Study of the Floristic, Morphological, and Genetic (atpF–atpH, Internal Transcribed Spacer (ITS), matK, psbK–psbI, rbcL, and trnH–psbA) Differences in Crataegus ambigua Populations in Mangistau (Kazakhstan)
Abstract
1. Introduction
2. Methods
2.1. Study Area
2.2. Plant Materials
2.3. Floristic Analysis
2.4. Genetic Analysis
2.5. Statistical Processing
3. Results
3.1. Floristic Analysis of C. ambigua Populations
3.2. Age Composition of C. ambigua in the Populations
3.3. Morphological Structure of C. ambigua Populations
3.4. Genetic Analysis of C. ambigua Populations
- matK: Shannon index: 1.334, Simpson index: 0.724. Moderately high nucleotide diversity.
- psbK–psbI: Shannon index: 1.303, Simpson index: 0.695. Moderate nucleotide diversity, slightly lower than matK.
- rbcL: Shannon index: 1.406, Simpson index: 0.749, The highest nucleotide diversity among all groups.
- trnH–psbA: Shannon index: 1.192, Simpson index: 0.650, The lowest nucleotide diversity among all groups.
- atpF–atpH: Shannon index: 1.345, Simpson index: 0.710, Moderately high nucleotide diversity.
- ITS: Shannon index: 1.394, Simpson index: 0.739. High nucleotide diversity, comparable to rbcL.
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Letukhova, V.Y.; Potapenko, I.L.; Fedoronchuk, M.M. Taxonomic analysis of some species of the Crataegus (Rosaceae) from the flora of Crimea. Ukr. Bot. J. 2014, 71, 182–187. [Google Scholar] [CrossRef] [Scilit]
- Poletiko, O.M. Hawthorn—Crataegus L. In Trees and Shrubs of the USSR; USSR Academy of Sciences: Saint Petersburg, Russia, 1954; Volume T.3, pp. 514–577. [Google Scholar]
- Rusanov, F.N. Introduced hawthorns of the botanical garden of the Academy of Sciences of the UzSSR. Dendrol. Uzb. 1965, 1, 8–254. (In Russian) [Google Scholar]
- Chang, Q.; Zuo, Z.; Harrison, F.; Chow MS, S. Hawthorn. J. Clin. Pharmacol. 2002, 42, 605–612. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kristafovich, A.N. Paleobotany. Science 1957, T.1, 594. [Google Scholar]
- Alekhin, V.V.; Kudryasheva, L.V.; Govorukhin, V.S. Geography of Plants with Basics of Botany; Uchpedgiz: Saint Petersburg, Russia, 1957; 519p. [Google Scholar]
- Zhukovsky, P.M. Cultivated Plants and Their Relatives; Kolos: Moscow, Russia, 1964; 792p. [Google Scholar]
- Wulf, E.V. Introduction to the Historical Geography of Plants; USSR Academy of Sciences: Saint Petersburg, Russia, 1933; 414p. [Google Scholar]
- Rusanov, F.N. History of the development of the river Crataegus L. In Introduction and Acclimation of Plants; Fan: Tashkent, Uzbekistan, 1970; pp. 20–28. [Google Scholar]
- Tsinovskis, R.E. Hawthorns of the Balkhash Region; Zinatne: Riga, Latvia, 1971; 384p. [Google Scholar]
- Boboreko, E.Z. Hawthorn; Science and Technology: Minsk, Belarus, 1974; 222p. [Google Scholar]
- Baytenov, M.S. Flora of Kazakhstan; Gylym: Almaty, Kazakhstan, 2001; 280p. [Google Scholar]
- Sokolov, S.Y.; Svyazeva, O.A. Geography of Woody Plants USSR; Nauka: Moscow, Russia, 1965; 265p. [Google Scholar]
- Kriissmann, G. Die Laubgeholze Aiifgabe; Verlag Parey: Berlin, Germany, 1951; pp. 118–125. [Google Scholar]
- Komorov, V.L. Flora of the U.S.S.R.; USSR Academy of Sciences: Saint Petersburg, Russia, 1939; Volume 9, pp. 416–468. (In Russian) [Google Scholar]
- Pavlov, N.V. Flora of Kazakhstan; Science: Almaty, Kazakhstan, 1961; Volume T.4, 410p. [Google Scholar]
- Ryabushkina, N.; Gemedjieva, N.; Kobaisy, M.; Cantrell, C.L. Brief review of Kazakhstan flora and use of its wild species. Asian Australas. J. Plant Sci. Biotechnol. 2008, 2, 64–71. [Google Scholar]
- Kubentayev, S.A.; Alibekov, D.T.; Perezhogin, Y.V.; Lazkov, G.A.; Kupriyanov, A.N.; Ebel, A.L.; Izbastina, K.S.; Borodulina, O.V.; Kubentayeva, B.B. Revised checklist of endemic vascular plants of Kazakhstan. PhytoKeys 2024, 238, 241–279. [Google Scholar] [CrossRef] [Scilit]
- Bikov, B.K. Red Book of Kazakhstan; Science: Almaty, Kazakhstan, 1981; Volume T.2, 99p. [Google Scholar]
