Next Article in Journal
Identification of SNP Markers and Candidate Genes Associated with Major Agronomic Traits in Coffea arabica
Next Article in Special Issue
Mapping and Candidate Gene Analysis of an All-Stage Stem Rust Resistance Gene in Durum Wheat Landrace PI 94701
Previous Article in Journal
Regulation of Proline Accumulation and Protein Secretion in Sorghum under Combined Osmotic and Heat Stress
Previous Article in Special Issue
Genome-Wide Association Studies on Chinese Wheat Cultivars Reveal a Novel Fusarium Crown Rot Resistance Quantitative Trait Locus on Chromosome 3BL
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 13
Issue 13
10.3390/plants13131875
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Transferring an Adult-Plant Stripe-Rust Resistance Gene Yr7VS from Chromosome 7V of Dasypyrum villosum (L.) to Bread Wheat

by
Fu Hou
1,2,†,
Yinyu Jin
1,†,
Jin Hu
1,
Lingna Kong
1,
Xiaoxue Liu
1,
Liping Xing
1,3,
Aizhong Cao
1,3 and
Ruiqi Zhang
1,3,*
1
State Key Laboratory of Crop Genetics & Germplasm Enhancement and Application/JCIC-MCP, College of Agronomy, Nanjing Agricultural University, Nanjing 210095, China
2
Huaiyin Institute of Agricultural Sciences of Xuhuai Area in Jiangsu, Huaian 223001, China
3
Zhongshan Biological Breeding Laboratory, No.50 Zhongling Street, Nanjing 210014, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Plants 2024, 13(13), 1875; https://doi.org/10.3390/plants13131875
Submission received: 9 June 2024 / Revised: 4 July 2024 / Accepted: 4 July 2024 / Published: 7 July 2024
(This article belongs to the Special Issue Mining and Mapping of Disease-Resistant Genes in Wheat)
Browse Figures
Versions Notes

Abstract

:
Stripe rust (Puccinia striiformis West. f.sp. tritici, Pst) is a destructive disease that seriously threatens wheat production globally. Exploring novel resistance genes for use in wheat breeding is an urgent need, as continuous Pst evolution frequently leads to a breakdown of host resistance. Here, we identified a set of wheat–Dasypyrum villosum 01I139 (V#6) disomic introgression lines for the purpose of determining their responses to a mixture of Pst isolates CYR32, CYR33 and CYR34 at both seedling and adult-plant stages. The results showed that all introgression lines exhibited high susceptibility at the seedling stage, with infection-type (IT) scores in the range of 6–8, whereas, for chromosomes 5V#6 and 7V#6, disomic addition lines NAU5V#6-1 and NAU7V#6-1 displayed high resistance at the adult-plant stage, indicating that adult-plant resistance (APR) genes were located on them. Further, in order to transfer the stripe-rust resistance on chromosome 7V#6, four new wheat–D. villosum introgression lines were identified, by the use of molecular cytogenetic approaches, from the self-pollinated seeds of 7D and 7V#6, in double monosomic line NAU7V#6-2. Among them, NAU7V#6-3 and NAU7V#6-4 were t7V#6L and t7V#6S monosomic addition lines, and NAU7V#6-5 and NAU7V#6-6 were homozygous T7DS·7V#6L and T7DL·7V#6S whole-arm translocation lines. Stripe-rust tests and genetic analyses of chromosome 7V#6 introgression lines revealed a dominant APR gene designated as Yr7VS on the chromosome arm 7V#6S. Comparison with the homozygous T7DL·7V#6S translocation line and the recurrent parent NAU0686 showed no significant differences in yield-related traits. Thus, T7DL·7V#6S whole-arm translocation with the APR gene Yr7VS provided a valuable germplasm for breeding for resistance.

1. Introduction

Stripe rust, caused by Puccinia striiformis West. f.sp. tritici, is one of the most damaging diseases affecting wheat (Triticum aestivum L.) production worldwide. Average yield losses per year caused by stripe rust range from 5–10%, but yield losses of more than 70% can occur in highly susceptible varieties [1]. The development and deployment of cultivars with host resistance is the most economical and environmentally friendly approach to the reduction of wheat-yield losses caused by stripe rusts. However, the resistance genes employed could turn out to be ineffective, as virulence in the pathogen population could be selected or the pathogen might rapidly evolve when a certain resistance gene is extensively used over large areas [2]. Therefore, ongoing efforts to exploit novel and effective sources of resistance are essential to counter the continuous evolution of stripe-rust pathogens.
Plants have developed various types of resistance to pathogens through their long-term coevolution [3]. In the case of stripe rust, race-specific all-stage resistance (ASR) genes, as well as race-nonspecific adult-plant resistance (APR) genes, have been employed in wheat breeding [4]. Race-specific ASR genes, such as Yr10 and Yr28, typically encode nucleotide-binding leucine-rich repeat (NLR) receptors that recognize specific pathogen avirulence (Avr) proteins and trigger a hypersensitive reaction [5,6]. The majority of these genes are non-durable as to their effectiveness, due to the evolution of new forms of virulence in the pathogen. In contrast, race-nonspecific APR genes, such as Yr18 and Yr46, encoding an ATP binding cassette (ABC) transporter and a hexose transporter involved in sugar uptake, respectively, confer durable resistance [7,8]. Although more than 86 stripe-rust resistance genes have been explored in wheat and its wild relatives (https://wheat.pw.usda.gov/GG3/wgc) (The access date is 1 May 2024), most of these genes belong to the race-specific ASR category. Therefore, the exploration of novel APR genes contributes to breeding durable resistance to wheat stripe-rust.
Numerous wheat disease-resistance genes have been introgressed from the plant’s wild relatives, enriching the genetic diversity of modern wheat [9]. For example, wheat stripe-rust resistance genes Yr9 and Yr83 originated from Secale cereal [10,11], Yr50 and YrT14 were introgressed from Thinopyrum intermedium [12,13] and Yr69 was introgressed from Thinopyrum ponticum [14]. Of these, Dasypyrum villosum (2n = 2x = 14, VV), an annual wild relative of wheat, has been used as a source for wheat improvement for decades [15]. Six D. villosum accessions (V#1 to V#6) were used to develop the amphiploids and alien addition/substitution lines [15,16]. Utilizing these intermediate materials, dozens of wheat–D. villosum translocation lines have been developed through centric breakage–fusion between homoeologous chromosomes or through physical irradiation [15]. Notably, seven powdery mildew genes, Pm21, Pm55, Pm62, Pm67, Pm5V, Pm3VS and Pm4VL, have been characterized and introgressed into bread wheat through the development of Robertsonian translocations [17,18,19,20,21,22,23]. Among them, the genes Pm21, Pm55 and Pm5V, typically encoding NLR receptors, have been cloned, and Pm55 and Pm5V were determined to be allelic and renamed as Pm55a and Pm55b, respectively [3,18]. In addition, the stripe-rust reactions of 115 D. villosum accessions have been tested, and 41 of them (35.65%) were resistant to different Pst isolates [24]. However, only a stripe rust ASR gene YrCD-3 on chromosome 3V#3 and an APR gene Yr5V on chromosome arm 5V#5S have been introgressed from D. villosum into bread wheat [19,25]. Recently, a complete array of new introgression lines involving chromosomes 1V#6 to 7V#6 of D. villosum accession 01I139 in the cv. NAU0686 genetic background have been developed [23], but their responses to stripe rust are unclear.
Here, we evaluated the stripe-rust responses for the chromosomes 1V#6 to 7V#6 as to disomic introgression lines, at both the seedling and adult-plant stages. The objectives of this work were to identify strip rust APR genes on the D. villosum chromosomes, and introgress them from the V genome into the wheat genomes through the breakage–fusion mechanism. Our results will provide a potential resource for wheat breeding with reference to resistance to stripe rust.

