Taxonomic, Physiological, and Biochemical Characterization of Asterarcys quadricellularis AQYS21 as a Promising Sustainable Feedstock for Biofuels and ω-3 Fatty Acids
Abstract
1. Introduction
2. Results
2.1. Morphological Characteristics
2.2. Molecular Identification and Sequence Analysis
2.3. Verification of the Optimal Cultivation Conditions for the Isolated Strain
2.4. Proximate Composition and Fatty Acid Methyl Ester (FAME) Analysis, Along with the Evaluation of Biodiesel Properties
3. Discussion
3.1. Morphological and Ultrastructural Characterization
3.2. Molecular-Phylogenetic Characterization
3.3. Ecological and Growth Characteristics, Including Adaptability
3.4. Carbohydrate and Lipid Contents
3.5. Fatty Acid Composition and Biodiesel Properties
4. Materials and Methods
4.1. Sample Collection and Isolation
4.2. Morphological Identification
4.3. Molecular Identification
4.4. Determination of Optimal Culture Conditions
4.5. Determination of Total Lipid, Carbohydrate, and Protein Contents
4.6. Analyses for Fatty Acid Composition of Lipids and Their Biodiesel Properties
4.7. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Khan, M.I.; Shin, J.H.; Kim, J.D. The promising future of microalgae: Current status, challenges, and optimization of a sustainable and renewable industry for biosfuels, feed, and other products. Microb. Cell Fact. 2018, 17, 36. [Google Scholar] [CrossRef] [PubMed]
- Little, S.M.; Senhorinho, G.N.A.; Saleh, M.; Basiliko, N.; Scott, J.A. Antibacterial compounds in green microalgae from extreme environments: A review. Algae 2021, 36, 61–72. [Google Scholar] [CrossRef]
- Arrigo, K.R. Marine microorganisms and global nutrient cycles. Nature 2005, 437, 349–355. [Google Scholar] [CrossRef] [PubMed]
- Chisti, Y. Biodiesel from microalgae. Biotechnol. Adv. 2007, 25, 294–306. [Google Scholar] [CrossRef] [PubMed]
- Cuellar-Bermudez, S.P.; Garcia-Perez, J.S.; Rittmann, B.E.; Parra-Saldivar, R. Photosynthetic bioenergy utilizing CO2: An approach on flue gases utilization for third generation biofuels. J. Clean. Prod. 2015, 98, 53–65. [Google Scholar] [CrossRef]
- Cheah, W.Y.; Show, P.L.; Chang, J.-S.; Ling, T.C.; Juan, J.C. Biosequestration of atmospheric CO2 and flue gas-containing CO2 by microalgae. Bioresour. Technol. 2015, 184, 190–201. [Google Scholar] [CrossRef]
- Pulz, O.; Gross, W. Valuable products from biotechnology of microalgae. Appl. Microb. Biotechnol. 2004, 65, 635–648. [Google Scholar] [CrossRef]
- Borowitzka, M.A. High-value products from microalgae-Their development and commercialisation. J. Appl. Phycol. 2013, 25, 743–756. [Google Scholar] [CrossRef]
- Hong, J.W.; Kang, N.S.; Jang, H.S.; Kim, H.J.; An, Y.R.; Yoon, M.; Kim, H.S. Biotechnological potential of Korean marine microalgal strains and its future prospectives. Ocean Polar Res. 2019, 41, 289–309. [Google Scholar] [CrossRef]
- Mendes, M.C.; Navalho, S.; Ferreira, A.; Paulino, C.; Figueiredo, D.; Silva, D.; Gao, F.; Gama, F.; Bombo, G.; Jacinto, R.; et al. Algae as food in Europe: An overview of species diversity and their application. Foods 2022, 11, 1871. [Google Scholar] [CrossRef]
- Su, M.; Bastiaens, L.; Verspreet, J.; Hayes, M. Applications of microalgae in foods, pharma and feeds and their use as fertilizers and biostimulants: Legislation and regulatory aspects for consideration. Foods 2023, 12, 3878. [Google Scholar] [CrossRef] [PubMed]
- Abdelfattah, A.; Ali, S.S.; Ramadan, H.; El-Aswar, E.I.; Eltawab, R.; Ho, S.-H.; Elsamahy, T.; Li, S.; El-Sheekh, M.M.; Schagerl, M.; et al. Microalgae-based wastewater treatment: Mechanisms, challenges, recent advances, and future prospects. Environ. Sci. Ecotechnol. 2023, 13, 100205. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Horsman, M.; Wu, N.; Lan, C.Q.; Dubois-Calero, N. Biofuels from microalgae. Biotechnol. Prog. 2008, 24, 815–820. [Google Scholar] [CrossRef] [PubMed]