- Aralbay, N.K.; Kudabaeva, G.M.; Imanbaeva, A.A. Catalog of Rare and Endangered Plant Species of the Mangystau Region (Red Book); Science: Almaty, Kazakhstan, 2006; 32p. [Google Scholar]
- Safronova, I.N. Deserts of Mangyshlak (essay on vegetation). Proc. Bot. Inta RAS 1996, 18, 211. [Google Scholar]
- Kisykov, U.K. Materials on the Flora of Mountain Mangyshlak; Tr. Institute of Botany An KazSSR: Almaty, Kazakhstan, 1955; Volume T.1, pp. 84–117. [Google Scholar]
- Sumbembayev, A.A.; Abugalieva, S.I.; Danilova, A.N.; Matveyeva, E.V.; Szlachetko, D.L. Flower morphometry of members of the genus Dactylorhiza Necker ex Nevski (Orchidaceae) from the Altai Mountains of Kazakhstan. Biodiversitas 2021, 22, 3545–3555. [Google Scholar] [CrossRef] [Scilit]
- Romanovich, V.V. Towards the Use of Elements of Wild Flora for Landscaping Industrial Centers and Settlements of the Mangyshlak Peninsula; Science: Almaty, Kazakhstan, 1969; Volume T.18, 187p. [Google Scholar]
- Cherepanov, S.K. Vascular Plants of the USSR; Science: Leningrad, Russia, 1981; 509p. [Google Scholar]
- Lyubimov, V.B. On the question of taxonomy of Crataegus trancaspica A. Pojark. In Bulletin of the Main Botanical Garden; Nauka: Moscow, Russia, 1989; pp. 47–50. [Google Scholar]
- Imanbaeva, A.A.; Ishmuratova, M.Y.; Tuyakova, A.T. Screening of Mangystau flora for wild relatives of cultivated plants. Cent. Eur. J. Bot. 2015, 1, 12–20. [Google Scholar] [CrossRef] [Scilit]
- Pavlov, N.B. Flora of Kazakhstan; Publishing House of the Kazakh Academy of Sciences: Almaty, Kazakhstan, 1956; Volume 1, 347p. [Google Scholar]
- Duysenova, N.I.; Imanbaeva, A.A.; Tuyakova, A.T.; Kopbaeva, G.B. The age composition of populations of Crataegus ambigua in the natural conditions of Mangyshlak. Bull. Karaganda Univ. 2017, 1, 29–34. [Google Scholar]
- Dönmez, A.A. The genus Crataegus L. (Rosaceae) with special reference to hybridisation and biodiversity in Turkey. Turk. J. Bot. 2004, 28, 29–37. [Google Scholar]
- Zargar, M.; Dyussibayeva, E.; Orazov, A.; Zeinullina, A.; Zhirnova, I.; Yessenbekova, G.; Rysbekova, A. Microsatellite-based genetic diversity analysis and population structure of Proso Millet (Panicum miliaceum L.) in Kazakhstan. Agronomy 2023, 13, 2514. [Google Scholar] [CrossRef] [Scilit]
- Zeinullina, A.; Zargar, M.; Dyussibayeva, E.; Orazov, A.; Zhirnova, I.; Yessenbekova, G.; Zotova, L.; Rysbekova, A.; Hu, Y.G. Agro-Morphological Traits and Molecular Diversity of Proso Millet (Panicum miliaceum L.) Affected by Various Colchicine Treatments. Agronomy 2023, 13, 2973. [Google Scholar] [CrossRef] [Scilit]
- Orazov, A.; Yermagambetova, M.; Myrzagaliyeva, A.; Mukhitdinov, N.; Tustubayeva, S.; Turuspekov, Y.; Almerekova, S. Plant height variation and genetic diversity between Prunus ledebouriana (Schlecht.) YY Yao and Prunus tenella Batsch based on using SSR markers in East Kazakhstan. PeerJ 2024, 12, e16735. [Google Scholar] [CrossRef] [Scilit]
- Hebert, P.D.; Cywinska, A.; Ball, S.L.; de Waard, J.R. Biological identifications through DNA barcodes. Proc. Biol. Sci. 2003, 270, 313–321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kress, W.J.; Erickson, D.L. A two-locus global DNA barcode for land plants: The coding rbcL gene complements the non-coding trnH–psbA spacer region. PLoS ONE 2007, 2, e508. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kress, W.J.; Erickson, D.L. DNA barcodes: Methods and protocols. Methods Mol. Biol. 2012, 858, 3–8. [Google Scholar]
- Chase, M.W.; Salamin, N.; Wilkinson, M.; Dunwell, J.M.; Kesanakurthi, R.P.; Haider, N.; Savolainen, V. Land plants and DNA barcodes: Short-term and long-term goals. Philos. Trans. R. Soc. Lond B Biol. Sci. 2005, 360, 1889–1895. [Google Scholar] [CrossRef] [Scilit]