2. Results

2.1. Stripe-Rust Responses of 1V#6 to 7V#6 Disomic Lines

To explore the stripe-rust resistance genes introduced from D. villosum accession 01I139, seven disomic lines of chromosomes 1V#6 to 7V#6 were assessed for their reactions to stripe rust at both the seedling and adult-plant stages. The results showed that the seven introgression lines, as well as their background parent NAU0686, were all susceptible to the mixed Pst strains (CYR32, CYR33 and CYR34) with an IT score of 6–8 at the seedling stage (Figure 1A). However, chromosomes 5V#6 and 7V#6, disomic addition lines NAU5V#6-1 and NAU7V#6-1, exhibited high resistance to the mixed Pst strains at the adult-plant stage, with DS values of 10 and 20, respectively (Figure 1B). These findings suggest that the genes conferring resistance to stripe rust at the adult-plant stage are likely located on chromosomes 5V#6 and 7V#6, respectively. Previously, a stripe rust APR gene, Yr5V, was mapped to the short chromosome arm 5V#5S. This APR gene identified on chromosome 5V#6 may be allelic to it. However, no genes conferring resistance to stripe rust on chromosome 7V of D. villosum have been reported.

2.2. Development of a Double Monosomic Line of Chromosomes 7D and 7V#6

To produce a line with a double monosomic condition involving chromosomes 7D and 7V#6, disomic addition line NAU7V#6-1 (2n = 44) was used as the female parent in a cross with the NT line N7DT7A (2n = 42), derived from CS. In the F2 progeny, a plant designated as NAU7V#6-2 was identified by GISH/FISH analysis; this plant had a chromosome number of 2n = 42, containing a single chromosome 7D and a single chromosome 7V#6 (Figure 2A). This line was further confirmed using 7V/7D co-dominant molecular markers CINAU7VL-67 and CINAU7VS-166, which indicated the presence of specific bands for both chromosomes, namely, 7D and 7V#6 (Figure 3A,B). Therefore, NAU7V#6-2 was a double monosomic line and the Robertsonian translocations might be present in its self-pollinated seeds, and potentially formed through the breakage–fusion mechanism between chromosomes 7D and 7V#6.

2.3. Development of Chromosome 7V#6 Alterations

To identify the Robertsonian translocations, a total of 285 plants obtained from the self-pollinated seeds of chromosomes 7D and 7V#6, double monosomic line NAU7V#6-2, were screened using 7VS- and 7VL-specific molecular markers CINAU7VL-67 and CINAU7VS-166. Of these, 16 plants exhibited polymorphic bands only for the 7VS-specific marker, while 17 plants displayed polymorphic bands only for the 7VL-specific marker. Subsequent GISH/FISH analysis revealed that 13 of 16 7VS-plants contained a 7V#6S telosome; the remaining three plants were heterozygous with a normal 7D chromosome and a T7DL·7V#6S whole-arm translocated chromosome. Additionally, 15 of 17 7VL-plants had a 7V#6L telosome, and the remaining two plants contained a T7DS·7V#6L whole-arm translocated chromosome. Consequently, genetically fixed lines derived from these plants included t7V#6L monosomic addition line NAU7V#6-3 (Figure 2B), t7V#6S monosomic addition line NAU7V#6-4 (Figure 2C), homozygous T7DS·7V#6L translocation line NAU7V#6-5 (Figure 2D,F) and homozygous T7DL·7V#6S translocation line NAU7V#6-6 (Figure 2E,F).

2.4. Chromosome Location of the Stripe-Rust Resistance Conferred by 7V#6

In order to localize the resistance on chromosome 7V#6, the four introgression lines of NAU7V#6-3, NAU7V#6-4, NAU7V#6-5 and NAU7V#6-6 were inoculated using the mixed isolates of races CYR32, CYR33 and CYR34. All lines were identified as being susceptible to stripe rust at the seedling stage in the greenhouse (IT 7-8). When testing them at the adult-plant stage in the field nursery, the 7V#6L-related lines NAU7V#6-3 and NAU7V#6-5 were still susceptible, while 7V#6S-related lines NAU7V#6-4 and NAU7V#6-6 exhibited high resistance, suggesting that the stripe rust APR gene could be located on the chromosome arm 7V#6S (Figure 4).
To further confirm whether the resistance was linked to the alien fragment of T7DL·7V#6S, a cross was conducted between NAU0686 and NAU7V#6-6. All F1 plants (n = 20) showed adult-plant resistance, with an average DS value of 23.5 (10–30). Subsequently, the F2 plants were identified using the 7VS-specific marker (Figure 5). Among the 302 plants identified, 69 individuals lacked alien chromatin, 161 were heterozygous, and 72 were disomic for a T7DL·7V#6S recombinant chromosome pair, suggesting normal gametic transmission of the translocated chromosome relative to its intact chromosome 7D (χ21:2:1 = 1.3, p > 0.05) (Table 1). These plants were then tested for their reaction to the stripe rust. All of the plants with the T7DL·7V#6S translocated chromosome exhibited high resistance at the adult-plant stage, whereas the 69 plants lacking T7DL·7V#6S were all susceptible, displaying an average DS value of 76.5 (Table 1).
Furthermore, the backcrossing lines with or without the T7DL·7V#6S translocated chromosome were identified from BC3F2 individuals of NAU7V#6-6/3*NAU0686. Ten lines (BC3F3) with homozygous T7DL·7V#6S-translocated chromosomes were compared as to their responses to stripe rust with another ten lines, each with a pair of chromosomes 7D. The results confirmed that all the T7DL·7V#6S-lines exhibited high resistance to stripe rust at the adult-plant stage (DS 20-30), whereas all the 7DL·7DS-lines were highly susceptible, with DS scores ranging from 60 to 100 (Figure 6A,B), confirming that the stripe-rust resistance originated from D. villosum. Taken together, we concluded that a dominant APR gene is located on chromosome arm 7V#6S; this gene was temporary designated as Yr7VS.