- Singh, J.; Gu, S. Commercialization potential of microalgae for biofuels production. Renew. Sustain. Energy Rev. 2010, 14, 2586–2610. [Google Scholar] [CrossRef]
- Wijffels, R.H.; Barbosa, M.J. An outlook on microalgal biofuels. Science 2010, 329, 796–799. [Google Scholar] [CrossRef]
- Avilés-Polanco, G.; Jefferson, D.J.; Almendarez-Hernández, M.A.; Beltrán-Morales, L.F. Factors that explain the utilization of the Nagoya protocol framework for access and benefit sharing. Sustainability 2019, 11, 5550. [Google Scholar] [CrossRef]
- Heinrich, M.; Scotti, F.; Andrade-Cetto, A.; Berger-Gonzalez, M.; Echeverria, J.; Friso, F.; Garcia-Cardona, F.; Hesketh, A.; Hitziger, M.; Maake, C.; et al. Access and Benefit Sharing under the Nagoya Protocol—Quo Vadis? Six Latin American case studies assessing opportunities and risk. Front. Pharmacol. 2020, 11, 765. [Google Scholar] [CrossRef]
- Leliaert, F.; Smith, D.R.; Moreau, H.; Herron, M.D.; Verbruggen, H.; Delwiche, C.F.; De Clerck, O. Phylogeny and molecular evolution of the green algae. CRC Crit. Rev. Plant Sci. 2012, 31, 1–46. [Google Scholar] [CrossRef]
- Tragin, M.; Lopes dos Santos, A.; Christen, R.; Vaulot, D. Diversity and ecology of green microalgae in marine systems: An overview based on 18S rRNA gene sequences. Perspect. Phycol. 2016, 3, 141–154. [Google Scholar] [CrossRef]
- Tragin, M.; Vaulot, D. Green microalgae in marine coastal waters: The Ocean Sampling Day (OSD) dataset. Sci. Rep. 2018, 8, 14020. [Google Scholar] [CrossRef]
- Zou, S.; Fei, C.; Wang, C.; Gao, Z.; Bao, Y.; He, M.; Wang, C. How DNA barcoding can be more effective in microalgae identification: A case of cryptic diversity revelation in Scenedesmus (Chlorophyceae). Sci. Rep. 2016, 6, 38824. [Google Scholar] [CrossRef] [PubMed]
- Falkowski, P.G.; Raven, J.A. Aquatic Photosynthesis; Princeton University Press: Princeton, NJ, USA, 2007. [Google Scholar]
- Lewis, L.A.; McCourt, R.M. Green algae and the origin of land plants. Am. J. Bot. 2004, 91, 1535–1556. [Google Scholar] [CrossRef] [PubMed]
- Raja, R.; Hemaiswarya, S.; Kumar, N.A.; Sridhar, S.; Rengasamy, R. A perspective on the biotechnological potential of microalgae. Crit. Rev. Microbiol. 2008, 34, 77–88. [Google Scholar] [CrossRef] [PubMed]
- Wilson, G.M., Jr.; Gorgich, M.; Corrêa, P.S.; Martins, A.A.; Mata, T.M.; Caetano, N.S. Microalgae for biotechnological applications. Cultivation, harvesting and biomass processing. Aquaculture 2020, 528, 735562. [Google Scholar] [CrossRef]
- Champenois, J.; Marfaing, H.; Pierre, R. Review of the taxonomic revision of Chlorella and consequences for its food uses in Europe. J. Appl. Phycol. 2015, 27, 1845–1851. [Google Scholar] [CrossRef]
- Higgins, B.; Nobles, D.; Ma, Y.; Wikoff, W.; Kind, T.; Fiehn, O.; Brand, J.; VanderGheynst, J.S. Informatics for improved algal taxonomic classification and research: A case study of UTEX 2341. Algal Res. 2015, 12, 545–549. [Google Scholar] [CrossRef]
- Borowitzka, M. Systematics, taxonomy and species names: Do they matter? In The Physiology of Microalgae; Developments in Applied Phycology; Borowitzka, M.A., Beardall, J., Raven, J.A., Eds.; Springer International Publishing: Dordrecht, The Netherlands, 2016; pp. 655–681. [Google Scholar] [CrossRef]
- Gantar, M.; Svircev, Z. Microalgae and cyanobacteria: Food for thought. J. Phycol. 2008, 44, 260–268. [Google Scholar] [CrossRef]
- Hyung, J.H.; Kim, E.J.; Moon, S.J.; Kang, N.S.; Park, J. Tetraselmis jejuensis sp. nov. (Chlorodendrophyceae), a euryhaline microalga found in supralittoral tide pools at Jeju Island, Korea. Plants 2021, 10, 1289. [Google Scholar] [CrossRef]
- Comas Gonzalez, A. New coenobial Chlorococcales (Chlorophyceae) from Cuba. Arch. Hydrobiol. Algol. Stud. 1981, 28, 213–219. [Google Scholar]
- Guiry, M.D.; Guiry, G.M. AlgaeBase. World-Wide Electronic Publication; National University of Ireland Galway. Available online: http://www.algaebase.org (accessed on 19 September 2024).