- Lahaye, R.; van der Bank, M.; Bogarin, D.; Warner, J.; Pupulin, F.; Gigot, G.; Maurin, O.; Duthoit, S.; Barraclough, T.G.; Savolainen, V. DNA barcoding the floras of biodiversity hotspots. Proc. Natl. Acad. Sci. USA 2008, 105, 2923–2928. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, S.; Yao, H.; Han, J.; Liu, C.; Song, J.; Shi, L.; Zhu, Y.; Ma, X.; Gao, T.; Pang, X.; et al. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS ONE 2010, 5, e8613. [Google Scholar] [CrossRef] [Scilit]
- Matveeva, T.V.; Pavlova, O.A.; Bogomaz, D.I.; Demkovič, L.A.; Lutova, A.E. Molecular markers for visual identification and plant phylogenetics. Ecol. Genet. 2011, 9, 32–43. [Google Scholar] [CrossRef] [Scilit]
- Nieto Feliner, G.; Rosselló, J.A. Better the devil you know? Guidelines for insightful utilization of nrDNA ITS in species-level evolutionary studies in plants. Mol. Phylogenet. Evol. 2007, 44, 911–919. [Google Scholar] [PubMed]
- Schultz, J.; Müller, T.; Achtziger, M.; Seibel, P.N.; Dandekar, T.; Wolf, M. The internal transcribed spacer 2 database—A web server for (not only) low level phylogenetic analyses. Nucleic. Acids Res. 2006, 34, W704–W707. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patwardhan, A.; Ray, S.; Roy, A. Molecular Markers in Phylogenetic Studies—A Review. J. Phylogen. Evolution. Biol. 2014, 2, 131. [Google Scholar]
- Orazov, A.; Myrzagaliyeva, A.; Mukhitdinov, N.; Tustubayeva, S. Callus induction with 6-BAP and IBA as a way to preserve Prunus ledebouriana (Rosaceae), and endemic plant of Altai and Tarbagatai, East Kazakhstan. Biodiversitas J. Biol. Divers. 2022, 23, 3178–3184. [Google Scholar] [CrossRef] [Scilit]
- Koshim, A.G.; Sergeyeva, A.M.; Bexeitova, R.T.; Aktymbayeva, A.S. Landscape of the Mangystau region in Kazakhstan as a geomorphotourism destination: A geographical review. Geo J. Tour. Geosites 2020, 29, 385–397. [Google Scholar]
- Sagyndykova, M.; Imanbayeva, A.; Gassanova, G.; Ishmuratova, M. Current Status and Resources of Alhagi pseudalhagi (Fabaceae) in the Atyrau Region, Western Kazakhstan. Diversity 2024, 16, 219. [Google Scholar] [CrossRef] [Scilit]
- Smirnova, O.V.; Zaugolnova, L.B.; Ermakova, I.M. Cenopopulation of Plants; Science Publishing House: Moscow, Russia, 1976; p. 217. [Google Scholar]
- Kamelin, R.V. Key to Plants of Central Asia. A Critical Abstract of Flora; Science Publishing House: Leningrad, Russia, 2015; Volume 11. [Google Scholar]
- International Plant Names Index. Available online: www.ipni.org (accessed on 30 January 2024).
- Serebryakov, I.G. Ecological Morphology of Plants. Life Forms of the Overgrowths and Conifers; High School: Moscow, Russia, 1982; 380p. (In Russian) [Google Scholar]
- Shay, J.E.; Pennington, L.K.; Mandussi Montiel-Molina, J.A.; Toews, D.J.; Hendrickson, B.T.; Sexton, J.P. Rules of plant species ranges: Application for conservation strategies. Front. Ecol. Evol. 2021, 9, 700962. [Google Scholar] [CrossRef] [Scilit]
- Kew Royal Botanical Garden. Plants of the World Online. Available online: www.powo.science.kew.org (accessed on 30 January 2024).
- Komarov, A.S.; Palenova, M.M.; Smirnova, O.V. The concept of discrete description of plant ontogenesis and cellular automata models of plant populations. Ecol. Model. 2003, 170, 427–439. [Google Scholar] [CrossRef] [Scilit]
- Fedorova, S.V. Methodological approaches in population botany and plant ecology. Am. J. BioSci. 2020, 8, 73–90. [Google Scholar] [CrossRef] [Scilit]
- Doyle, J.J.; Doyle, J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 1987, 19, 11–15. [Google Scholar]
- Maniatis, T.; Fritsch, E.E.; Sambrook, J. Molecular Cloning; A laboratory manual; Cold Spring Harbor Laboratory: New York, NY, USA, 1982; p. 545. [Google Scholar]
- Rogers, S.O.; Bendich, A.J. Extraction of DNA from milligram amounts of fresh, herbarium, and mummified plant tissues. Plant Mol. Biol. 1985, 5, 69–76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sanger, F.; Nicklen, S.; Coulson, A.R. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 1977, 74, 5463–5467. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- BLAST. Available online: https://blast.ncbi.nlm.nih.gov (accessed on 30 January 2024).
- Yamada, K.; Tomii, K. Revisiting amino acid substitution matrices for identifying distantly related proteins. Bioinformatics 2014, 30, 317–325. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, S.; Gadagkar, S.R. Disparity index: A simple statistic to measure and test the homogeneity of substitution patterns between molecular sequences. Genetics 2001, 158, 1321–1327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuziev, R.K.; Sektimenko, V.E. Soils of Uzbekistan; Extremum Press Publishing House: Tashkent, Uzbekistan, 2009; p. 351. (In Russian) [Google Scholar]
- Kuziev, R.K.; Yuldashev, G.Y.U.; Akramov, I.A. Bonitization of Soils; The Way of Science Publishing House: Tashkent, Uzbekistan, 2004; p. 127. [Google Scholar]
- Joshi, S.P.; Gupta, V.S.; Aggarwal, R.K.; Ranjekar, P.K.; Brar, D.S. Genetic diversity and phylogenetic relationship revealed by intersimple sequence repeat (ISSR) polymorphism in the genus Oryza. Theor. Appl. Genet. 2000, 100, 1311–1320. [Google Scholar] [CrossRef] [Scilit]
- Rohlf, F. NTSYSpc: Numerical Taxonomy and Multivariate Analysis System, Version 2.02; Exeter Software: Setauket, NY, USA, 1998. [Google Scholar]
- Phipps, J.B. Biogeographic, taxonomic, and cladistic relationships between East Asiatic and North American Crataegus. Ann. Mo. Bot. Gard. 1983, 70, 667–700. [Google Scholar] [CrossRef] [Scilit]
- Duisenova, N.I.; Imanbayeva, A.A.; Ishmuratova, M.Y. The study of the state and structure of populations of rare plant of mangyshlak crataegus ambigua CA Mey ex A. Beck. Ecol. Environ. Conserv. 2016, 22, 2087–2093. [Google Scholar]
- Hamzeh’ee, B.; Attar, F.; Assareh, M.H.; Maassoumi, A.A.; Kazempour Osaloo, S.; Christensen, K.I. Taxonomic notes on Crataegus, ser. Crataegus, subser. Erianthae (Rosaceae), new species and record, using morphology and micromorphological evidence. Nord. J. Bot. 2014, 32, 26–37. [Google Scholar] [CrossRef] [Scilit]
- Sharifnia, F.; Seyedipour, N.; Mehregan, I.; Salimpour, F. Phylogenetic study some of Crataegus L. (Rosaceae, Pyreae) species in Iran. J. Biodivers. Environ. Sci. 2013, 3, 1–11. [Google Scholar]
- Yermagambetova, M.; Almerekova, S.; Turginov, O.; Sultangaziev, O.; Abugalieva, S.; Turuspekov, Y. Genetic Diversity and Population Structure of Juniperus seravschanica Kom. Collected in Central Asia. Plants 2023, 12, 2961. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baibagyssov, A.; Thevs, N.; Nurtazin, S.; Waldhardt, R.; Beckmann, V.; Salmurzauly, R. Biomass resources of Phragmites australis in Kazakhstan: Historical developments, utilization, and prospects. Resources 2020, 9, 74. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Tariq, A.; Hughes, A.C.; Hong, D.; Wei, F.; Sun, H.; Sardans, J.; Peñuelas, J.; Perry, G.; Qiao, J.; et al. Challenges and solutions to biodiversity conservation in arid lands. Sci. Total Environ. 2023, 857, 159695. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Orazov:, A.; Tustubayeva, S.; Alemseytova, J.; Mukhitdinov, N.; Myrzagaliyeva, A.; Turuspekov, Y.; Sramko, G. Flora accompanying Prunus ledebouriana (Schltdl.) YY Yao in the Tarbagatai State National Park in Kazakhstan. Int. J. Biol. Chem. 2021, 14, 21–34. [Google Scholar] [CrossRef] [Scilit]