2.5. Evaluation of Major Agronomic Traits

The T7DL·7V#6S translocation line possesses the stripe rust APR gene, suggesting that it could be an excellent resource for wheat improvement. However, it remains unknown whether it has any linkage drag making it undesirable relative to major agronomic traits. To investigate whether the T7DL·7V#6S translocated chromosome has any negative effect on the agronomic traits of bread wheat, we compared the yield-related traits between the BC3F3 and BC3F4 homozygous T7DL·7V#6S lines and their recurrent parent NAU0686 (Figure 7). The results showed that the T7DL·7V#6S-lines exhibited normal fertility and developmental stages, similar to the recurrent parent NAU0686, under field conditions (Figure 6A). Statistical analyses revealed no significant differences between the BC3F3 homozygous T7DL·7V#6S line and NAU0686 in terms of plant height, spike length, spikes per plant, thousand-grain weight, or grain yield per plant, but the grains per spike of the T7DL·7V#6S line was a little lower than that of NAU0686. In comparison, the BC3F4 homozygous T7DL·7V#6S line showed no significant differences in any of the tested agronomic traits. Accordingly, the T7DL·7V#6S translocation would not have significant negative impacts on agronomic traits, making it a valuable resource for wheat improvement.

3. Discussion

Exploiting genes from wild relatives is an important means used to broaden wheat’s genetic diversity [9]. D. villosum is an annual outcrossing diploid grass species which displays a high level of genetic differentiation among natural populations. Although the hybrids between tetraploid wheat and D. villosum are easy to produce, only a fraction of the alien chromatin is currently available as introgressions into bread wheat [15,16]. Recently, a complete set of new wheat–D. villosum V#6 disomic introgression lines were developed in CINAU, including four disomic substitution lines (2n = 42) containing, respectively, chromosomes 1V#6, 2V#6, 3V#6 and 6V#6, in addition to four disomic addition lines (2n = 44) containing, respectively, chromosomes 4V#6, 5V#6, 6V#6 and 7V#6 [23]. These lines have been evaluated as to their responses to powdery mildew at both the seedling and adult-plant stages [17,23]. In the present study, we further evaluated their responses to stripe rust, and revealed a novel stripe rust APR gene Yr7VS on the short arm of chromosome 7V#6. The identification of a compensating T7DL·7V#6S whole-arm translocation line with high levels of resistance to stripe rust at the adult-plant stage may provide a useful resource for wheat improvement.
Robertsonian whole-arm translocations (RobTs), which facilitate alien gene mapping to chromosome arms, are an initial material basis for small-fragment chromosome engineering; in addition, they can be used to evaluate the agronomic performance of the alien introgressed genes [19]. To develop RobTs translocations, the centric breakage–fusion behavior of univalents can be exploited [26]. In a double monosomic plant consisting of an alien chromosome and a homoeologous wheat chromosome, both monosomes remain univalent at meiotic metaphase I and have a tendency to break at the centromeres. This can result in the formation of RobTs through fusion of the broken arms [27,28]. By producing plants which were double-monosomic for chromosomes 7D of wheat and 7V#6 of D. villosum, we targeted the formation of RobTs between these two chromosomes. Seven RobTs were identified among the 280 progenies double-monosomic for the screened chromosomes 7D and 7V#6, corresponding to a frequency of 2.5%. The same approach was used to produce RobTs involving wheat chromosomes 1D to 7D and D. villosum chromosomes 1V#5 to 7V#5 [19].
Studies have shown that introgressed alien genes may be orthologous to resistance genes in wheat; examples include rye-derived Pm8 and wheat Pm3 [29], as well as D. villosum Pm21 and wheat Pm12 [30]. To date, several cataloged stripe-rust resistance genes in wheat and its relatives have been located on homoeologous group 7 chromosome short arms. Among them, Yr18 on 7DS confers a pleiotropic resistance effect [31]. Yr2 on chromosome 7B is a recessive gene [32], while Yr6 on chromosome arm 7BS in cv. Fielder is a seedling resistance gene [33]. However, in the present study, a stripe rust APR gene, Yr7VS, was confirmed as being located on chromosome arm 7V#6S; this could be distinct from previously characterized genes on the homoeologous group 7 chromosome short arms. Although genetic analysis in F2 and F2:3 progenies of cross NAU7V#6-6/NAU0686 exhibited a dominant gene conferring stripe-rust resistance at the adult-plant stage, and the gene was located on chromosome arm 7V#6S (Table 1), the number of introgressed alien resistance genes on this chromosome arm is unclear, as no recombinations have been identified between 7VS and 7DS. Thus, isolation and molecular-mechanism analysis of the gene Yr7V is needed, and this work will be performed in the next research effort.
Genome sequencing has revealed complex translocation events involving 4VL-5VL-7VS in D. villosum, which is similar to the 4AL-5AL-7BS translocation in wheat [34,35]. Notably, the size of the segment translocated from 7VS to 4VL was found to be larger than that of the fragment translocated from 7BS to 4AL in wheat [35]. In the current study, two Robertsonian whole-arm translocations, T7DS·7V#6L and T7DL·7V#6S, were developed through the fusion of the broken arms of chromosomes 7D and 7V#6. These lines might potentially have an impact on the genetic diversity and agronomic traits of wheat. However, yield-related-traits evaluation showed that T7DL·7V#6S translocations have no significant negative effects on major yield-related traits, which suggests that compensatory effects from genes on 7DS, missing in the T7DL·7V#6S translocation, could be provided by homologs on the homoeologous chromosome arms 7AS or 7BS. Overall, the development of the T7DL·7V#6S translocation line NAU7V#6-6 represents a valuable novel genetic resource for attempts to enhance stripe-rust resistance in wheat breeding. The stripe rust APR gene Yr7VS can be combined with other major or minor resistance genes to achieve low rust severity and durability [36]. Molecular markers for cloned ASR genes, such as Yr10, and APR genes, such as Yr36, are available and can be used for gene stacking [37,38]. We are presently transferring the T7DL·7V#6S translocation to commercial cultivars, which will allow us to evaluate its effects in other genetic backgrounds.

4. Materials and Methods

4.1. Plant Materials

The materials used in this study are listed in Table 2. Among them, D. villosum accession 01I139 (#6) was the donor of the alien introgression lines. Durum wheat ZY1286 (2n = 4x = 28, AABB) was, firstly, crossed with 01I139 to develop the amphiploid line AABBVV-3 [17]. Bread wheat NAU0686, with a high susceptibility to stripe rust, was used as a recurrent parent. A set of wheat–D. villosum disomic chromosome 1V#6 to 7V#6 lines was developed from the progenies of AABBVV-3/4*NAU0686 [23]. To develop translocation lines, the chromosome 7V#6 disomic addition line was crossed as a female with the Chinese Spring (CS)-derived nullisomic/tetrasomic (NT) line N7DT7A provided by the Wheat Genetics and Genomics Resource Centre, Kansas State University, Manhattan, KS, USA. Their progenies were screened for double monosomic plants with chromosomes 7D of wheat and 7V#6 of D. villosum accession 01I139. The new introgression lines were identified from the self-pollinated progenies of the 7D/7V double monosomic plant by molecular cytogenetic approaches. All of the genetic resources were maintained at the Cytogenetics Institute, Nanjing Agricultural University (CINAU).

