Cytoplasm of the Wild Species Aegilops mutica Reduces VRN1 Gene Expression in Early Growth of Cultivated Wheat: Prospects for Using Alloplasmic Lines to Breed Varieties Adapted to Global Warming
Abstract
1. Introduction
2. Results
2.1. The Plastochron (Leaf Formation Speed) in Alloplasmic Lines Is Significantly Slower than in Euplasmic Lines
2.2. VRN1 Expression Levels in Alloplasmic Lines Are Significantly Lower than in Euplasmic Lines
2.3. Ae. mutica Cytoplasm Prevents Tiller Number (Ear Number) Reduction During a Warm Winter
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Growth Chamber Experiments
4.3. Gene Expression Analysis
4.4. Field Experiments
5. Conclusions
6. Patents
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kihara, H. Substitution of nucleus and the effects on genome maintenance. Cytologia 1951, 16, 177–193. [Google Scholar] [CrossRef]
- Tsunewaki, K.; Wang, G.-Z.; Matsuoka, Y. Plasmon analysis of Triticum (wheat) and Aegilops. 1. Production of alloplasmic common wheats and their fertilities. Genes Genet. Syst. 1996, 71, 293–311. [Google Scholar] [CrossRef] [PubMed]
- Tsunewaki, K.; Wang, G.-Z.; Matsuoka, Y. Plasmon analysis of Triticum (wheat) and Aegilops. 2. Characterization and classification of 47 plasmons based on their effects on common wheat phenotype. Genes Genet. Syst. 2002, 77, 409–427. [Google Scholar] [CrossRef] [PubMed]
- Whitford, R.; Fleury, D.; Reif, J.C.; Garcia, M.; Okada, T.; Korzun, V.; Langridge, P. Hybrid breeding in wheat: Technologies to improve hybrid wheat seed production. J. Exp. Bot. 2013, 18, 5411–5428. [Google Scholar] [CrossRef]
- Soltani, A.; Kumar, A.; Mergoum, M.; Pirseyedi, S.M.; Hegstad, J.B.; Mazaheri, M.; Kianian, S.F. Novel nuclear-cytoplasmic interaction in wheat (Triticum aestivum) induces vigorous plants. Funct. Integr. Genom. 2016, 16, 171–182. [Google Scholar] [CrossRef]
- Crosatti, C.; Quansah, L.; Maré, C.; Giusti, L.; Roncaglia, E.; Atienza, S.G.; Cattivelli, L.; Fait, A. Cytoplasmic genome substitution in wheat affects the nuclear-cytoplasmic cross-talk leading to transcript and metabolite alterations. BMC Genom. 2013, 14, 868. [Google Scholar] [CrossRef]
- Tsunewaki, K. Genome-plasmon interactions in wheat. Jpn. J. Genet. 1993, 68, 1–34. [Google Scholar] [CrossRef]
- Matsumura, M.; Murai, K. Effects of cytoplasm from the related wild species Aegilops mutica on agronomic characters in Japanese bread wheat cultivars. Cytologia 2023, 88, 203–208. [Google Scholar] [CrossRef]
- Yan, L.; Loukoianov, A.; Tranquilli, G.; Helguera, M.; Fahima, T.; Dubcovsky, J. Positional cloning of the wheat vernalization gene VRN1. Proc. Natl. Acad. Sci. USA 2003, 100, 6263–6268. [Google Scholar] [CrossRef]
- Danyluk, J.; Kane, N.A.; Breton, G.; Limin, A.E.; Fowler, D.B.; Sarhan, F. TaVRT-1, a putative transcription factor associated with vegetative to reproductive transition in cereals. Plant Physiol. 2003, 132, 1849–1860. [Google Scholar] [CrossRef]