- Ren, H.Y.; Song, X.; Kong, F.; Song, Q.; Ren, N.Q.; Liu, B.F. Lipid production characteristics of a newly isolated microalga Asterarcys quadricellulare R-56 as biodiesel feedstock. Environ. Sci. Pollut. Res. Int. 2023, 30, 48339–48350. [Google Scholar] [CrossRef]
- Hong, J.W.; Kim, S.A.; Chang, J.; Yi, J.; Jeong, J.; Kim, S.; Kim, S.H.; Yoon, S.H. Isolation and description of a Korean microalga, Asterarcys quadricellulare KNUA020, and analysis of its biotechnological potential. Algae 2012, 27, 197–203. [Google Scholar] [CrossRef]
- Singh, D.P.; Khattar, J.S.; Rajput, A.; Chaudhary, R.; Singh, R. High production of carotenoids by the green microalga Asterarcys quadricellulare PUMCC 5.1. 1 under optimized culture conditions. PLoS ONE 2019, 14, e0221930. [Google Scholar] [CrossRef] [PubMed]
- Morsi, H.; Eladel, H.; Maher, A. Coupling nutrient removal and biodiesel production by Asterarcys quadricellulare microalga grown in municipal wastewater. BioEnergy Res. 2021, 15, 193–201. [Google Scholar] [CrossRef]
- Cordeiro, E.C.N.; Mógor, Á.F.; de Oliveira Amatussi, J.; Mógor, G.; de Lara, G.B.; Marques, H.M.C. Microalga biofertilizer triggers metabolic changes improving onion growth and yield. Horticult 2022, 8, 223. [Google Scholar] [CrossRef]
- Ghosh, A.; Khanra, S.; Mondal, M.; Halder, G.; Tiwari, O.N.; Bhowmick, T.K.; Gayen, K. Effect of macronutrient supplements on growth and biochemical compositions in photoautotrophic cultivation of isolated Asterarcys sp. (BTA9034). Energy Convers. Manag. 2017, 149, 39–51. [Google Scholar] [CrossRef]
- Lara, G.B.D.; Mógor, Á.; Amatussi, J.D.O.; Cordeiro, E.C.N.; Marques, H.M.C.; Mógor, G. Microalga improve the growth, yield, and contents of sugar, amino acid, and protein of tomato. Ciênc. Agrotecnol. 2022, 46, e023821. [Google Scholar] [CrossRef]
- Lortou, U.; Panteris, E.; Gkelis, S. Uncovering new diversity of photosynthetic microorganisms from the Mediterranean region. Microorganisms 2022, 10, 1571. [Google Scholar] [CrossRef]
- Grama, B.S.; Chader, S.; Khelifi, D.; Stenuit, B.; Jeffryes, C.; Agathos, S.N. Characterization of fatty acid and carotenoid production in an Acutoclesmus microalga isolated from the Algerian Sahara. Biomass Bioenergy 2014, 69, 265–275. [Google Scholar] [CrossRef]
- Granéli, E.; Flynn, K. Chemical and Physical Factors Influencing Toxin Content. In Ecology of Harmful Algae; Granéli, E., Turner, J.T., Eds.; Springer: New York, NY, USA, 2006; Volume 189, pp. 229–241. [Google Scholar]
- Hegewald, E.; Schmidt, A. Asterarcys Comas, eine weit verbreitete tropische Grunalgengattung. Algol. Stud./Arch. Hydrobiol. 1992, 66, 25–30. [Google Scholar]
- EN 14214; Automotive Fuels-Fatty Acid Methyl Esters (FAME) for Diesel Engines-Requirements and Test Methods. European Committee for Standardization: Brussels, Belgium, 2008.
- ASTM D6751-02; Standard Specification for Biodiesel Fuel (B100) Blend Stock for Distillate Fuels. American Society for Testing and Materials: West Conshohocken, PA, USA, 2002.