| Populations | Name | Geographical Location | Coordinates | Altitude |
|---|---|---|---|---|
| Pop 1 | Sultan Epe | Sultan Epe Gorge (Tyubkaragan Peninsula) | 44°25′85.7″ N 50°58′30.7″ E | 172 m |
| Pop 2 | Karakozaiym | Karakozayim Gorge (Tyubkaragan Peninsula) | 44°27′41.8″ N 50.37′71.5″ E | 136 m |
| Pop 3 | Emdikorgan | Emdikorgan Gorge (Northern Aktau Ridge) | 44°28′62.8″ N 51°25′25.4″ E | 35 m |
| Pop 4 | Samal | Samal Gorge (Western Karatau Ridge) | 44°07′43.6″ N 51°35′41.8″ E | 247 m |
| Name | Sequence 5′–3′ | Locus for Barcode |
|---|---|---|
| atpF | ACTCGCACACACTCCCTTTCC | atpF–atpH |
| atpH | GCTTTTATGGAAGCTTTAACAAT | atpF–atpH |
| ITS4 | TCCTCCGCTTATTGATATGC | ITS1 and ITS2 |
| ITS5 | GGAAGTAAAAGTCGTAACAAG | ITS1 and ITS2 |
| 3F_KIMf | CGTACAGTACTTTTGTGTTTACGAG | matK |
| 1R_KIMr | ACCCCATTCATCTGGAAATCTTGGTTC | matK |
| psbK | TTAGCCTTTGTTTGGCAAG | psbK–psbI |
| psbI | AGAGTTTGAGAGTAAGCAT | psbK–psbI |
| rbcLa_F | ATGTCACCACAAACAGAGACTAAAGC | rbcL |
| rbcLa_R | GTAAAATCAAGTCCACCRCG | rbcL |
| psbA3f | GTTATGCATGAACGTAATGCTC | trnH–psbA |
| trnHf_05 | CGCGCATGGTGGATTCACAATCC | trnH–psbA |
| Population | Co-Dominant Species | Tree Species | Shrub Species | Herbaceous Species |
|---|---|---|---|---|
| Pop 1 | Morus alba | Crataegus ambigua, Morus alba, Morus nigra, Salix alba, Elaeagnus angustifolia | Caragana grandiflora, Rhamnus sintenesii, Nanophyton erinaceum, Artemisia lercheana, Atraphaxis replicata, Limonium suffriticosum, Salsola arbuscula | Cardaria draba, Chorispora tenella, Psathyrostachys juncens, Poa bulbosa, Eremopyrum triticeum, E. orientale, Veronica amoema, Ceratocephala testiculata, Descurainia sophia, Allium sabulosum, Gypsophila alsinoides, Petrosimonia glaucescens, Androsace maxima, Scorzonera pusilla, Sisimbrium loeselii, Camelina sylvestris, Nonnea caspia, Juncus bufonius, Teucrium polium, Sinaps arvensis, Asparagus persicus, Galium aparine, Malva pusila, Marrubium vulgare, Equisetum ramosissima, Potentilla supine/ |
| Pop 2 | Herba varia | Crataegus ambigua, Morus alba | Rhamnus sintenesii, Caragana grandiflora, Rubus caesius, Reaumuria fruticosa | Onopordum acanthium, Allium sabulosum, Lagochilus acutilobus, Haplophyllum obtusifolim, Onosma staminea, Alopecurus arundinaceus, Ceratocephala testiculata, Crambe edentula, Poa bulbosa, Eremopyrum orientale, Alyssum desertorum, A. turkestanicum, Androsace maxima, Tragopogon ruber, Chorispora tenella, Salsola australis, Nonea caspica, Gagea peticulata, Lepidium ruderale, Bromus squarrosus, Minuartia regeliana, Fumaria parviflora, Veronica amoema, Lappula sinaica, Mentha longifolia, Potentilla transcaspia, Equisetum ramosissima, Galium humifusum, Cardaria draba, Descurainia sophia/ |
| Pop 3 | Rhamnus sintenesii | Crataegus ambigua | Rhamnus sintenesii, Tamarix | Falcaria vulgaris, Galium aparine, Haplophyllum bungee, Ixiolirion tataricum, Linaria leptoceras, Marrubium vulgare, Meniocus linifolius, Lepidium perfoliatum, Mentha longifolia, Onosma stamineum, Poa bulbosa, Prangos odontalgica/ |
| Pop 4 | Mentha longifolia | Crataegus ambigua, Elaeagnus angustifolia, Ulmus pumila | Crataegus ambigua, Rhamnus sintenesii, Caragana grandiflora | Mentha longifolia, Teucrium polium, Marrubium vulgare, Nepeta cataria, Centaurea squarossa, Cousinia onopordioides, Verbascum songaricum, Verbascum blattaria, Plantago lanceolata, Inula britanica, Medicago caerulea, Malva pusila, Equisetum ramosissimum, Rubus caesius, Stellaria media, Phragmites communis, Artemisia terrae-albae, Artemisia gurganica, Tanacetum santolina, Ephedra distachya, Echinops ritro, Alhagi pseudalhagi, Acanthophyllum pungens, Meristotropis triphylla, Stipa caspia, S. caucasica, Agropyron fragile, Poa bulbosa/ |
| Populations | Total Copies, Pcs. | Age | |||||||
|---|---|---|---|---|---|---|---|---|---|
| Juveniles | Virginia | Young Generative | Adult Generative | ||||||
| Pcs. | % | Pcs. | % | Pcs. | % | Pcs. | % | ||
| Pop 1 | 415 | 89 | 21.4 | 34 | 8.2 | 175 | 42.2 | 117 | 28.2 |
| Pop 2 | 130 | 35 | 26.9 | 3 | 2.3 | 88 | 67.7 | 4 | 3.1 |
| Pop 3 | 55 | 15 | 27.27 | 11 | 20.00 | 22 | 40.00 | 7 | 12.73 |
| Pop 4 | 104 | 16 | 15.3 | 12 | 11.5 | 44 | 42.3 | 32 | 30.7 |
| Morphological Parameters | Pop 1 (Mean/SD/CV) | Pop 2 (Mean/SD/CV) | Pop 3 (Mean/SD/CV) | Pop 4 (Mean/SD/CV) |
|---|---|---|---|---|
| Plant height (V) | 185/13.2//0.07 | 126.7/25.2/0.20 | 170/10/0.06 | 136.7/15.3/0.1 |
| Plant height (YG) | 246.7/25.2/0.10 | 260/10/0.04 | 273.3/37.9/0.14 | 250/20/0.08 |
| Plant height (AG) | 400/20/0.05 | 426.7/5.8/0.01 | 450/50/0.11 | 456.7/11.5/0.03 |
| Plant crown diameter (V) | 126.7/14.4/0.11 | 80/17.3/0.22 | 101.7/7.6/0.08 | 81.7/7.6/0.09 |
| Plant crown diameter (YG) | 206.7/20.8/0.10 | 263.3/32.1/0.12 | 276.7/25.2/0.09 | 260/36.1/0.14 |
| Plant crown diameter (AG) | 423.3/45.1/0.11 | 373.3/41.6/0.11 | 363.3/15.3/0.04 | 450/50/0.11 |
| Plant trunk height (V) | 30/5/0.17 | 35/8.7/0.25 | 31/3.6/0.12 | 33.3/12.6/0.38 |
| Plant trunk height (YG) | 54.3/4.04/0.07 | 73.3/7.6/0.10 | 53.3/3.51/0.07 | 56.3/5.5/0.10 |
| Plant trunk height (AG) | 80.7/9.02/0.11 | 64.3/6.03/0.09 | 71/3.61/0.05 | 90/5/0.06 |
| Plant trunk diameter (V) | 10/0.5/0.05 | 9.3/0.58/0.06 | 9.5/1.32/0.14 | 11.7/4.16/0.36 |
| Plant trunk diameter (YG) | 15.1/0.32/0.02 | 12.2/1.26/0.10 | 13.3/1.26/0.09 | 15.3/1.5/0.10 |
| Plant trunk diameter (AG) | 19.3/3.51/0.18 | 16.3/1.53/0.09 | 14.2/0.76/0.05 | 14.3/2.08/0.15 |
| Spike size (V) | 1.07/0.21/0.20 | 0.87/0.15/0.18 | 0.9/0.1/0.11 | 0.9/0.1/0.11 |
| Spike size (YG) | 1.1/0.1/0.09 | 1.07/0.15/0.14 | 1.1/0.3/0.27 | 0.93/0.15/0.16 |
| Leaf length (V) | 3.53/0.72/0.21 | 3.53/0.61/0.17 | 3.15/0.58/0.18 | 3.66/0.69/0.19 |
| Leaf length (YG) | 3.46/0.68/0.20 | 4.15/0.76/0.18 | 3.07/0.48/0.16 | 3.67/0.60/0.16 |
| Leaf length (AG) | 5.11/0.57/0.11 | 4.02/0.42/0.10 | 3.47/0.48/0.14 | 3.68/0.84/0.23 |
| Leaf width (V) | 3.11/0.40/0.13 | 3.01/0.41/0.14 | 2.4/0.75/0.31 | 3.77/0.62/0.16 |
| Leaf width (YG) | 2.91/0.41/0.14 | 3.75/0.76/0.20 | 2.52/0.57/0.23 | 3.09/0.41/0.13 |
| Leaf width (AG) | 4.84/0.54/0.11 | 3.85/0.37/0.10 | 2.35/0.70/0.30 | 3.13/0.49/0.16 |
| Leaf petiole length (V) | 1.62/0.58/0.35 | 2.01/0.39/0.19 | 1.21/0.28/0.23 | 1.92/0.34/0.17 |
| Leaf petiole length (YG) | 1.7/0.45/0.27 | 1.6/0.39/0.25 | 1.38/0.23/0.17 | 1.91/0.54/0.28 |
| Leaf petiole length (AG) | 1.82/0.70/0.39 | 1.77/0.41/0.23 | 1.42/0.34/0.24 | 2.05/0.58/0.28 |
| Leaf area (V) | 9.7/1.26/0.13 | 10.38/1.45/0.14 | 10.971/1.34/0.12 | 9.79/1.82/0.19 |
| Leaf area (YG) | 11.1/1.53/0.14 | 12.81/2.37/0.19 | 14.95/3.15/0.21 | 13.21/1.93/0.15 |
| Leaf area (AG) | 13.9/1.72/0.12 | 14.24/3.14/0.22 | 13.8/2.19/0.16 | 15.87/1.44/0.09 |
| Morphological Parameters | Pop 1 (Mean/SD/CV) | Pop 2 (Mean/SD/CV) | Pop 3 (Mean/SD/CV) | Pop 4 (Mean/SD/CV) |
|---|---|---|---|---|
| Inflorescence diameter (YG) | 4.97/0.52/0.10 | 4.39/0.80/0.18 | 4.39/0.73/0.17 | 4.52/1.13/0.25 |
| Inflorescence diameter (AG) | 5.83/0.48/0.08 | 5.3/0.78/0.15 | 6.21/0.75/0.12 | 5.5/0.63/0.11 |
| Number of flowers on one inflorescence (YG) | 7.6/1.26/0.17 | 14.8/0.79/0.05 | 8.2/1.81/0.22 | 15.6/2.37/0.15 |
| Number of flowers on one inflorescence (AG) | 14.4/2.22/0.15 | 14.4/1.78/0.12 | 14.3/3.20/0.22 | 19.1/2.13/0.11 |
| Number of inflorescences on one branch (YG) | 14.4/1.71/0.12 | 11.3/3.71/0.33 | 12.2/2.86/0.23 | 42.8/6.94/0.16 |
| Number of inflorescences on one branch (AG) | 27.7/3.59/0.13 | 35.6/7.41/0.21 | 29.6/8.77/0.30 | 83.5/13.24/0.16 |
| Pedicel length (YG) | 4.46/1.00/0.22 | 6.35/1.97/0.31 | 5.49/1.12/0.20 | 5.92/1.76/0.30 |
| Pedicel length (AG) | 5.12/0.60/0.12 | 6.52/2.20/0.34 | 5.46/1.32/0.24 | 7.33/2.14/0.29 |
| Flower diameter (YG) | 13.45/1.45/0.11 | 14.58/1.47/0.10 | 14.29/1.79/0.13 | 15.93/1.23/0.08 |
| Flower diameter (AG) | 16.21/1.31/0.08 | 15.01/1.52/0.10 | 14.83/1.42/0.10 | 16.58/1.08/0.06 |
| Fruit weight (YG) | 0.672/0.20/0.30 | 0.943/0.21/0.23 | 1.102/0.17/0.16 | 1.122/0.14/0.13 |
| Fruit weight (AG) | 0.977/0.21/0.21 | 1.102/0.19/0.17 | 1.07/0.14/0.13 | 1.169/0.13/0.11 |
| Fruit length (YG) | 1.408/0.27/0.19 | 1.071/0.10/0.10 | 1.06/0.08/0.08 | 1.163/0.06/0.05 |
| Fruit length (AG) | 1.503/0.28/0.18 | 1.435/0.21/0.14 | 1.068/0.13/0.12 | 1.14/0.11/0.09 |
| Fruit width (YG) | 1.532/0.36/0.24 | 0.958/0.14/0.14 | 1.082/0.12/0.12 | 1.11/0.08/0.07 |
| Fruit width (AG) | 1.07/0.05/0.04 | 1.202/0.08/0.07 | 1.002/0.12/0.12 | 1.20/0.08/0.07 |
| Number of seeds (YG) | 1.6/0.52/0.32 | 1.6/0.52/0.32 | 1.8/0.63/0.35 | 1.6/0.52/0.32 |
| Number of seeds (AG) | 1.6/0.52/0.32 | 1.6/0.52/0.32 | 1.6/0.52/0.32 | 1.6/0.52/0.32 |
| Seed mass (YG) | 0.255/0.06/0.22 | 0.173/0.05/0.29 | 0.152/0.05/0.31 | 0.116/0.03/0.25 |
| Seed mass (AG) | 0.149/0.06/0.39 | 0.183/0.05/0.28 | 0.132/0.03/0.25 | 0.121/0.03/0.23 |
| Genetic Markers | Length | Conserved Sites | Variable Sites | Singletons |
|---|---|---|---|---|
| atpF–atpH | 414 | 408 | 0 | 0 |
| ITS | 332 | 328 | 2 | 2 |
| matK | 570 | 570 | 0 | 0 |
| psbK–psbI | 193 | 185 | 7 | 6 |
| rbcL | 497 | 493 | 0 | 0 |
| trnH–psbA | 270 | 270 | 0 | 0 |
| Nucleotide | Pop 1 | Pop 2 | Pop 3 | Pop 4 | Avg. |
|---|---|---|---|---|---|
| atpF–atpH | |||||
| T(U) | 37.7 | 37.3 | 37.5 | 37.5 | 37.5 |
| C | 12.8 | 12.3 | 12.7 | 12.7 | 12.7 |
| A | 34.0 | 33.9 | 33.8 | 33.8 | 33.9 |
| G | 15.5 | 16.5 | 15.9 | 15.9 | 16.0 |
| Total | 406 | 413 | 408 | 408 | 408.8 |
| ITS | |||||
| T(U) | 19.4 | 19.4 | 19.8 | 19.7 | 19.6 |
| C | 32.4 | 32.4 | 32.8 | 32.4 | 32.5 |
| A | 18.5 | 18.5 | 18.2 | 18.5 | 18.4 |
| G | 29.7 | 29.7 | 29.2 | 29.4 | 29.5 |
| Total | 330 | 330 | 329 | 330 | 329.8 |
| matK | |||||
| T(U) | 30.4 | 30.4 | 30.4 | 30.4 | 30.4 |
| C | 18.1 | 18.1 | 18.1 | 18.1 | 18.1 |
| A | 35.3 | 35.3 | 35.3 | 35.3 | 35.3 |
| G | 16.3 | 16.3 | 16.3 | 16.3 | 16.3 |
| Total | 570 | 570 | 570 | 570 | 570 |
| psbK–psbI | |||||
| T(U) | 43.5 | 43.8 | 44.0 | 44.0 | 43.8 |
| C | 13.5 | 14.1 | 13.6 | 13.6 | 13.7 |
| A | 27.5 | 27.6 | 27.7 | 27.7 | 27.6 |
| G | 15.5 | 14.6 | 14.7 | 14.7 | 14.9 |
| Total | 193 | 192 | 191 | 191 | 191.8 |
| rbcL | |||||
| T(U) | 29.6 | 29.4 | 29.6 | 29.6 | 29.6 |
| C | 21.3 | 21.1 | 21.3 | 21.3 | 21.3 |
| A | 26.6 | 27.0 | 26.6 | 26.6 | 26.7 |
| G | 22.5 | 22.5 | 22.5 | 22.5 | 22.5 |
| Total | 493 | 497 | 493 | 493 | 494 |
| trnH–psbA | |||||
| T(U) | 33.3 | 33.2 | 33.2 | 33.3 | 33.3 |
| C | 13.3 | 13.4 | 13.4 | 13.3 | 13.4 |
| A | 46.7 | 47.0 | 47.0 | 46.7 | 46.8 |
| G | 6.7 | 6.3 | 6.3 | 6.7 | 6.5 |
| Total | 270 | 268 | 268 | 270 | 269 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Imanbayeva, A.; Duisenova, N.; Orazov, A.; Sagyndykova, M.; Belozerov, I.; Tuyakova, A. Study of the Floristic, Morphological, and Genetic (atpF–atpH, Internal Transcribed Spacer (ITS), matK, psbK–psbI, rbcL, and trnH–psbA) Differences in Crataegus ambigua Populations in Mangistau (Kazakhstan). Plants 2024, 13, 1591. https://doi.org/10.3390/plants13121591
Imanbayeva A, Duisenova N, Orazov A, Sagyndykova M, Belozerov I, Tuyakova A. Study of the Floristic, Morphological, and Genetic (atpF–atpH, Internal Transcribed Spacer (ITS), matK, psbK–psbI, rbcL, and trnH–psbA) Differences in Crataegus ambigua Populations in Mangistau (Kazakhstan). Plants. 2024; 13(12):1591. https://doi.org/10.3390/plants13121591
Chicago/Turabian StyleImanbayeva, Akzhunis, Nurzhaugan Duisenova, Aidyn Orazov, Meruert Sagyndykova, Ivan Belozerov, and Ainur Tuyakova. 2024. "Study of the Floristic, Morphological, and Genetic (atpF–atpH, Internal Transcribed Spacer (ITS), matK, psbK–psbI, rbcL, and trnH–psbA) Differences in Crataegus ambigua Populations in Mangistau (Kazakhstan)" Plants 13, no. 12: 1591. https://doi.org/10.3390/plants13121591
APA StyleImanbayeva, A., Duisenova, N., Orazov, A., Sagyndykova, M., Belozerov, I., & Tuyakova, A. (2024). Study of the Floristic, Morphological, and Genetic (atpF–atpH, Internal Transcribed Spacer (ITS), matK, psbK–psbI, rbcL, and trnH–psbA) Differences in Crataegus ambigua Populations in Mangistau (Kazakhstan). Plants, 13(12), 1591. https://doi.org/10.3390/plants13121591