4.2. Cytogenetic Analysis

The chromosomes of wheat and D. villosum were detected by genomic in situ hybridization (GISH) and fluorescence in situ hybridization (FISH) techniques. Root-tip cells from the germinating seedlings of the introgression lines were used to prepare the mitotic metaphase chromosomes [39]. D. villosum accession 01I139 genomic DNA was labeled with fluorescein-12-dUTP (green), used as a probe for GISH detection [40]. The special DNA repeat sequence Oligo-pAs1-2,5, labeled with 6-carboxytetramethylrhodamine (TAM) and synthesized by Shanghai Sangon Biotech Co., Ltd. (Shanghai, China), was used as probe for FISH detection, which produces red signals and preferentially paints tandem repeats on the wheat D genome. All of the chromosomes on the slides were counterstained with 4,6-diamidino-2-phenylindole (DAPI) (Invitrogen Life Science, Carlsbad, CA, USA) with a blue signal. Cytological images were captured using an Olympus BX60 microscope (Olympus Co., Tokyo) equipped with a SPOT Cooled Color Digital Camera (Diagnostic Instruments, Sterling Heights, MI, USA).

4.3. Molecular Marker Analysis

Leaf samples were collected at the 3-leaf stage, and genomic DNA was extracted using the cetyl trimethyl ammonium bromide (CTAB) method. The 7VL-specific molecular markers CINAU7VL-67 (F: GACTCTTCAGCCAGTTACTTCA; R: CTGCAGCGCCTCCTTTCC) and 7VS-specific molecular markers CINAU7VS-166 (F: CACAGTCAACAAGGAGGTCC; R: CCCAGTGCTGCTTGATGAAC) developed by Zhang et al. [41] were used to screen the progenies of NAU7V#6-1/N7DT7A for selection of the lines carrying chromosome arms 7VS or 7VL. PCR amplification was conducted using an iCycler thermalcycler (Bio-RAD Laboratories, Emeryville, CA, USA) in a 10 μL reaction volume. The reaction mixture contained 40 ng of genomic DNA, 2.0 μmol/L of each primer, 2.5 mmol/L of each dNTP and 0.2 U of Taq DNA polymerase, following the protocol described by Zhang et al. [19]. Subsequently, the PCR amplification products were combined with 2.0 μL of loading buffer (comprising 10 mM EDTA, 98% formamide, 0.25% bromophenol blue and 0.25% xylene cyanol) and subjected to analysis in 8% non-denaturing polyacrylamide gels. The D2000 Plus DNA Ladder (GenStar, Beijing, China) was used for the DNA marker in non-denaturing polyacrylamide gel. The resulting band patterns were visualized using silver staining.

4.4. Stripe-Rust Evaluation

The stripe-rust responses of wheat–D. villosum introgression lines and their recurrent parent NAU0686 were assessed at both seedling and adult-plant stages. The mixed Pst strains, including CYR32, CYR33 and CYR34 isolates, from types currently prevailing in China, were used to infect the plants of the test lines and the spreader [42]. The seedling tests were performed in a greenhouse environment with a temperature of 16 °C and a light intensity of 150–170 µmol m−2 s−1 for 16 h, followed by 8 h at 10 °C in darkness. Ten seeds from each of the lines were grown in rectangular trays, with each tray consisting of 32 cells (6.5 × 6.5 × 9.0 cm). The susceptible check NAU0686 was planted with three cells randomly selected from among the trays. Seedling infection-type (IT) data were recorded 14 days post-inoculation, utilizing a modified 0–9 scale, when the spores were fully developed on the first affected leaf of the susceptible cultivar NAU0686 [43].
The same set of lines was tested at the adult-plant stage against the mixture of stripe-rust pathotypes. All of the materials were planted in the field nurseries at the Baima Experiment Station of Nanjing Agricultural University. Twenty seeds from each line were sown in individual 1.5 m rows with 25 cm spacing between them. The plants were rated for stripe-rust infection at the shooting stage. NAU0686 samples were used as the susceptible control. Adult-plant reactions were assessed using a 0–100 scale, based on the severity of the disease levels on the flag leaves of the susceptible check when they had reached maximum severity [44].

4.5. Evaluation of Agronomic Traits

Homozygous T7DL·7V#6S translocation lines were identified from the BC3F2 progenies of the NAU7V#6-6/3*NAU0686. Yield trials of BC3F3 and BC3F4 lines and the recurrent parent NAU0686 were performed in the experimental station of Jiangsu Academy of Agricultural Sciences, Nanjing, China. Each line was arranged in a randomized plot design, with rows (1.5 m × 0.2 m/row) with three replications. All of the plants were treated with fungicides and pesticides to manage diseases and insects. At the physiological maturity stage, fifteen plants located in the middle of the internal two rows of T7DL·7V#6S translocation lines and NAU0686 were randomly chosen for the analysis of various yield-related traits, including plant height (PH), spike length (SL), spike number per plant, grains per spike, and thousand-grain weight (TKW). The mean values and standard errors of the treatments were determined using Microsoft Excel. Differences in agronomic traits between the lines were evaluated using Tukey’s post hoc test (SPSS 26.0, Chicago, USA) at a significance level of p = 0.05.

5. Conclusions

In this study, a complete set of wheat–Dasypyrum villosum 01I139 (V#6) disomic introgression lines were evaluated with reference to their responses to stripe rust at both seedling and adult-plant stages. By using a combination of GISH/FISH and molecular markers, wheat–D. villosum homozygous T7DS·7V#6L translocation line NAU7V#6-5, and T7DL·7V#6S translocation line NAU7V#6-6 were identified. A stripe rust APR gene, Yr7VS, located on the chromosome arm 7VS#6, was confirmed and introgressed into the wheat. The T7DL·7V#6S translocation showed no obvious negative effect on yield-related traits; this research provides a new germplasm which can be used in breeding for resistance.

Author Contributions

R.Z. conceptualized the experiments and designed the methodology; F.H. and Y.J. performed the data curation and formal analysis; J.H. and L.K. performed the investigation; X.L. and L.X. supervised the experiment; R.Z. and F.H. wrote the original manuscript; A.C. contributed to the revision of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (32272062); National Key Research and Development Program of China (2023YFD1200402); Research and Development Fund Project of Huai’an Academy of Agricultural Sciences (HNY202211); and Huai’an Natural Science Research Program (Guiding) Project (HABZ202228).