- Ancona-Canché, K.; López-Adrián, S.; Espinosa-Aguilar, M.; Garduño-Solórzano, G.; Toledano-Thompson, T.; Narváez-Zapata, J.; Valdez-Ojeda, R. Molecular phylogeny and morphologic data of strains of the genus Coelastrella (Chlorophyta, Scenedesmaceae) from a tropical region in North America (Yucatán Peninsula). Bot. Sci. 2017, 95, 527–537. [Google Scholar] [CrossRef]
- Hegewald, E.; Wolf, M.; Keller, A.; Friedl, T.; Krienitz, L. ITS2 sequence-structure phylogeny in the Scenedesmaceae with special reference to Coelastrum (Chlorophyta, Chlorophyceae), including the new genera Comasiella and Pectinodesmus. Phycologia 2010, 49, 325–335. [Google Scholar] [CrossRef]
- Kalina, T.; Puncochárová, M. Taxonomy of the subfamily Scotiellocystoideae Fott 1976 (Chlorellaceae, Chlorophyceae). Arch. Hydrobiol. Suppl. Algol. Stud. 1987, 45, 473–521. [Google Scholar]
- Kang, N.S.; Cho, K.; An, S.M.; Kim, E.S.; Ki, H.; Lee, C.H.; Choi, G.; Hong, J.W. Taxonomic and biochemical characterization of microalga Graesiella emersonii GEGS21 for its potential to become feedstock for biofuels and bioproducts. Energies 2022, 15, 8725. [Google Scholar] [CrossRef]
- Kaufnerová, V.; Eliáš, M. The demise of the genus Scotiellopsis Vinatzer (Chlorophyta). Nova Hedwig. 2013, 97, 415–428. [Google Scholar] [CrossRef]
- Goecke, F.; Noda, J.; Paliocha, M.; Gislerød, H.R. Revision of Coelastrella (Scenedesmaceae, Chlorophyta) and first register of this green coccoid microalga for continental Norway. World J. Microbiol. Biotechnol. 2020, 36, 149. [Google Scholar] [CrossRef]
- Wang, Q.; Song, H.; Liu, X.; Liu, B.; Hu, Z.; Liu, G. Morphology and molecular phylogeny of coccoid green algae Coelastrella sensu lato (Scenedesmaceae, Sphaeropeales), including the description of three new species and two new varieties. J. Phycol. 2019, 55, 1290–1305. [Google Scholar] [CrossRef]
- Stoyneva, M.P.; Ingolic, E.; Gärtner, G.; Vyverman, W. The pyrenoid ultrastructure in Oocystis lacustris CHODAT (Chlorophyta, Trebouxiophyceae). Fottea 2009, 9, 149–154. [Google Scholar] [CrossRef]
- Brown, R.M.; Bold, H.C. Phycological Studies 5. In Comparative studies of the Algal Genera Tetracystis and Chlorococcum; The University of Texas Publication: Austin, TX, USA, 1964; Volume 6417, pp. 1–213. [Google Scholar]
- Brown, R.M., Jr.; McLean, R.J. New taxonomic criteria in classifications of Chlorococcum species. II. Pyrenoid fine structure. J. Phycol. 1969, 4, 114–118. [Google Scholar] [CrossRef]
- Friedl, T. Comparative ultrastructure of pyrenoids in Trebouxia (Microthamniales, Chlorophyta). Plant Systemat. Evol. 1989, 164, 145–159. [Google Scholar] [CrossRef]
- Ingolić, E.; Gärtner, G. Ultrastructure of pyrenoids in green algal taxonomy. In Performance Report 2001/2002; Forschungsinstitut für Elektronenmikroskopie, Technische Universität Graz: Graz, Austria, 2003; pp. 90–91. [Google Scholar]
- Chekanov, K. Diversity and distribution of carotenogenic algae in Europe: A review. Mar. Drugs 2023, 21, 108. [Google Scholar] [CrossRef]
- Odjadjare, E.C.; Mutanda, T.; Chen, Y.-F.; Olaniran, A.O. Evaluation of pre-chlorinated wastewater effluent for microalgal cultivation and biodiesel production. Water 2018, 10, 977. [Google Scholar] [CrossRef]
- Oliveira, O.; Gianesella, S.; Silva, V.; Mata, T.; Caetano, N. Lipid and carbohydrate profile of a microalga isolated from wastewater. Energy Procedia 2017, 136, 468–473. [Google Scholar] [CrossRef]
- Saadaoui, I.; Bounnit, T.; Mraiche, F.; Joseph, J.M.; Cherif, M.; Al-Jabri, H. Asterarcys quadricellulare (Chlorophyceae) protects H9c2 cardiomyoblasts from H2O2-induced oxidative stress. Mol. Cell. Biochem. 2023, 478, 1915–1925. [Google Scholar] [CrossRef] [PubMed]
- Sangapillai, K.; Marimuthu, T. Isolation and selection of growth medium for freshwater microalgae Asterarcys quadricellulare for maximum biomass production. Water Sci. Technol. 2019, 80, 2027–2036. [Google Scholar] [CrossRef] [PubMed]
- Dar, R.A.; Gupta, R.K.; Phutela, U.G. Enhancement of euryhaline Asterarcys quadricellulare biomass production for improving biogas generation through anaerobic co-digestion with carbon rich substrate. 3 Biotech. 2021, 11, 251. [Google Scholar] [CrossRef]
- An, S.M.; Cho, K.; Kim, E.S.; Ki, H.; Choi, G.; Kang, N.S. Description and characterization of the Odontella aurita OAOSH22, a marine diatom rich in eicosapentaenoic acid and fucoxanthin, isolated from Osan Harbor, Korea. Mar. Drugs 2023, 21, 563. [Google Scholar] [CrossRef]
- Maltsev, Y.; Maltseva, K.; Kulikovskiy, M.; Maltseva, S. Influence of light conditions on microalgae growth and content of lipids, carotenoids, and fatty acid composition. Biology 2021, 10, 1060. [Google Scholar] [CrossRef]
- Ras, M.; Steyer, J.-P.; Bernard, O. Temperature effect on microalgae: A crucial factor for outdoor production. Rev. Environ. Sci. Bio/Technol. 2013, 12, 153–164. [Google Scholar] [CrossRef]
- Zhang, Y.; Li, Y.; Zhang, X.; Tan, T. Biodiesel production by direct transesterification of microalgal biomass with co-solvent. Bioresour. Technol. 2015, 196, 712–715. [Google Scholar] [CrossRef]
- Mallick, N.; Mandal, S.; Singh, A.K.; Bishai, M.; Dash, A. Green microalga Chlorella vulgaris as a potential feedstock for biodiesel. J. Chem. Technol. Biotechnol. 2012, 87, 137–145. [Google Scholar] [CrossRef]
- Devappa, R.K.; Rakshit, S.K.; Dekker, R.F. Forest biorefinery: Potential of poplar phytochemicals as value-added co-products. Biotechnol. Adv. 2015, 33, 681–716. [Google Scholar] [CrossRef] [PubMed]
- IMARC Group. Global Palmitic Acid Market: Industry Trends, Share, Size, Growth, Opportunity and Forecast 2023–2032. Available online: https://www.imarcgroup.com/palmitic-acid-market (accessed on 4 July 2024).
