong, Dan Wen, Peng Qiao, Hongen Guo, and Qinghua Shi. 2025. "Brassinosteroid Enhances Cucumber Stress Tolerance to NaHCO3 by Modulating Nitrogen Metabolism, Ionic Balance and Phytohormonal Response" Plants 14, no. 1: 80. https://doi.org/10.3390/plants14010080
APA StyleNie, W., Gong, B., Wen, D., Qiao, P., Guo, H., & Shi, Q. (2025). Brassinosteroid Enhances Cucumber Stress Tolerance to NaHCO3 by Modulating Nitrogen Metabolism, Ionic Balance and Phytohormonal Response. Plants, 14(1), 80. https://doi.org/10.3390/plants14010080