Data Availability Statement

The original contributions presented in the present study are included in the article. The plant materials and datasets generated and analyzed during the present study are available from the corresponding authors upon reasonable request.

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Chen, X. Pathogens which threaten food security: Puccinia striiformis, the wheat stripe rust pathogen. Food Sec. 2020, 12, 239–251. [Google Scholar] [CrossRef]
  2. Develey-Rivière, M.P.; Galiana, E. Resistance to pathogens and host developmental stage: A multifaceted relationship within the plant kingdom. New Phytol. 2007, 175, 405–416. [Google Scholar] [CrossRef] [PubMed]
  3. Lu, C.; Du, J.; Chen, H.; Gong, S.; Jin, Y.; Meng, X.; Zhang, T.; Fu, B.; Molnár, I.; Holušová, K.; et al. Wheat Pm55 alleles exhibit distinct interactions with an inhibitor to cause different powdery mildew resistance. Nat. Commun. 2024, 15, 503. [Google Scholar] [CrossRef] [PubMed]
  4. Whalen, M.C. Host defense in a developmental context. Mol. Plant Pathol. 2005, 6, 347–360. [Google Scholar] [CrossRef]
  5. Zhang, C.; Huang, L.; Zhang, H.; Hao, Q.; Lyu, B.; Wang, M.; Epstein, L.; Liu, M.; Kou, C.; Qi, J.; et al. An ancestral NB-LRR with duplicated 3′UTRs confers stripe rust resistance in wheat and barley. Nat. Commun. 2019, 10, 4023. [Google Scholar] [CrossRef] [PubMed]
  6. Ni, F.; Zheng, Y.; Liu, X.; Yu, Y.; Zhang, G.; Epstein, L.; Mao, X.; Wu, J.; Yuan, C.; Lv, B.; et al. Sequencing trait-associated mutations to clone wheat rust-resistance gene YrNAM. Nat. Commun. 2023, 14, 4353. [Google Scholar] [CrossRef] [PubMed]
  7. Krattinger, S.G.; Kang, J.; Bräunlich, S.; Boni, R.; Chauhan, H.; Selter, L.L.; Robinson, M.D.; Schmid, M.W.; Wiederhold, E.; Hensel, G.; et al. Abscisic acid is a substrate of the ABC transporter encoded by the durable wheat disease resistance gene Lr34. New Phytol. 2019, 223, 853–866. [Google Scholar] [CrossRef] [PubMed]
  8. Moore, J.W.; Herrera-Foessel, S.; Lan, C.; Schnippenkoetter, W.; Ayliffe, M.; Huerta-Espino, J.; Lillemo, M.; Viccars, L.; Milne, R.; Periyannan, S.; et al. A recently evolved hexose transporter variant confers resistance to multiple pathogens in wheat. Nat. Genet. 2015, 47, 1494–1498. [Google Scholar] [CrossRef]
  9. Tekin, M.; Emiralioğlu, O.; Yeken, M.Z.; Nadeem, M.A.; Çiftçi, V.; Baloch, F.S. Wild relatives and their contributions to wheat breeding. In Ancient Wheats; Zencirci, N., Ulukan, H., Baloch, F.S., Mansoor, S., Rasheed, A., Eds.; Springer: Cham, Switzerland, 2022. [Google Scholar]
  10. Shi, Z.X.; Chen, X.M.; Line, R.F.; Leung, H.; Wellings, C.R. Development of resistance gene analog polymorphism markers for the Yr9 gene resistance to wheat stripe rust. Genome 2001, 44, 509–516. [Google Scholar] [CrossRef] [PubMed]
  11. Li, J.; Dundas, I.; Dong, C.; Li, G.; Trethowan, R.; Yang, Z.; Hoxha, S.; Zhang, P. Identification and characterization of a new stripe rust resistance gene Yr83 on rye chromosome 6R in wheat. Theor. Appl. Genet. 2020, 133, 1095–1107. [Google Scholar] [CrossRef] [PubMed]
  12. Liu, J.; Chang, Z.; Zhang, X.; Yang, Z.; Li, X.; Jia, J.; Zhan, H.; Guo, H.; Wang, J. Putative Thinopyrum intermedium-derived stripe rust resistance gene Yr50 maps on wheat chromosome arm 4BL. Theor. Appl. Genet. 2013, 126, 265–274. [Google Scholar] [CrossRef] [PubMed]
  13. Guo, X.; Huang, Y.; Wang, J.; Fu, S.; Wang, C.; Wang, M.; Zhou, C.; Hu, X.; Wang, T.; Yang, W.; et al. Development and cytological characterization of wheat-Thinopyrum intermedium translocation lines with novel stripe rust resistance gene. Front. Plant Sci. 2023, 14, 1135321. [Google Scholar] [CrossRef] [PubMed]
  14. Hou, L.; Jia, J.; Zhang, X.; Li, X.; Yang, Z.; Ma, J.; Guo, H.; Zhan, H.; Qiao, L.; Chang, Z. Molecular mapping of the stripe rust resistance gene Yr69 on wheat chromosome 2AS. Plant Dis. 2016, 100, 1717–1724. [Google Scholar] [CrossRef] [PubMed]
  15. De Pace, C.; Vaccino, P.; Cionini, G.; Pasquini, M.; Bizzarri, M.; Qualset, C.O. Wild crop relatives: Genomic and breeding resources, cereals, vol 1, chapter 4. Springer, Heidelberg. Exp. Agric. 2011, 47, 736. [Google Scholar]
  16. Grądzielewska, A. The genus Dasypyrum—Part 2. Dasypyrum villosum—A wild species used in wheat improvement. Euphytica 2006, 152, 441–454. [Google Scholar]
  17. Hou, F.; Chen, H.; Zhang, T.; Jin, Y.; Kong, L.; Liu, X.; Xing, L.; Cao, A.; Zhang, R. Introgression of an all-stage and broad-spectrum powdery mildew resistance gene Pm3VS from Dasypyrum villosum chromosome 3V into wheat. Plant Dis. 2024; Epub ahead of print. [Google Scholar]
  18. Xing, L.; Hu, P.; Liu, J.; Witek, K.; Zhou, S.; Xu, J.; Zhou, W.; Gao, L.; Huang, Z.; Zhang, R.; et al. Pm21 from Haynaldia villosa encodes a CC-NBS-LRR protein conferring powdery mildew resistance in wheat. Mol. Plant 2018, 11, 874–878. [Google Scholar] [CrossRef] [PubMed]
  19. Zhang, R.Q.; Lu, C.T.; Meng, X.R.; Fan, Y.L.; Du, J.; Liu, R.R.; Feng, Y.; Xing, L.; Cápal, P.; Holušová, K.; et al. Fine mapping of powdery mildew and stripe rust resistance genes Pm5V/Yr5V transferred from Dasypyrum villosum into wheat without yield penalty. Theor. Appl. Genet. 2022, 135, 3629–3642. [Google Scholar] [CrossRef] [PubMed]