- Bamgboye, A.I.; Hansen, A.C. Prediction of cetane number of biodiesel fuel from the fatty acid methyl ester (FAME) composition. Int. Agrophys. 2008, 22, 21–22. [Google Scholar]
- Díaz, G.C.; Cruz, Y.R.; Fortes, M.M.; Viegas, C.V.; Carliz, R.G.; Furtado, N.C.; Aranda, D.A.G. Primary separation of antioxidants (unsaponifiables) from the wet biomass of microalgae Chlamydomonas sp. and production of biodiesel. Nat. Sci. 2014, 6, 1210. [Google Scholar] [CrossRef]
- Talebi, A.F.; Mohtashami, S.K.; Tabatabaei, M.; Tohidfar, M.; Bagheri, A.; Zeinalabedini, M.; Hadavand Mirzaei, H.; Mirzajanzadeh, M.; Shafaroudi, S.M.; Bakhtiari, S. Fatty acids profiling: A selective criterion for screening microalgae strains for biodiesel production. Algal Res. 2013, 2, 258–267. [Google Scholar] [CrossRef]
- Simopoulos, A.P. The importance of the ratio of omega-6/omega-3 essential fatty acids. Biomed. Pharmacother. 2002, 56, 365–379. [Google Scholar] [CrossRef]
- Abedi, E.; Sahari, M.A. Long-chain polyunsaturated fatty acid sources and evaluation of their nutritional and functional properties. Food Sci. Nutr. 2014, 2, 443–463. [Google Scholar] [CrossRef]
- Dolganyuk, V.; Belova, D.; Babich, O.; Prosekov, A.; Ivanova, S.; Katserov, D.; Patyukov, N.; Sukhikh, S. Microalgae: A promising source of valuable bioproducts. Biomolecules 2020, 10, 1153. [Google Scholar] [CrossRef]
- Simopoulos, A.P. Essential fatty acids in health and chronic disease. Am. J. Clin. Nutr. 1999, 70, 560s–569s. [Google Scholar] [CrossRef]
- Knothe, G. Improving biodiesel fuel properties by modifying fatty ester composition. Energy Environ. Sci. 2009, 2, 759–766. [Google Scholar] [CrossRef]
- Islam, M.A.; Magnusson, M.; Brown, R.J.; Ayoko, G.A.; Nabi, M.N.; Heimann, K. Microalgal species selection for biodiesel production based on fuel properties derived from fatty acid profiles. Energies 2013, 6, 5676–5702. [Google Scholar] [CrossRef]
- Deshmukh, S.; Bala, K.; Kumar, R. Selection of microalgae species based on their lipid content, fatty acid profile and apparent fuel properties for biodiesel production. Environ. Sci. Pollut. Res. 2019, 26, 24462–24473. [Google Scholar] [CrossRef] [PubMed]
- Hoekman, S.K.; Broch, A.; Robbins, C.; Ceniceros, E.; Natarajan, M. Review of biodiesel composition, properties, and specifications. Renew. Sustain. Energy Rev. 2012, 16, 143–169. [Google Scholar] [CrossRef]
- Kousoulidou, M.; Fontaras, G.; Ntziachristos, L.; Samaras, Z. Biodiesel blend effects on common-rail diesel combustion and emissions. Fuel 2010, 89, 3442–3449. [Google Scholar] [CrossRef]
- Pandey, S.; Narayanan, I.; Vinayagam, R.; Selvaraj, R.; Varadavenkatesan, T.; Pugazhendhi, A. A review on the effect of blue green 11 medium and its constituents on microalgal growth and lipid production. J. Environ. Chem. Eng. 2023, 11, 109984. [Google Scholar] [CrossRef]
- Stanier, R.V.; Kunisawa, R.; Mandel, M.; Cohen-Bazire, G. Purification and properties of unicellular blue-green algae (order: Chrococcales). Bacteriol. Rev. 1971, 35, 171–205. [Google Scholar] [CrossRef]
- Cho, D.-H.; Ramanan, R.; Kim, B.-H.; Lee, J.; Kim, S.; Yoo, C.; Choi, G.-G.; Oh, H.-M.; Kim, H.-S. Novel approach for the development of axenic microalgal cultures from environmental samples. J. Phycol. 2013, 49, 802–810. [Google Scholar] [CrossRef]