- Murai, K.; Miyamae, M.; Kato, H.; Takumi, S.; Ogihara, Y. WAP1, a wheat APETALA1 homolog, plays a central role in the phase transition from vegetative to reproductive growth. Plant Cell Physiol. 2003, 44, 1255–1265. [Google Scholar] [CrossRef] [PubMed]
- Trevaskis, B.; Bagnall, D.J.; Ellis, M.H.; Peacock, W.J.; Dennis, E.S. MADS box genes control vernalization-induced flowering in cereals. Proc. Natl. Acad. Sci. USA 2003, 100, 13099–13104. [Google Scholar] [CrossRef] [PubMed]
- Nishiura, A.; Kazama, Y.; Abe, T.; Mizuno, N.; Nasuda, S.; Murai, K. Level of VERNALIZATION 1 expression is correlated with earliness in extra early-flowering mutant wheat lines. Breeding Sci. 2014, 64, 213–221. [Google Scholar] [CrossRef] [PubMed]
- Shimada, S.; Ogawa, T.; Kitagawa, S.; Suzuki, T.; Ikari, C.; Shitsukawa, N.; Abe, T.; Kawahigashi, H.; Kikuchi, R.; Handa, H.; et al. A genetic network of flowering-time genes in wheat leaves, in which an APETALA1/FRUITFULL-like gene, VRN1, is upstream of FLOWERING LOCUS T. Plant J. 2009, 58, 668–681. [Google Scholar] [CrossRef]
- Tanaka, C.; Itoh, T.; Iwasaki, Y.; Mizuno, N.; Nasuda, S.; Murai, K. Direct interaction between VRN1 protein and the promoter region of the wheat FT gene. Genes Genet. Syst. 2018, 93, 25–29. [Google Scholar] [CrossRef]
- Yan, L.; Fu, D.; Li, C.; Blechl, A.; Tranquilli, G.; Bonafede, M.; Sanchez, A.; Valarik, M.; Yasuda, S.; Dubcovsky, J. The wheat and barley vernalization gene VRN3 is an orthologue of FT. Proc. Natl. Acad. Sci. USA 2006, 103, 19581–19586. [Google Scholar] [CrossRef]
- Smith, D.R.; Keeling, P.J. Mitochondrial and plastid genome architecture: Re-occurring themes, but significant differences at the extremes. Proc. Natl. Acad. Sci. USA 2015, 112, 2014–2049. [Google Scholar] [CrossRef]
- Fujii, S.; Toriyama, K. Genome barriers between nuclei and mitochondria exemplified by cytoplasmic male sterility. Plant Cell Physiol. 2008, 49, 1484–1494. [Google Scholar] [CrossRef]
- Oliver, S.N.; Finnegan, E.J.; Dennis, E.S.; Peacock, W.J.; Trevaskis, B. Vernalization-induced flowering in cereals is associated with changes in histone methylation at the VERNALIZATION 1 gene. Proc. Natl. Acad. Sci. USA 2009, 106, 8386–8391. [Google Scholar] [CrossRef]
- Oliver, S.N.; Deng, W.; Casao, M.C.; Trevaskis, B. Low temperatures induce rapid changes in chromatin state and transcript levels of the cereal VERNALIZATION 1 gene. J. Exp. Bot. 2013, 64, 2413–2422. [Google Scholar] [CrossRef]
- Li, Y.; Jin, L.; Liu, X.; He, C.; Bi, S.; Saeed, S.; Yan, W. Epigenetic control on transcription of vernalization genes and whole-genome gene expression profile induced by vernalization in common wheat. Plant Divers. 2024, in press. [Google Scholar] [CrossRef] [PubMed]
- Tanio, M.; Kato, K.; Ishikawa, N.; Tamura, Y.; Sato, M.; Takagi, H.; Matsuoka, M. Genetic analysis of photoperiod response in wheat and its relation with the earliness of heading in the Southwestern part of Japan. Breed Sci. 2005, 55, 327–334. [Google Scholar] [CrossRef][Green Version]
- Paolacci, A.R.; Tanzarella, O.A.; Porceddu, E.; Ciaffi, M. Identification and validation of reference genes for quantitative RT-PCR normalization in wheat. BMC Mol. Biol. 2009, 10, 11. [Google Scholar] [CrossRef] [PubMed]
Line | Leaf Stage | Plastochron (Days: Mean ± SE) | Days to Flag-Leaf Unfolding 2 (Days: Mean ± SE) | |
---|---|---|---|---|
End of Vernalization | Heading | |||
Chikugoizumi | 4.0 | 8.0 | 2.25 ± 0.08 | 65.0 ± 0.3 |
Fukusayaka | 3.8 | 8.8 | 3.36 ± 0.33 | 72.4 ± 0.6 |
Kinuhime | 3.8 | 9.6 | 4.13 ± 0.31 | 77.8 ± 1.0 |
Haruibuki | 3.0 | 10.0 | 4.35 ± 0.19 | 86.2 ± 0.4 |
(mut)-Chiku. | 1.3 | 7.0 | 4.38 ± 0.22 ** | 81.0 ± 0.4 ** |
(mut)-Fuku. | 2.0 | 7.6 | 5.48 ± 0.11 ** | 86.6 ± 0.9 ** |
(mut)-Kinu. | 1.7 | 8.0 | 5.02 ± 0.15 * | 87.3 ± 0.3 ** |
(mut)-Haru. | 1.2 | 8.0 | 5.76 ± 0.15 ** | 95.2 ± 1.8 ** |
ANOVA 1 | - | - | p = 0.000 ** | p = 0.000 ** |
Gene | Primer Name | Sequence (5′ to 3′) | Product Size (bp) | Annealing Temperature (°C) |
---|---|---|---|---|
CDCP | CDCP-L | CAAATACGCCATCAGGGAGAACATC | 227 | 62 |
CDCP-R | CGCTGCCGAAACCACGAGAC | |||
VRN-A1 | Real-VRN-A1L | CAGCCTCAAACCAGCTCTTCA | 102 | 65 |
Real-VRN-A1R | CTCTGCCCTCTCGCCTGT | |||
VRN-B1 | Real-VRN-B1L4 | TCGAGAAGCAGAAGGCCCAG | 143 | 65 |
Real-VRN-B1R4 | CTCTGCCCTCTCTCCTGAT | |||
VRN-D1 | Real-VRN-D1L7 | ATTCATCCAGCGGCGG | 107 | 65 |
Real-VRN-D1R7 | CAGCCGTTGATGTGGCTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Matsumura, M.; Watanabe, Y.; Tada, H.; Murai, K. Cytoplasm of the Wild Species Aegilops mutica Reduces VRN1 Gene Expression in Early Growth of Cultivated Wheat: Prospects for Using Alloplasmic Lines to Breed Varieties Adapted to Global Warming. Plants 2024, 13, 3346. https://doi.org/10.3390/plants13233346
Matsumura M, Watanabe Y, Tada H, Murai K. Cytoplasm of the Wild Species Aegilops mutica Reduces VRN1 Gene Expression in Early Growth of Cultivated Wheat: Prospects for Using Alloplasmic Lines to Breed Varieties Adapted to Global Warming. Plants. 2024; 13(23):3346. https://doi.org/10.3390/plants13233346
Chicago/Turabian StyleMatsumura, Mina, Yuko Watanabe, Hiroko Tada, and Koji Murai. 2024. "Cytoplasm of the Wild Species Aegilops mutica Reduces VRN1 Gene Expression in Early Growth of Cultivated Wheat: Prospects for Using Alloplasmic Lines to Breed Varieties Adapted to Global Warming" Plants 13, no. 23: 3346. https://doi.org/10.3390/plants13233346
APA StyleMatsumura, M., Watanabe, Y., Tada, H., & Murai, K. (2024). Cytoplasm of the Wild Species Aegilops mutica Reduces VRN1 Gene Expression in Early Growth of Cultivated Wheat: Prospects for Using Alloplasmic Lines to Breed Varieties Adapted to Global Warming. Plants, 13(23), 3346. https://doi.org/10.3390/plants13233346