  20. Zhang, R.Q.; Fan, Y.L.; Kong, L.N.; Wang, Z.J.; Wu, J.Z.; Xing, L.P.; Cao, A.Z.; Feng, Y.G. Pm62, an adult-plant powdery mildew resistance gene introgressed from Dasypyrum villosum chromosome arm 2VL into wheat. Theor. Appl. Genet. 2018, 131, 2613–2620. [Google Scholar] [CrossRef] [PubMed]
  21. Zhang, R.Q.; Xiong, C.X.; Mu, H.Q.; Yao, R.N.; Meng, X.R.; Kong, L.N.; Xing, L.P.; Wu, J.Z.; Feng, Y.G.; Cao, A.Z. Pm67, a new powdery mildew resistance gene transferred from Dasypyrum villosum chromosome 1V to common wheat (Triticum aestivum L.). Crop J. 2021, 9, 882–888. [Google Scholar] [CrossRef]
  22. Zhang, R.Q.; Sun, B.X.; Chen, J.; Cao, A.Z.; Xing, L.P.; Feng, Y.G.; Lan, C.; Chen, P. Pm55, a developmental-stage and tissue-specific powdery mildew resistance gene introgressed from Dasypyrum villosum into common wheat. Theor. Appl. Genet. 2016, 129, 1975–1984. [Google Scholar] [CrossRef] [PubMed]
  23. Wei, Y.; Zhang, T.; Li, W.; Kong, L.N.; Liu, X.Y.; Xing, L.P.; Cao, A.Z.; Zhang, R.Q. Introgression of an adult-plant powdery mildew resistance gene Pm4VL from Dasypyrum villosum chromosome 4V into bread wheat. Front. Plant Sci. 2024, 15, 1401525. [Google Scholar] [CrossRef] [PubMed]
  24. Yildirim, A.; Jones, S.S.; Murray, T.D.; Line, R.F. Evaluation of Dasypyrum villosum populations for resistance to cereal eyespot and stripe rust pathogens. Plant Dis. 2000, 84, 40–44. [Google Scholar] [CrossRef] [PubMed]
  25. Zhang, J.; Tang, S.; Lang, T.; Wang, Y.; Long, H.; Deng, G.; Chen, Q.; Guo, Y.; Xuan, P.; Xiao, J.; et al. Molecular cytogenetic identification of the wheat-Dasypyrum villosum T3DL·3V#3S translocation line with resistance against stripe rust. Plants 2022, 11, 1329. [Google Scholar] [CrossRef] [PubMed]
  26. Sears, E.R. Misdivision of univalents in common wheat. Chromosoma 1952, 4, 535–550. [Google Scholar] [CrossRef] [PubMed]
  27. Friebe, B.; Zhang, P.; Linc, G.; Gill, B.S. Robertsonian translocations in wheat arise by centric misdivision of univalents at anaphase I and rejoining of broken centromeres during interkinesis of meiosis II. Cytogenet Genome Res. 2005, 109, 293–297. [Google Scholar] [CrossRef] [PubMed]
  28. Lukaszewski, A.J. Further manipulation by centric misdivision of the 1RS.1BL translocation in wheat. Euphytica 1997, 94, 257–261. [Google Scholar] [CrossRef]
  29. Hurni, S.; Brunner, S.; Buchmann, G.; Herren, G.; Jordan, T.; Krukowski, P.; Wicker, T.; Yahiaoui, N.; Mago, R.; Keller, B. Rye Pm8 and wheat Pm3 are orthologous genes and show evolutionary conservation of resistance function against powdery mildew. Plant J. 2013, 76, 957–969. [Google Scholar] [CrossRef] [PubMed]
  30. Zhu, S.Y.; Liu, C.; Gong, S.; Chen, Z.; Chen, R.; Liu, T.; Liu, R.; Du, H.; Guo, R.; Li, G.; et al. Orthologous genes Pm12 and Pm21 from two wild relatives of wheat show evolutionary conservation but divergent powdery mildew resistance. Plant Commun. 2022, 4, 100472. [Google Scholar] [CrossRef] [PubMed]
  31. Tomkowiak, A.; Skowrońska, R.; Kwiatek, M.; Spychała, J.; Weigt, D.; Kurasiak-Popowska, D. Identification of leaf rust resistance genes Lr34 and Lr46 in common wheat (Triticum aestivum L. ssp. aestivum) lines of different origin using multiplex PCR. Open Life Sci. 2021, 16, 172–183. [Google Scholar] [PubMed]
  32. Klymiuk, V.; Haile, T.; Ens, J.; Wiebe, K.; Fatiukha, A.; Krugman, T.; Ben-David, R.; Hübner, S.; Cloutier, S.; Pozniak, C.J. Genetic architecture of rust resistance in a wheat (Triticum turgidum) diversity panel. Front. Plant Sci. 2023, 14, 1145371. [Google Scholar] [CrossRef] [PubMed]
  33. Li, Y.; Niu, Y.C.; Chen, X.M. Mapping a stripe rust resistance gene YrC591 in wheat variety C591 with SSR and AFLP markers. Theor. Appl. Genet. 2009, 118, 339–346. [Google Scholar] [CrossRef] [PubMed]
  34. Dvorak, J.; Wang, L.; Zhu, T.; Jorgensen, C.M.; Luo, M.; Deal, K.R.; Gu, Y.; Gill, B.S.; Distelfeld, A.; Devos, K.M.; et al. Reassessment of the evolution of wheat chromosomes 4A, 5A, and 7B. Theor. Appl. Genet. 2018, 131, 2451–2462. [Google Scholar] [CrossRef] [PubMed]
  35. Zhang, X.; Wang, H.; Sun, H.; Li, Y.; Feng, Y.; Jiao, C.; Li, M.; Song, X.; Wang, T.; Wang, Z.; et al. A chromosome-scale genome assembly of Dasypyrum villosum provides insights into its application as a broad-spectrum disease resistance resource for wheat improvement. Mol. Plant 2023, 16, 432–451. [Google Scholar] [CrossRef] [PubMed]
  36. Wang, F.; Zhang, M.; Hu, Y.; Gan, M.; Jiang, B.; Hao, M.; Ning, S.; Yuan, Z.; Chen, X.; Chen, X.; et al. Pyramiding of adult-plant resistance genes enhances all-stage resistance to wheat stripe rust. Plant Dis. 2023, 107, 879–885. [Google Scholar] [CrossRef] [PubMed]
  37. Liu, W.; Frick, M.; Huel, R.; Nykiforuk, C.L.; Wang, X.; Gaudet, D.A.; Eudes, F.; Conner, R.L.; Kuzyk, A.; Chen, Q.; et al. The stripe rust resistance gene Yr10 encodes an evolutionary-conserved and unique CC-NBS-LRR sequence in wheat. Mol. Plant 2014, 7, 1740–1755. [Google Scholar] [CrossRef] [PubMed]
  38. Fu, D.; Uauy, C.; Distelfeld, A.; Blechl, A.; Epstein, L.; Chen, X.; Sela, H.; Fahima, T.; Dubcovsky, J. Kinase-START gene confers temperature-dependent resistance to wheat stripe rust. Science 2009, 323, 1357–1360. [Google Scholar] [CrossRef]
  39. Kato, A.; Lamb, J.C.; Birchler, J.A. Chromosome painting using repetitive DNA sequences as probes for somatic chromosome identification in maize. Proc. Natl. Acad. Sci. USA 2004, 101, 13554–13559. [Google Scholar] [CrossRef] [PubMed]