- Reynolds, E.S. The use of lead citrate at high pH as an electron-opaque stain in electron microscopy. J. Cell Biol. 1963, 17, 208–212. [Google Scholar] [CrossRef]
- Medlin, L.; Elwood, H.J.; Stickel, S.; Sogin, M.L. The characterization of enzymatically amplified eukaryotic 16S-like rRNA-coding regions. Gene 1988, 71, 491–499. [Google Scholar] [CrossRef]
- Litaker, R.W.; Vandersea, M.W.; Kibler, S.R.; Reece, K.S.; Stokes, N.A.; Steidinger, K.A.; Millie, D.F.; Bendis, B.J.; Pigg, R.J.; Tester, P.A. Identification of Pfiesteria piscicida (Dinophyceae) and Pfiesteria-like organisms using internal transcribed spacers-specific PCR assays 1. J. Phycol. 2003, 39, 754–761. [Google Scholar] [CrossRef]
- Weekers, P.; Gast, R.J.; Fuerst, P.A.; Byers, T.J. Sequence variations in small-subunit ribosomal RNAs of Hartmannella vermiformis and their phylogenetic implications. Mol. Biol. Evol. 1994, 11, 684–690. [Google Scholar] [CrossRef]
- Scholin, C.A.; Herzog, M.; Sogin, M.; Anderson, D.M. Identification of group and strain specific genetic makers for globally distributed Alexandrium (Dinophyceae) II. Sequence analysis of a fragment of the LSU rRNA gene. J. Phycol. 1994, 30, 999–1011. [Google Scholar] [CrossRef]
- Hadi, S.I.I.A.; Santana, H.; Brunale, P.P.M.; Gomes, T.G. DNA barcoding green microalgae isolated from neotropical inland waters. PLoS ONE 2016, 11, e0149284. [Google Scholar] [CrossRef] [PubMed]
- Famà, P.; Wysor, B.; Kooistra, W.H.; Zuccarello, G.C. Molecular phylogeny of the genus Caulerpa (Caulerpales, Chlorophyta) inferred from chloroplast tufA gene1. J. Phycol. 2002, 38, 1040–1050. [Google Scholar] [CrossRef]
- Huelsenbeck, J.P.; Ronquist, F. MrBayes: Bayesian inference of phylogeny. Bioinformatics 2001, 17, 754–755. [Google Scholar] [CrossRef]
- Ronquist, F.; Huelsenbeck, J.P. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef]
- Kang, N.S.; Jeong, H.J.; Moestrup, Ø.; Shin, W.G.; Nam, S.W.; Park, J.Y.; de Salas, M.F.; Kim, K.W.; Noh, J.H. Description of a new planktonic mixotrophic dinoflagellate Paragymnodinium shiwhaense n. gen., n. sp. from the coastal waters off western Korea: Morphology, pigments, and ribosomal DNA gene sequence. J. Eukaryot. Microbiol. 2010, 57, 121–144. [Google Scholar] [CrossRef]
- Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef]
- Heo, J.; Cho, D.H.; Ramanan, R.; Oh, H.M.; Kim, H.S. PhotoBiobox: A tablet sized, low-cost, high throughput photobioreactor for microalgal screening and culture optimization for growth, lipid content and CO2 sequestration. Biochem. Eng. J. 2015, 103, 193–197. [Google Scholar] [CrossRef]
- Dubois, M.; Gilles, K.A.; Hamilton, J.K.; Rebers, P.A.; Smith, F. Colorimetric method for determination of sugars and related substances. Anal. Chem. 1956, 28, 350–356. [Google Scholar] [CrossRef]
- Mariotti, F.; Tome, D.; Mirand, P.P. Converting nitrogen into protein-Beyond 6.25 and Jones’ factors. Crit. Rev. Food Sci. 2008, 48, 177–184. [Google Scholar] [CrossRef]
- Kim, E.S.; Ki, H.; Lee, C.H.; An, S.M.; Kang, N.S.; Choi, G.; Hong, J.W.; Pan, C.H.; Park, B.S.; Cho, K. Enhancing carotenoid production and exploring the potential use of microalga Desmodesmus cf. pleiomorphus DSHM22 as a biodiesel feedstock through photoheterotrophic cultivation. Biomass Bioenergy 2023, 177, 106939. [Google Scholar] [CrossRef]
- Breuer, G.; Evers, W.A.C.; de Vree, J.H.; Kleinegris, D.M.M.; Martens, D.E.; Wijffels, R.H.; Lamers, P.P. Analysis of fatty acid content and composition in microalgae. J. Vis. Exp. 2013, 80, e50628. [Google Scholar]
Character Traits | AQYS21 | Guatemala | TAU-MAC 3917 | PUMCC 5.1.1 |
---|---|---|---|---|
Strain locality | Republic of Korea | Guatemala | Greece | India |
Coenobia | Present, 1-, 2-, 4-, 8-celled coenobia embedded in mucilage | Present, 1-, 2-, 4-, 8-celled coenobia embedded in mucilage | Present, cells surrounded by a mucilage envelope | Present, 2–4 or more cells within a spherical mucilage envelope |
Shape of young/mature cells | Asymmetric spindle-shaped | ND | ND | ND |
Pointed position of young cells | Both ends or one end pointed | ND | ND | ND |
Cell shape of mature cells | Sub-spherical to spherical shaped | ND | Spherical shaped * | Spherical shaped * |
Pyrenoid | Present, surrounded by the starch grains | Present | Present, surrounded by the starch grains * | Present, surrounded by the starch grains * |
Asexual reproduction | Present, mainly 2–8 autospores. Some cells have more than eight | 4–8 | Present, some cells have more than eight | ND |
Number of cell wall ribs | 20–26 | ND | ND | ND |
Cytoplasmic oil bodies | Present | ND | Present | ND |
Reference | This study | [43] | [40] | [35] |
Species | Strain | LC | Date | T (℃) | S (PSU) | Marker Gene | Amplicon Length (bp) | GenBank Accession Number |
---|---|---|---|---|---|---|---|---|
A. quadricellularis | AQYS21 | Manseong-ri Black Sand Beach | May 2021 | 23.2 | 15.3 | SSU | 923 | OR910536 |
LSU | 567 | OR910537 | ||||||
rbcL | 428 | OR916435 | ||||||
tufA | 967 | OR916436 |
Collection Location | Strain Habitat (Isolation Source) | Strain Name | GenBank Accession Number | Asterarcys quadricellularis AQYS21 * |
---|---|---|---|---|
Escaleras de Jaruco, Cuba | ND | Comas 77/75 | AF388375 | 0 (0) |
Daegu, Republic of Korea | Soil | KNUA020 | JQ043183 | 0 (0) |
Zhengzhou, China | ND | FACHB-2316 | MH176109 | 0 (0) |
Harbin, China | Soil | R-56 | OM427507 | 0 (0) |
Thessaloniki, Greece | Freshwater | TAU-MAC 3917 | OK641941 | 0 (0) |
Benha City, Egypt | Soil | A3 | ON763818 | 1 (0.1) |
Chennai, India | Freshwater | ND | KT280061 | 1 (0.1) |
Muktsar, India | Brackish | BGLR5 | MF661929 | 5 (0.5) |
Brazil | Freshwater | ND | KT429436 ** | 2 (0.2) |
Component | Content (%) | Note |
---|---|---|
Palmitic acid (C16:0) | 25.5 | SFA (major) |
Stearic acid (C18:0) | 0.87 | - |
Oleic acid (C18:1 n-9) | 13.3 | ω-9 MUFA (major) |
Linoleic acid (C18:2 n-6) | 5.98 | ω-6 PUFA (major) |
α-linolenic acid (C18:3 n-3) | 54.39 | ω-3 PUFA (major) |
Total saturated fatty acids | 26.37 | |
Total monounsaturated fatty acids | 13.3 | |
Total polyunsaturated fatty acids | 60.37 |
Source | SV (mg KOH/g) | IV (g I2/100 g) | DU | MUFA (%) | PUFA (%) | LCSF | CFPP (°C) | CN | OS (h) |
---|---|---|---|---|---|---|---|---|---|
Jatropha | 190.98 | 105.42 | 122.1 | 37.3 | 42.4 | 4.54 | −2.21 | 51.16 | 5.37 |
Karanja | 184.05 | 94.22 | 105.2 | 65.6 | 19.8 | 2.64 | −8.18 | 54.76 | 8.55 |
Mahua | 191.58 | 67.72 | 78.62 | 39.1 | 19.76 | 11.65 | 20.12 | 59.55 | 8.56 |
Palm | 194.82 | 48.05 | 55.7 | 37.04 | 9.33 | 6.91 | 5.22 | 63.5 | 15.23 |