  40. Du, P.; Zhuang, L.F.; Wang, Y.Z.; Li, Y.; Wang, Q.; Wang, D.R.; Tan, L.; Shen, J.; Xu, H.; Zhao, H.; et al. Development of oligonucleotides and multiplex probes for quick and accurate identification of wheat and Thinopyrum bessarabicum chromosomes. Genome 2017, 60, 93–103. [Google Scholar] [CrossRef] [PubMed]
  41. Zhang, X.D.; Wei, X.; Xiao, J.; Yuan, C.X.; Wu, Y.F.; Cao, A.Z.; Xing, L.P.; Chen, P.D.; Zhang, S.Z.; Wang, X.E. Whole genome development of intron targeting (IT) markers specific for Dasypyrum villosum chromosomes based on next-generation sequencing technology. Mol. Breed. 2017, 37, 115. [Google Scholar] [CrossRef]
  42. Han, D.; Wang, Q.; Chen, X.; Zeng, Q.; Wu, J.; Xue, W.; Zhan, G.; Huang, L.L.; Kang, Z. Emerging Yr26-virulent races of Puccinia striiformis f. tritici are threatening wheat production in the Sichuan basin, China. Plant Dis 2015, 99, 754–760. [Google Scholar] [CrossRef] [PubMed]
  43. Line, R.F.; Qayoum, A. Virulence, Aggressiveness, Evolution, and Distribution of Races of Puccinia striiformis (the Cause of Stripe Rust of Wheat) in North America 1968–1987; US Department of Agriculture Technical Bulletin: Canberra, Australia, 1992; p. 74.
  44. Peterson, R.F.; Campbell, A.B.; Hannah, A.E. A diagrammatic scale for estimating rust intensity of leaves and stems of cereals. Can. J. Res. 1948, 26, 496–500. [Google Scholar] [CrossRef]
Plants 13 01875 g001
Figure 1. Stripe-rust reactions of a set of wheat–D. villosum disomic introgression lines involving chromosomes 1V#6 to 7V#6. (A) In the seedling (three-leaf) stage, recurrent parent NAU0686 and seven disomic introgression lines were highly susceptible (IT 6-8) to the mixed isolates of CYR32, CYR33 and CYR34. Bar: 0.5 cm. (B) Lines NAU0686, NAU1V#6-1, NAU2V#6-1, NAU3V#6-1, NAU4V#6-1 and NAU6V#6-1 were susceptible to stripe rust at the adult-plant stage, while lines NAU5V#6-1 and NAU7V#6-1 were resistant. Bar: 0.5 cm.
Figure 1. Stripe-rust reactions of a set of wheat–D. villosum disomic introgression lines involving chromosomes 1V#6 to 7V#6. (A) In the seedling (three-leaf) stage, recurrent parent NAU0686 and seven disomic introgression lines were highly susceptible (IT 6-8) to the mixed isolates of CYR32, CYR33 and CYR34. Bar: 0.5 cm. (B) Lines NAU0686, NAU1V#6-1, NAU2V#6-1, NAU3V#6-1, NAU4V#6-1 and NAU6V#6-1 were susceptible to stripe rust at the adult-plant stage, while lines NAU5V#6-1 and NAU7V#6-1 were resistant. Bar: 0.5 cm.
Plants 13 01875 g001
Plants 13 01875 g002
Figure 2. Identification of chromosome 7V#6 introgression lines through genomic in situ hybridization (GISH) and fluorescent in situ hybridization (FISH). D. villosum 01I139 genomic DNA labeled with fluorescein-12-dUTP (green) as probes was used for GISH. The D-genome-specific probe for FISH was Oligo-pAs1-2,5, labeled with TAM (red). Wheat chromosomes were counterstained with DAPI (blue). (A) GISH/FISH patterns of NAU7V#6-2 (2n = 42), showing double monosomic aspects for chromosomes 7D and 7V#6. (B) GISH/FISH patterns of NAU7V#6-3 (2n = 43), t7V#6L monosomic addition line. (C) GISH/FISH patterns of NAU7V#6-4 (2n = 43), t7V#6S monosomic addition line. (D) GISH/FISH patterns of NAU7V#6-5 (2n = 42), homozygous T7DS·7V#6L translocation line. (E) GISH/FISH patterns of NAU7V#6-6 (2n = 42), homozygous T7DL·7V#6S translocation line. (F) Comparison of chromosomes 7D, 7V#6, T7DS·7V#6L and T7DL·7V#6S. Bars: 10 μm.
Figure 2. Identification of chromosome 7V#6 introgression lines through genomic in situ hybridization (GISH) and fluorescent in situ hybridization (FISH). D. villosum 01I139 genomic DNA labeled with fluorescein-12-dUTP (green) as probes was used for GISH. The D-genome-specific probe for FISH was Oligo-pAs1-2,5, labeled with TAM (red). Wheat chromosomes were counterstained with DAPI (blue). (A) GISH/FISH patterns of NAU7V#6-2 (2n = 42), showing double monosomic aspects for chromosomes 7D and 7V#6. (B) GISH/FISH patterns of NAU7V#6-3 (2n = 43), t7V#6L monosomic addition line. (C) GISH/FISH patterns of NAU7V#6-4 (2n = 43), t7V#6S monosomic addition line. (D) GISH/FISH patterns of NAU7V#6-5 (2n = 42), homozygous T7DS·7V#6L translocation line. (E) GISH/FISH patterns of NAU7V#6-6 (2n = 42), homozygous T7DL·7V#6S translocation line. (F) Comparison of chromosomes 7D, 7V#6, T7DS·7V#6L and T7DL·7V#6S. Bars: 10 μm.
Plants 13 01875 g002
Plants 13 01875 g003
Figure 3. PCR amplification patterns of wheat–D. villosum introgression lines using specific molecular markers. (A) PCR amplification patterns, using 7VS-specific marker CINAU7VS-166. (B) PCR amplification patterns, using 7VL-specific marker CINAU7VL-67. Marker: DL2000.
Figure 3. PCR amplification patterns of wheat–D. villosum introgression lines using specific molecular markers. (A) PCR amplification patterns, using 7VS-specific marker CINAU7VS-166. (B) PCR amplification patterns, using 7VL-specific marker CINAU7VL-67. Marker: DL2000.
Plants 13 01875 g003
Plants 13 01875 g004
Figure 4. Stripe-rust reactions of chromosome 7V#6 introgression lines at the adult-plant stage. Lines NAU7V#6-1, NAU7V#6-2, NAU7V#6-4 and NAU7V#6-6 exhibited high resistance to a mixture of Pst isolates CYR32, CYR33 and CYR34 at the adult-plant stage, whereas NAU7V#6-3 and NAU7V#6-5 were susceptible. Bar: 0.5 cm.