Rapeseed | 188.61 | 115.07 | 125.46 | 64.4 | 30.53 | 0.77 | −14.05 | 49.35 | 6.45 |
A. quadricellularis AQYS21 | 205.11 | 171.65 | 134.04 | 13.3 | 60.37 | 2.99 | −7.08 | 34.29 | 4.54 |
Chlamydomonas hedleyi MM0020 | 95.6 | 62.09 | 55.0 | 2.6 | 26.2 | 2.43 | −8.84 | 89.42 | 7.09 |
Chlorella salina MM0063 | 132.19 | 100.26 | 85.0 | 2.6 | 41.2 | 2.75 | −7.84 | 65.03 | 5.45 |
Coelastrum microporum IBL-C119 | 181.83 | 82.61 | 84.64 | 45.24 | 19.7 | 4.02 | −3.84 | 57.73 | 8.58 |
Dunaliella salina LIMS-PS-1511 | 121.29 | 95.41 | 78.3 | 3.7 | 37.3 | 2.73 | −7.9 | 69.83 | 5.75 |
Graesiella emersonii GEGS21 | 204.86 | 131.06 | 121.3 | 22.5 | 49.4 | 3.05 | −6.89 | 43.45 | 4.98 |
Haematococcus lacustris | 162.7 | 98.86 | 95.81 | 20.13 | 37.84 | 3.82 | −4.46 | 57.6 | 5.75 |
Microglena monadina NFW3 | 188.54 | 166.15 | 138.24 | 3.28 | 67.48 | 2.71 | −7.97 | 37.86 | 4.34 |
Mychonastes homosphaera UTEX 2341 | 142.74 | 162.79 | 98.9 | 23.9 | 37.5 | 1.45 | −11.92 | 47.91 | 23.28 |
Jaagichlorella luteoviridis MM0014 | 157.6 | 109.69 | 110.7 | 7.1 | 51.8 | 2.77 | −7.77 | 56.25 | 4.87 |
Tetradesmus obliquus MM0026 | 138.92 | 98.63 | 85.4 | 18.4 | 33.5 | 2.45 | −8.78 | 63.4 | 6.11 |
EN14214 | - | ≤120 | - | - | - | - | ≤−20~5 | ≥51 | ≥6 |
ASTM D6751-02 | - | - | - | - | - | - | - | ≥47 | ≥3 |
Primer Name | Primer Region | Sequence (5′-3′) | Reference |
---|---|---|---|
EukA | Forward, SSU | AACCTGGTTGATCCTGCCAG | [87] |
G18R | Reverse, SSU | GCATCACAGACCTGTTATTG | [88] |
570F | Forward, SSU | GTAATTCCAGCTCCAATAGC | [89] |
EukB | Reverse, SSU | TGATCCTTCTGCAGGTTCACCTAC | [87] |
D1R | Forward, LSU | ACCCGCTGAATTTAAGCATA | [90] |
LSUB | Reverse, LSU | ACGAACGATTTGCACGTCAG | [88] |
rbcL-192 | Forward, rbcL | GGTACTTGGACAACWGTWTGGAC | [91] |
rbcL-657 | Reverse, rbcL | GAAACGGTCTCKCCARCGCAT | [91] |
TufA-F | Forward, tufA | TGAAACAGAAMAWCGTCATTATGC | [92] |
TufA-R | Reverse, tufA | CCTTCNCGAATMGCRAAWCGC | [92] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kang, N.S.; An, S.M.; Jo, C.R.; Ki, H.; Kim, S.Y.; Jeong, H.G.; Choi, G.; Hong, J.W.; Cho, K. Taxonomic, Physiological, and Biochemical Characterization of Asterarcys quadricellularis AQYS21 as a Promising Sustainable Feedstock for Biofuels and ω-3 Fatty Acids. Plants 2024, 13, 3008. https://doi.org/10.3390/plants13213008
Kang NS, An SM, Jo CR, Ki H, Kim SY, Jeong HG, Choi G, Hong JW, Cho K. Taxonomic, Physiological, and Biochemical Characterization of Asterarcys quadricellularis AQYS21 as a Promising Sustainable Feedstock for Biofuels and ω-3 Fatty Acids. Plants. 2024; 13(21):3008. https://doi.org/10.3390/plants13213008
Chicago/Turabian StyleKang, Nam Seon, Sung Min An, Chang Rak Jo, Hyunji Ki, Sun Young Kim, Hyeon Gyeong Jeong, Grace Choi, Ji Won Hong, and Kichul Cho. 2024. "Taxonomic, Physiological, and Biochemical Characterization of Asterarcys quadricellularis AQYS21 as a Promising Sustainable Feedstock for Biofuels and ω-3 Fatty Acids" Plants 13, no. 21: 3008. https://doi.org/10.3390/plants13213008
APA StyleKang, N. S., An, S. M., Jo, C. R., Ki, H., Kim, S. Y., Jeong, H. G., Choi, G., Hong, J. W., & Cho, K. (2024). Taxonomic, Physiological, and Biochemical Characterization of Asterarcys quadricellularis AQYS21 as a Promising Sustainable Feedstock for Biofuels and ω-3 Fatty Acids. Plants, 13(21), 3008. https://doi.org/10.3390/plants13213008