Figure 4. Stripe-rust reactions of chromosome 7V#6 introgression lines at the adult-plant stage. Lines NAU7V#6-1, NAU7V#6-2, NAU7V#6-4 and NAU7V#6-6 exhibited high resistance to a mixture of Pst isolates CYR32, CYR33 and CYR34 at the adult-plant stage, whereas NAU7V#6-3 and NAU7V#6-5 were susceptible. Bar: 0.5 cm.
Plants 13 01875 g004
Plants 13 01875 g005
Figure 5. PCR amplification patterns of 7VS/7DS co-dominant marker CINAU7VS-166 in NAU0686/NAU7V#6-6 F2 individuals.
Figure 5. PCR amplification patterns of 7VS/7DS co-dominant marker CINAU7VS-166 in NAU0686/NAU7V#6-6 F2 individuals.
Plants 13 01875 g005
Plants 13 01875 g006
Figure 6. The morphologies of adult plants with or without T7DL·7V#6S translocation. (A) Plant morphology of T7DL·7V#6S translocation line and its recurrent parent NAU0686, showing the similar developmental stages and plant height shared between them. (B) The 7DL·7DS and 7DL·7V#6S NILs in the NAU0686 background, showing enhanced resistance to stripe rust caused by the T7DL·7V#6S introgression.
Figure 6. The morphologies of adult plants with or without T7DL·7V#6S translocation. (A) Plant morphology of T7DL·7V#6S translocation line and its recurrent parent NAU0686, showing the similar developmental stages and plant height shared between them. (B) The 7DL·7DS and 7DL·7V#6S NILs in the NAU0686 background, showing enhanced resistance to stripe rust caused by the T7DL·7V#6S introgression.
Plants 13 01875 g006
Plants 13 01875 g007
Figure 7. Comparative analysis of agronomic traits between T7DL·7V#6S translocation lines and recurrent parent NAU0686. (A–F) The differences of the yield-related traits in plant height (A), spike length (B), spikes/plant (C), grains/spike (D), thousand-grain weight (E) and grain yield per plant (F), showing that the T7DL·7V#6S translocation would not have significant negative impacts on agronomic traits. Values are the mean ± SD (two-sided t-test; * p < 0.1; ns not significant; n = 45).
Figure 7. Comparative analysis of agronomic traits between T7DL·7V#6S translocation lines and recurrent parent NAU0686. (A–F) The differences of the yield-related traits in plant height (A), spike length (B), spikes/plant (C), grains/spike (D), thousand-grain weight (E) and grain yield per plant (F), showing that the T7DL·7V#6S translocation would not have significant negative impacts on agronomic traits. Values are the mean ± SD (two-sided t-test; * p < 0.1; ns not significant; n = 45).
Plants 13 01875 g007
Table 1. Adult-plant stage segregation for reaction to stripe rust in progeny of cross NAU7V#6-6/NAU0686.
Table 1. Adult-plant stage segregation for reaction to stripe rust in progeny of cross NAU7V#6-6/NAU0686.
Chromosome Status(7VS/7VS)(7VS/7DS)(7DS/7DS)Expected Ratioχ2
Number of F2 individuals72161691:2:11.3
Strip-rust severity (%) of individual F2 plants20 (10–30)28.5 (20–50)76.5 (60–100)--
Response of F2:3 linesHomozygous resistantSegregatingHomozygous susceptible -
χ2 value for significance at p = 0.05 is 5.99.
Table 2. The genetic stocks developed and used in this study.
Table 2. The genetic stocks developed and used in this study.
LineChromosome StructureDescription
NAU0686AABBDD (2n = 42)High-yield wheat cultivar highly susceptible to stripe rust; used as the recurrent parent for all alien introgression lines
N7DT7ANull 7D (2n = 42)Nulli-tetrasomic line of Chinese Spring
01I139V#6V#6 (2n = 14)Donor Dasypyrum villosum collected from Greece
ZY1286AABB (2n = 28)Spring durum wheat used to cross with D. villosum 01I139
NAU7V#6-1DA7V#6 (2n = 44)NAU0686, with an added pair of chromosome 7V#6 of 01I139
NAU7V#6-2MA7V#6 (2n = 42)7D and 7V#6, double monosomic line
NAU7V#6-3t7V#6L (2n = 43)7V#6L telosomic addition line
NAU7V#6-4t7V#6L (2n = 43)7V#6S telosomic addition line
NAU7V#6-5T7DS·7V#6L (2n = 42)Compensation translocation line in which chromosome arm 7V#6L is substituted for 7DL
NAU7V#6-6T7DL·7V#6S (2n = 42)Compensation translocation line in which chromosome arm 7V#6S is substituted for 7DS
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Hou, F.; Jin, Y.; Hu, J.; Kong, L.; Liu, X.; Xing, L.; Cao, A.; Zhang, R. Transferring an Adult-Plant Stripe-Rust Resistance Gene Yr7VS from Chromosome 7V of Dasypyrum villosum (L.) to Bread Wheat. Plants 2024, 13, 1875. https://doi.org/10.3390/plants13131875

AMA Style

Hou F, Jin Y, Hu J, Kong L, Liu X, Xing L, Cao A, Zhang R. Transferring an Adult-Plant Stripe-Rust Resistance Gene Yr7VS from Chromosome 7V of Dasypyrum villosum (L.) to Bread Wheat. Plants. 2024; 13(13):1875. https://doi.org/10.3390/plants13131875

Chicago/Turabian Style

Hou, Fu, Yinyu Jin, Jin Hu, Lingna Kong, Xiaoxue Liu, Liping Xing, Aizhong Cao, and Ruiqi Zhang. 2024. "Transferring an Adult-Plant Stripe-Rust Resistance Gene Yr7VS from Chromosome 7V of Dasypyrum villosum (L.) to Bread Wheat" Plants 13, no. 13: 1875. https://doi.org/10.3390/plants13131875

APA Style

Hou, F., Jin, Y., Hu, J., Kong, L., Liu, X., Xing, L., Cao, A., & Zhang, R. (2024). Transferring an Adult-Plant Stripe-Rust Resistance Gene Yr7VS from Chromosome 7V of Dasypyrum villosum (L.) to Bread Wheat. Plants, 13(13), 1875. https://doi.org/10.3390/plants13131875

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop