Next Article in Journal
Metabolite Profiling to Evaluate Metabolic Changes in Genetically Modified Protopanaxadiol-Enriched Rice
Next Article in Special Issue
Marker-Assisted Improvement for Durable Bacterial Blight Resistance in Aromatic Rice Cultivar HUR 917 Popular in Eastern Parts of India
Previous Article in Journal
Do We Need to Breed for Regional Adaptation in Soybean?—Evaluation of Genotype-by-Location Interaction and Trait Stability of Soybean in Germany
Previous Article in Special Issue
Analysis of Domestication Loci in Wild Rice Populations
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Marker-Assisted Pyramiding of Blast-Resistance Genes in a japonica Elite Rice Cultivar through Forward and Background Selection

1
Council for Agricultural Research and Economics—Research Centre for Cereal and Industrial Crops, s.s. 11 to Torino, km 2.5, 13100 Vercelli, VC, Italy
2
Institute for Sustainable Plant Protection, National Research Council, Strada Delle Cacce 73, 10135 Turin, TO, Italy
3
Council for Agricultural Research and Economics—Research Centre for Vegetable and Ornamental Crops, Corso Inglesi 508, 18038 Sanremo, IM, Italy
4
Council for Agricultural Research and Economics—Research Centre for Genomics and Bioinformatics, Via S. Protaso 302, 29017 Fiorenzuola d’Arda, PC, Italy
5
Bertone Sementi S.P.A., Strada Cacciolo, 15030 Terruggia, AL, Italy
6
Council for Agricultural Research and Economics—Viticulture and Oenology, Viale Santa Margherita 80, 52100 Arezzo, AR, Italy
7
CIRAD, UMR PHIM TA A 120/K, Campus de Baillarguet, 34, CEDEX 5, 34398 Montpellier, France
8
Plant Health Institute of Montpellier (PHIM), University of Montpellier, CIRAD, INRAE, IRD, Montpellier SupAgro, 34, 34398 Montpellier, France
9
Dipartimento per lo Sviluppo Sostenibile e la Transizione Ecologica, Università del Piemonte Orientale, Piazza San Eusebio 5, 13100 Vercelli, VC, Italy
*
Authors to whom correspondence should be addressed.
Plants 2023, 12(4), 757; https://doi.org/10.3390/plants12040757
Submission received: 17 January 2023 / Revised: 1 February 2023 / Accepted: 6 February 2023 / Published: 8 February 2023
(This article belongs to the Special Issue Advances in Genetics and Breeding of Grain Crops)

Abstract

Rice blast, caused by Pyricularia oryzae, is one of the main rice diseases worldwide. The pyramiding of blast-resistance (Pi) genes, coupled to Marker-Assisted BackCrossing (MABC), provides broad-spectrum and potentially durable resistance while limiting the donor genome in the background of an elite cultivar. In this work, MABC coupled to foreground and background selections based on KASP marker assays has been applied to introgress four Pi genes (Piz, Pib, Pita, and Pik) in a renowned japonica Italian rice variety, highly susceptible to blast. Molecular analyses on the backcross (BC) lines highlighted the presence of an additional blast-resistance gene, the Pita-linked Pita2/Ptr gene, therefore increasing the number of blast-resistance introgressed genes to five. The recurrent genome was recovered up to 95.65%. Several lines carrying four (including Pita2) Pi genes with high recovery percentage levels were also obtained. Phenotypic evaluations confirmed the effectiveness of the pyramided lines against multivirulent strains, which also had broad patterns of resistance in comparison to those expected based on the pyramided Pi genes. The developed blast-resistant japonica lines represent useful donors of multiple blast-resistance genes for future rice-breeding programs related to the japonica group.

1. Introduction

Rice blast, caused by the ascomycete Pyricularia oryzae (synonym Magnaporthe oryzae, [1,2]), is one of the most damaging fungal diseases of rice at the World scale [3]. It causes lesions to all aerial parts of the plant, mainly leaves and panicles, resulting in yield losses, sometimes up to 100% under favorable environmental conditions [4] and equivalent to the food of 60 million people annually [5]. Most of the current European varieties show intermediate or low resistance to blast in field conditions; in particular, some traditional renowned Italian varieties currently cultivated, such as Carnaroli and Vialone Nano, are highly susceptible [6,7,8].
Blast disease control by chemicals increases production costs and impacts the environment, favoring the emergence and selection of new fungal strains resistant to fungicides. Furthermore, some molecules used in chemical control pose health issues that are subject to scrutiny by competent authorities. For example, the residues of tricyclazole were limited to 0.01 mg/kg of grains by EU ruling in 2017, resulting in the banning of its use. Recently, control agencies have also imposed a progressive reduction in chemical employment on the basis of Directive 2009/128/CE, encouraging researchers to develop alternative solutions.
The generation of resistant rice varieties, harboring blast-resistance (R) genes (Pi genes [7,9,10,11]), has gained a central role in breeding programs worldwide. To date, more than 146 blast Pi genes and 500 quantitative trait loci (QTLs) have been identified, and about 36 of them have been cloned [9,12,13,14], providing the opportunity to introgress two or more resistant loci into a unique line by means of the gene-pyramiding strategy [7,15,16,17]. This approach allows a broad-spectrum resistance to be obtained and the risk of resistance breakdown by the pathogen to be reduced [18,19,20].
An ideal pyramiding product should contain as little donor genome as possible in the genetic background of an elite recurrent variety. Recurrent backcrossing was a traditional breeding method employed to transfer alleles from a donor to an elite cultivar (cv), with an expected recurrent parent (RP) genome of 99.2% after at least six backcrosses [21,22]. An alternative approach to introgress genes of interest into an elite variety is Marker-Assisted BackCrossing (MABC), based on the combination of backcrosses and genetic screenings with molecular markers. In this way, it is possible to track the specific resistance loci in segregating populations avoiding phenotypic screening [23] and to recover the RP genome in less time (by three backcrosses) in comparison to conventional breeding [22,24,25,26]. In brief, two steps, i.e., foreground selection and background selection, are applied. Foreground selection consists of the analysis of specific markers associated (closely located or positioned inside) with the target genes, while background selection is based on dispersed markers throughout the genome for the recovery of the RP genetic background [27]. Several molecular markers associated with Pi genes have been developed and tested on different donors and potential receivers represented by japonica varieties [7,20]. Moreover, the level of resistance against the Northern Italy field-blast population conferred by different Pi genes has been evaluated, allowing the identification of Pi genes (including Pita, Pik, Piz, and Pib) that are effective against the field strains of the pathogen [7]. Unlike the other-mentioned Pi genes, the function of the Pik locus relies on the presence of two genes, Pik-1 and Pik-2, which are not homologous but are adjacent in the genome, separated by only about 2,5 kb and both required to confer Pik resistance [28]. PIK-1 contains an integrated heavy-metal-associated (HMA) domain that is responsible for the direct binding of the AVR-PIK effector [29,30]. Many non-synonymous nucleotide polymorphisms have been observed at Pik-1 among rice cvs [29,30], and some of them have occurred at the HMA domain-encoding sequence, most likely contributing to recognition specificity [31]. Conversely, Pik-2 shows a low level of DNA polymorphism among different genotypes [31].
The present work describes the pyramiding of four Pi genes (Pib, Pik, Pita, and Piz), previously demonstrated as effective against the field-blast population in Italy, in the genetic background of the highly susceptible renowned Italian cv Vialone Nano, by a MABC-based program. The four target Pi genes are located on rice chromosomes 2 (Pib) [13,32], 6 (Piz) [33], 11 (Pik) [28,34], and 12 (Pita) [34,35]. The donor line for the four Pi genes, named SJKK, was obtained from a pyramiding program assisted by molecular markers using Saber, Jefferson, Katy, and Kusabue as donors for Pib, Piz, Pita, and Pik, respectively [17]. The obtained backcross (BC) lines showed up to 95.2% of the RP genome, and phenotypic evaluations of blast resistance demonstrated that the presence of multiple Pi genes conferred valuable resistance levels against four multivirulent P. oryzae strains.

2. Results

2.1. Development of Molecular Markers

Pi genes were introgressed in the cv Vialone Nano by crossing with the donor line SJKK. Diagnostic markers for Piz and Pib were obtained from previous publications (Table 1 [7,33,36]) and were used to amplify the genomic DNA from the original donors (Saber and Jefferson, respectively, for Pib and Piz) and the parents SJKK and Vialone Nano.
Sequencing of the Pib marker amplicons with primers Pib5f/r allowed the identification of a [C/T] Single Nucleotide Polymorphism (SNP) between the Pib donor SJKK and Vialone Nano (Table 2; Supplementary Figure S1); Saber carried the same allele as SJKK at this locus. For the Piz marker amplicon, sequencing with Z56592f/r showed a [G/A] SNP between the Piz donor SJKK and Vialone Nano (Table 2; Supplementary Figure S1), with Jefferson showing the same allele as SJKK at this locus.
Diagnostic markers for Pik1 were developed in this work. The sequencing of the Pik locus LOC_Os11g46200 (Os11g0688832) in the original donor Kusabue, SJKK, and Vialone nano allowed the identification of a dominant pres/abs marker, defined by primers Pik1-10f/r, in the donor and receiving genotypes (Figure 1a).
Since no amplicons were obtained for the Vialone Nano genome with the whole set of Pik1 primer pairs (Supplementary Table S1), it could be hypothesized either that this gene is absent in this susceptible genotype or that its sequence is largely divergent. Pik1-10 was therefore useful during the BC generations, but did not discriminate homo- or heterozygous genotypes in the selfing generations. Since no sequences could be obtained from Vialone Nano to generate co-dominant markers, Pik2 (GenBank accession number HM048900, LOC_Os11g46210, Os11g0689100; [34]) was sequenced in Vialone Nano, Kusabue, and SJKK; and a diagnostic marker, based on a [G/A] SNP between SJKK (and the original donor Kusabue) and Vialone Nano and corresponding to the primer combination Pik2-2AEf/r, was developed (Table 2; Supplementary Figure S1). The availability of two markers for Pik, one dominant for Pik1 (Pik1-10f/r) and one co-dominant for Pik2 (Pik2-2AEf/r), allowed selection for both genes in two different steps of the process: Pik1-10 was used during the backcrosses, while Pik2-2AE was used for selecting the homozygous F2 plants (as explained below). This procedure reinforced the selection power, allowing the identification of F2 lines carrying resistant alleles for both genes at the Pik locus. In Kusabue the two genes are tightly physically linked on chromosome 11 (separated by 2543 bp; [34]), making the possibility of recombination among the two genes during the backcrossing process extremely unlikely.
The Pita locus was sequenced in both parents and in the original donor Katy; primers were designed from bp 10,606,359 to bp 10,612,068 of LOC_Os12g18360 (Os12g0281300) [35]. The amplification with primers Pita-10f/r allowed the identification of a [T/A] SNP between SJKK and Vialone Nano (Table 2; Supplementary Figure S1); the same allele was identified in the original donor Katy. This SNP was exploited to obtain a HincII Cleaved Amplified Polymorphic Sequence (CAPS) marker (Figure 1b).
The position of the developed markers on the Pik, Pib, Pita, and Piz homologous genes in the Nipponbare reference genome is showed in Figure 2.

2.2. MABC

The MABC program started with a cross between the donor parent (DP) SJKK and Vialone Nano (RP). F1 plants were tested for being produced from a cross rather than from selfing by using the Pib markers listed in Table 1. Thirty-one plants were identified as true F1 (Figure 3) and were backcrossed to the RP, obtaining 175 BC1F1 lines that were tested with the markers for the four Pi genes (Pib3; Z6050; Pik1-10; Pita-10).
Nine lines harboring the four Pi genes in heterozygosity were identified out of 175, following approximately the expected percentage of 6.25%. These plants were backcrossed again with the RP, and 103 BC2F1 lines were obtained. Marker screening revealed that five of them were heterozygous at the four Pi loci, again approaching the expected percentage of 6.25%. After the third backcross, 205 BC3F1 lines were analyzed to recover heterozygous lines: seven of these harbored the four Pi genes, while fifteen carried three genes in two different combinations (Pita + Pib + Piz and Pita + Pib + Pik). All 22 plants were self-pollinated to obtain BC3F2 seeds, resulting in the production of 1624 plants from the BC3F1 lines carrying the four Pi genes and 876 BC3F2 plants from the BC3F1 lines with three Pi genes, accounting for a total of 2500 BC3F2 individuals. The BC3F2 plants were subsequently analyzed in foreground selection to identify homozygous plants in the four or three Pi loci.

2.3. Foreground Selection

The 2500 BC3F2 plants were analyzed by Kompetitive Allele Specific (KASP) marker assays together with the parents SJKK and Vialone Nano. Co-dominant KASP markers based on SNPs between the DP and the RP (Table 2) were utilized for the screening. The assays were pursued through the utilization of “on-the-gene” co-dominant markers for Pik (Pik2-2AE), Pib (Pib5), and Pita (Pita-10), and a co-dominant marker (Z56592) for Piz that was localized at about 20 Kbp from the target gene on a Nipponbare reference genome (Figure 2).
Of the original 2500 BC3F2 lines, 2364 produced seeds. Application of the results of the foreground assay to these plants allowed the identification of homozygous plants for resistant alleles of the Pi genes, i.e., 8 plants with four Pi genes, 82 with three genes, 371 with two genes, and 839 with one gene (Table 3; Supplementary Table S2).
The percentage of lines carrying the four Pi genes at the homozygous state (0.34%) was in agreement with the expected frequency of 1/256 (0.39%) for the segregation of four genes in an F2 population. For the combinations of three genes, the expected homozygosity ratio of 1/64 (1.56%) was approximately observed for Piz + Pib + Pita (1.1%) and Pib + Pik + Pita (1.7%), while for Piz + Pik + Pita (0.42%) and Piz + Pib + Pik (0.21%) a lower-than-expected homozygosity ratio was observed. For the combinations of two genes, the expected homozygosity ratio of 1/16 (6.25%) was approximately observed only for Pib + Pita (6.2%), while for all the other combinations a lower than expected value of homozygous lines occurred: 0.8% for Piz + Pik; 2.16% for Piz + Pita; 1.9% for Pib + Pik; 1.9% for Piz + Pita; 2.7% for Pik + Pita. All the lines with only one Pi gene showed a segregation that yielded a lower number of homozygous lines than expected (25%).

2.4. Background Selection

Ninety-six KASP markers, among those commercially available at LGC Genomics, were selected for the 12 rice chromosomes. On average, 7 markers were located on chromosomes not carrying Pi genes, while for each chromosome harboring the Pi genes (chromosome 2 for Pib, 6 for Piz, 11 for Pik, and 12 for Pita), 10 markers were selected. These 40 markers were located in regions of Nipponbare reference genome assembly IRGSP-1.0 where homologs of the Pi genes or Pi markers are localized (Supplementary Table S3). For Pib, the homolog sequence in Nipponbare (Os02g0818500) is localized on chromosome 2 from 35,113,637 bp to 35,116,084 bp. The Piz marker Z56592 is located on Nipponbare chromosome 6 at 11,677,565–11,677,843 bp and Os06g028700, which is indicated to be similar to the NBS-LRR type-R protein Nbs4-Pi, is localized from 10,387,793 bp to 10,390,465 bp. Considering that Nbs4-Piz-t is defined as Piz-t in the rice variety Toride [37], it cannot be excluded that Nbs4-Pi in Nipponbare is the homolog of Piz in Jefferson and Piz-t in Toride. The homolog of Pik in Nipponbare (Os11g0689100) is localized on chromosome 11 from 27,981,132 bp to 27,991,195 bp, while the Pita homolog in Nipponbare (Os12g0281300) is located on chromosome 12 from 10,606,359 bp to 10,611,917 bp. Considering the positions of the selected Pi genes (Supplementary Table S3), the selected additional markers were located in regions overlapping or adjoining to the target genes in order to improve the recovery of the RP genome in the genomic regions adjacent to the four Pi genes.
Seven lines, out of eight carrying four Pi genes, set enough seeds and were submitted to background selection. The background selection was also applied to 39 BC3F2 lines with four different combinations of three genes: Piz + Pik + Pita, Piz + Pib + Pik, Piz + Pib + Pita, and Pib + Pik + Pita. Twenty-three KASP markers out of 96 resulted in being polymorphic between DP and RP (Supplementary Table S3). With the exclusion of the Piz region on chromosome 6, all the chromosomes had at least one polymorphic molecular marker to assist the RP genome selection. Moreover, in the three regions corresponding to Pib, Pik, and Pita, respectively, on chromosomes 2, 11, and 12, there was at least one polymorphic marker (Supplementary Table S3).
KASP marker genotyping data were used to calculate the recovery percentage of the Vialone Nano genome in the BC3F2 lines subjected to background selection, using the formula:
(1 − (number of heterozygous markers/total number of markers)) × 100.
The recovery percentage values ranged from 65.22% to 95.65% (Supplementary Table S4) among lines. Interestingly, out of the seven BC3F2 lines with four Pi genes, four showed a recovery percentage of higher than 90% and one (06BC304F2127) higher than 95%. Recovery percentage values higher than 95% were also calculated for several lines carrying three pyramided genes.

2.5. Phenotyping

A phenotypic screening for blast resistance was performed using four multivirulent blast isolates to inoculate the original varieties carrying the four Pi genes: the DP SJKK, the BC lines carrying three or four Pi genes, together with Maratelli and Vialone Nano (RP) as susceptible controls (Table 4).
The two lines (154/05/3/154/A and 154/06/04/127) with four genes showed resistance against all four fungal strains. All the lines with three genes were also resistant to all the tested fungal strains, with some exceptions highlighted in three lines for which a few lesions were detected in one replicate.
Preliminary evaluations were carried out in a paddy field in 2022 for the line 154/06/04/127, which is under registration for commercial exploitation. Data related to amylose, biometrics of the kernels, and sowing to flowering time were in agreement with those obtained for the RP Vialone Nano, indicating that these traits were fully recovered in the introgression line (Table 5). The relevant difference recorded for yield was ascribable to a heavy incidence of the blast disease on the RP.

2.6. Checking for the Presence of the Pita2/Ptr Gene in the Introgression Lines

Katy was the original donor of Pita and also carries the tightly linked blast-R gene Pita2/Ptr, located on the pericentromeric region of rice chromosome 12 [38]. On the Nipponbare reference sequence, the Pita locus LOC_Os12g18360 (Os12g0281300) is located on chromosome 12 from 10,606,359 bp to 10,612,068 bp, which is indicated as Pita on RAP-DB (http://rapdb.dna.affrc.go.jp/download/irgsp1.html (accessed on 1 February 2016)). Conversely, LOC_Os12g18729 (Os12g0285100), corresponding to Pita2/Ptr, encompasses a chromosome 12 region from 10,822,534 to 10,833,768 bp [38,39]. Therefore, these two Pi genes are separated by only approximately 2 Mbp in a pericentromeric site where, most likely, meiotic recombination is reduced, raising the possibility that these two genes could have been co-transferred from Katy to SJKK. To verify this, a gene-specific KASP marker was designed for Pita2/Ptr (Table 2) and was used to genotype the alleles on SJKK, Katy, Vialone Nano, and the seven lines phenotypically evaluated for blast response. Results indicated that the five individuals carrying Pita have the same allele of Katy and SJKK at this marker, supporting that Pita2/Ptr was also pyramided in these lines.

3. Discussion

This work was focused on obtaining rice lines with pyramided R genes against P. oryzae in the background of the renowned Italian cv Vialone Nano by the application of MABC and KASP markers (the whole procedure is summarized in Figure S2). MABC represents a suitable procedure for the introgression of R genes in susceptible genomes, reducing the donor genome content into the elite variety [40]. Compared to traditional approaches of gene pyramiding, MABC has several advantages, including saving time, since a traditional approach would imply the availability and selection of the resistant genes using differential pathogen strains. It also minimizes the negative effects of linkage drag, since the background selection leads to the identification of lines with higher recovery of the RP genome [9,20].
In this work a pre-selection with a few foreground markers, followed by a final background selection on selected lines, was conducted. This strategy was demonstrated as more efficient than genome-wide background selection with high-throughput markers alone [41]. The high-throughput markers used in this work were assayed by KASP marker analysis based on SNPs, and are characterized by several advantages: high abundance of genomes, low cost, co-dominant inheritance, locus specificity, potential for high-throughput analysis, and relatively low genotyping error rates [42,43,44]. The KASP markers developed here can be complementary or alternative to other Pi markers (e.g., [7,16,20]) and can provide additional breeding tools for pyramiding effective blast-R genes in rice.
A low level of polymorphism was highlighted during the screening of the 96 KASP markers in the background selection: only 23 markers, over 96 (24%), were polymorphic between SJKK and Vialone Nano. This result can most likely be ascribed to the relatedness of the two varieties, as recent studies indicate that japonica accessions are highly related to each other, resulting in a slow linkage disequilibrium (LD) decay because of few historical recombination events [45,46]. LD decay, indeed, has been reported to range from 500 kb up to 2 Mb, in a temperate japonica background, and to 75 kb, in an indica background [46,47,48,49,50]. Even with a moderate coverage of markers, due to the low level of polymorphism, the application of the MABC scheme coupled with background selection allowed the identification of an elite line harboring four Pi genes with a 95.24% recovery percentage in just four years. In addition, several lines with three pyramided genes were identified as having RP values higher than 95%. Of these, two lines carrying two different combinations of three Pi genes (Piz + Pib + Pita and Pib + Pik + Pita) reached the recovery percentages of 95.45% and 91.30%, respectively, and a reduced number of heterozygous alleles.
The use of resistant cvs with multiple R genes is one of the most efficient and environmentally and economically sustainable methods of limiting disease incidence, leading to long-lasting resistance, and of defeating pesticide hazards [20,51]. The pyramiding of blast-R genes represents a useful tool to prevent infection and was applied to different rice cvs for up to four blast R genes/QTLs [20]. In fact, the probability that a pathogen may overcome an entire set of R genes is based on the possibility that the pathogen avirulence genes mutate and escape recognition by the corresponding R genes [52]. It is expected that, for asexual pathogens, accumulating several virulences will be a long process and that, due to fitness cost, multivirulent strains will not emerge due to lower competitiveness. The ascertainment of the effect of pyramiding on resistance durability would require the long-term monitoring of field resistance for the pyramided lines. However, reports of increased resistance (i.e., fewer lesions) provided by stacking different blast-R genes are available: rice pyramiding of Pi1 + Piz-5 + Pita2 and Pi-1 + Pi-9 + Pi-kh enhanced blast resistance in comparison to a single gene [53,54,55]; nine Pi genes were introgressed individually or in combination of two by MABC, and the obtained lines demonstrated that Pigm and Pid3 significantly enhanced resistance during the growth period [56]; Wu et al. [57] obtained pyramided lines carrying different alleles of the Piz locus (Pigm, Pi40, Pi9, Pi2, and Piz) combined with Pi1, Pi33, and Pi54, respectively, and demonstrated that polygene pyramided lines displayed more seedling and panicle blast resistance than monogenic lines.
The lines obtained in this work showed resistance to all four blast strains utilized for phenotypic evaluations and were chosen for their broad and complementary virulence pattern. No substantial differences were observed for the level of resistance of the lines with four genes in comparison to those with three genes, with the exclusion of three lines for which some blast symptoms were observed in one replicate. The results obtained for the lines with four genes (154/05/3/154/A and 154/06/04/127) agree with the levels of resistance observed for the lines containing the pyramided genes: BL1 (Pib) can confer resistance to NG0190, K1 (Pita) can confer resistance to TG0015, Kanto51 (Pik) can confer resistance to BN0013, while Zenith (Piz) can confer resistance to BN0040. Therefore, the presence of the four genes is expected to protect from the virulence functions of all four strains. For two lines showing pyramiding of Piz, Pib, and Pik (154/05/01/219/C and 154/05/11/65), resistance to isolating TG0015 was unexpected, given the absence of Pita (and Pita2/Ptr). This result deserves additional investigations to address the origins of this resistance. Epistasis or synergic effects might explain this behavior. For the other three lines, unexpected resistance responses were observed: in 154/05/01/185 the absence of Pik should confer no resistance to BN0013; similarly, in 154/05/11/135, the absence of Pib should result in susceptibility to NG0190; in 154/16/70/310, the absence of Piz did not explain the resistance to BN0040. Even though additional investigations are required to address these observations, the presence, in all these lines, of the broad-spectrum Pita2/Ptr gene could explain the extended pattern of resistance.
The original donors (Saber, Katy, Kusabue, and Jefferson) are resistant to all four blast strains used in this study, suggesting the presence of additional Pi genes in these genetic backgrounds, with respect to those for which they acted as donors. As an example, Jefferson has three Pi genes: Pi-d(t) and Pikh-(t), tightly linked on chromosome 11; and Piz, located on chromosome 6 close to the centromere [58]. Furthermore, as mentioned before, Katy carries at least two Pi genes, Pita and Pita2/Ptr, tightly linked on the pericentromeric region of chromosome 12, and acting as a donor of both to SJKK and, consequently, to the lines tested for resistance.
In two lines (154/05/3/154/A and 154/06/04/127), four R genes were stacked; these data were then updated to five genes, after verification that Pita2/Ptr was also introgressed. This last gene provides a broad-spectrum resistance and represents a non-NLR gene encoding a novel R protein containing an Armadillo repeat domain [38,39]. The verification of whether this level of pyramiding will provide durable resistance will require the long-term monitoring of the resistance under blast pressure in field conditions.
Vialone Nano is a traditional and renowned Italian variety, grown on several thousands of hectares and also having a Protected Geographical Indication (in Italy, denominated IGP). Nonetheless, it is one of the most blast-susceptible Italian cvs [8,59]. Although treated with fungicides during the growing season, Vialone Nano often suffers a serious yield penalty when exposed to moderate pathogen pressure, making the sustainability of this cultivation very uncertain. The introduction of multiple Pi genes effective against field-blast population [7,60] will most likely allow relief from or solution of the problems related to blast incidence in this rice variety.

4. Materials and Methods

4.1. Plant Material and DNA Extraction

Rice genotypes Katy, Saber, and Jefferson, original donors of Pita, Pib, and Piz, respectively, were obtained from the USDA National Small Grains Collection, Aberdeen, WA, USA; Kusabue, harboring Pik, was obtained from the National Institute of Agrobiological Sciences (NIAS), Japan. The elite Italian variety Vialone Nano (RP) was provided by CREA-CI, Vercelli, Italy; DP SJKK, harboring the four Pi genes [17], was derived from Bertone sementi SpA, Terruggia, Italy. It was obtained from a pyramiding program, assisted by molecular markers, using Katy, Saber, Jefferson, and Kusabue as Pi donors [17].
Seeds were surface-sterilized by washing in 70% ethanol for 1 min, followed by another washing with 30% bleach for 30 min and three rinses with distilled water for 5 min. Seeds were then germinated in Petri dishes on wet paper. After one week, seedlings were planted in pots filled with peat moss (225 L), vermiculite (125 L), calcium carbonate (225 g), and osmocote exact 3–4 M (700 g) and watered.
DNA was extracted from leaves of two-week-old plants from each Pi donor, DP, RP, the F1, BCnF1, and self-pollination (BC3F2) progenies (see below), according to the method described by [61].

4.2. Molecular Marker Development and Analysis

Some of the markers utilized in the present work to assess the presence of resistant alleles at the Pib and Piz loci were already available (see below), while for Pita and Pik, markers were derived from Nipponbare homologous loci. For all the markers, the general strategy was based on the amplification of genomic fragments from both the donor SJKK (as well as from the original donors: Saber for Pib, Jefferson for Piz, Katy for Pita, and Kusabue for Pik) and the RP Vialone Nano, followed by sequencing and searching for sequence polymorphisms to develop co-dominant diagnostic molecular markers.
The sequence of Pita [35] was obtained by searching for the locus ID LOC_Os12g18360 (Os12g0281300, chr12: from 10.606.359 bp to 10.612.068 bp) on the Gramene database (http://www.gramene.org/, (accessed on 1 February 2016)). Overlapping primers (Supplementary Table S1) were designed by Vector NTI Software (Thermo Fisher Scientific), to achieve ~500-bp-long overlapping amplicons.
The sequences corresponding to the Pik-1 and Pik-2 alleles in Nipponbare were indicated as Pik5-NP and Pik6-NP, respectively, by [34]. Both genes are needed to confer the Pik resistance [28]. The sequence of the Pik-1 locus in Nipponbare, LOC_Os11g46200.1 (Os11g0688832, chr11: 27,981,132–27,991,195 bp), corresponding to the Pik5-NP gene indicated by [34], was obtained from the Gramene database (http://www.gramene.org/ (accessed on 1 February 2016)). Overlapping primers (listed in Supplementary Table S1) were designed, as described above, to amplify Pik1 sequences in the donor(s) and receiver(s). A marker was first obtained for Pik1 using primers Pik1-10f/r designed from LOC_Os11g46200.1 (Os11g0688832), but it was not suitable for the KASP marker assay (detailed in the Results Section 2.1). To develop useful KASP markers, the Pik-2 sequence (available in GenBank—accession number HM048900; [34]) was used to search the Vialone Nano Pik2 homolog sequences by a BlastN search within a custom Vialone Nano genome assembly (unpublished data). The two sequences were aligned using Sequencing Analysis Software 6 (Applied Biosystems Inc., Foster City, CA, USA), and regions carrying putative polymorphisms were targeted by designing additional primers, by means of Primer3Plus (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi (accessed on 15 November 2018)), which were used to amplify overlapping regions of Pik2 in SJKK and Vialone Nano (Supplementary Table S1). Primers Pik2-2AEf/r (listed in Table 1), designed to amplify a region from 3869 bp to 4322 bp of HM048900, allowed the identification of SNP-based markers.
Primers for Pib and Piz were already available in the literature [7,33,37]. Figure 2 shows the localization of the Pi markers with respect to the positions of Pita, Pik, and Pib homolog genes in Nipponbare. Piz markers (Z6050 and Z56592, obtained from [33,37], respectively), were localized at 9,916,006–9,916,133 bp and 10,407,985–10,408,277 bp, respectively, in Nipponbare. The position of Piz in Nipponbare was inferred by blasting the Piz alleles Pi-zt, Pi2, and Pi9 on the Os-Nipponbare-Reference-IRGSP-1.0 genome assembly (http://rapdb.dna.affrc.go.jp/download/irgsp1.html (accessed on 15 June 2017)), allowing the identification of LOC_Os06g17900 (Os06g0286700, 10,387,973–10,390,465 bp) as the putative Nipponbare allele for Piz, Pizt, Pi2, and Pi9. The position of Piz markers Z6050 and Z56592 with respect to the Piz allele in Nipponbare is indicated in Figure 2.
Primers to amplify the Pita2/Ptr locus were designed using the Primer3Plus program on the Ptr sequence cloned in Katy (Genebank ID: MG385185.1). The analysis was focused on less-conserved regions (UTRs and introns), in order to increase the probability of detecting polymorphisms between the different varieties.
For the amplification of entire gene fragments (for Piz and Pita), PCR reactions were performed in a total volume of 10 μL containing 20 ng of genomic DNA, 500 nM forward and reverse primers, 1.5 mM MgCl, 5% DMSO, 0.25 mM dNTPs, and 1U GoTaq DNA Polymerase (Promega, Madison, WI, USA). A touchdown program was applied as follows: denaturation at 94 °C for 3 m, 10 cycles at 94 °C for 45 s, from 60 °C to 55 °C for 45 s, reducing the annealing temperature of 0.5 °C for each cycle, and 72 °C per 45 s, 24 cycles at 94 °C for 45 s, 51 °C for 45 s, and 72 °C for 45 s, with a final extension at 72 °C for 10 m.
Some markers were utilized for both MABC and KASP (Table 1). For the initial polymorphism searches, carried out by comparing the RP with the donors, PCRs were performed in a 20 µL reaction mix, containing 1.5 mM MgCl2, 0.25 mM of each dNTP, 0.5 µM of each primer, 5% DMSO, 1U GoTaq® G2 Flexi DNA polymerase (Promega, Madison, WI, USA), and 40ng of genomic DNA. The PCR program comprised 1 cycle of 4 m at 94 °C, 35 cycles of 30 s at 94 °C, 40 s at the annealing temperature indicated in Table 1, 1 m at 72 °C, and a final extension 72 °C for 7 m.
All the PCR products were purified after electrophoresis on 1% agarose gel by a Wizard® SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA) and directly sequenced using Big dye terminator v1.0 in each direction, using the primers indicated in Table 1 and in Supplementary Table S1. A capillary electrophoresis instrument (3130XL Genetic Analyzer; Applied Biosystems Inc., Foster City, CA, USA) was utilized. SNPs were identified by aligning the RP and RP sequences using Sequencing Analysis Software 6 (Applied Biosystems Inc., Foster City, CA, USA).
Restriction enzymes suitable for SNP recognition were identified using the ‘‘Restriction Enzyme Site Mapper version 3” software (http://www.restrictionmapper.org/ (accessed on 20 February 2016)). PCRs for marker scoring on cross or BC progenies were performed as for the polymorphism screen. For the CAPS and dCAPS marker scorings, 10 µL of unpurified PCR products were digested overnight in a 15 µL volume containing 1× restriction enzyme buffer and 2.5U restriction enzyme, following the manufacturer’s instructions. The resulting fragments were visualized on 2% agarose gels.

4.3. Foreground Selection by KASP Marker Assays

Two thousand and five hundred BC3F2 seeds, together with those of the parents SJKK and Vialone Nano, were sown as described in Section 4.1. DNA extracted from each plant was screened in foreground selection by KASP (Kompetitive Allele-Specific) markers. The sequences listed in Table 2 and shown in Supplementary Figure S1 were used to develop KASP marker assays corresponding to the SNP present in each sequence of Piz, Pib, Pik, Pita, and Pita/Ptr genes, indicated in red in Table 2 and Supplementary Figure S1. The selected SNPs were sent to LGC Genomics UK (https://www.lgcgroup.com/ (accessed on 1 February 2023)) for primer design. For these SNPs, 250 bp flanking the candidate SNPs on either side were provided to LGC. The foreground analyses for Piz, Pib, Pik, and Pita genes were carried out by the LGC group. A subsequent foreground analysis for evaluating the presence of the Pita2/Ptr gene linked to the Pita gene on chromosome 12 was carried out on the selected introgression lines 159/16/70/310, 154/06/04/127, 154/06/1/185, 154/05/3/154A, 154/05/219/C, 154/05/11/135, 154/05/11/65, the DPs Katy and SJKK, and the RP Vialone Nano. The allelic discrimination assay for the Pita2/Ptr gene was tested in a 96-well format and established as 10 μL reactions (4.86 μL of template DNA (50 ng), 5.0 μL of 2× Low Rox Kasp mix, and 0.14 μL of primer mix). PCR was performed on a BIORAD-CFX OPUS device in accordance to the following protocol: pre-read stage at 60 °C for 60 s, hot start at 94 °C for 15 min, 10 touchdown cycles (94 °C for 20 s; touchdown at 61 °C, −0.6 °C per cycle, 60 s) and then 26 cycles of amplification (94 °C for 20 s; 55 °C for 60 s), 3 cycles of amplification (94 °C for 20 s; 57 °C for 60 s), and a post-read stage at 40 °C for 60 s.

4.4. Background Selection by KASP Marker Assays

The background selection was carried out by LGC (https://www.lgcgroup.com/ (accessed on 1 February 2023)) on 46 BC3F2 individuals selected on the basis of the foreground selection results, and on DP and RP, using 96 KASP markers evenly spaced over the 12 rice chromosomes. On average, one SNP every 1–5 Mb (depending on chromosome size and markers available) was selected from the commercially available KASP markers, resulting in an average of seven SNPs per chromosome. For chromosomes 2, 6, 11, and 12, bearing the introgressed Pi genes, 10 KASP markers were selected in order to include about 3 additional markers (spaced at a distance lower than 1 Mb) in the genomic regions where Pi genes are localized. The 96 markers employed in the analysis are listed in Supplementary Table S3.

4.5. Phenotyping

A resistance screening was performed, as described by [62] on seven BC3F4 lines selected on the bases of the recovery of the RP genome, using four multivirulent blast isolates (BN0013, BN0040, NG0190, and TG0015), each being avirulent to one of the four Pi introgressed genes (Table 4). The four initial DPs (Jefferson, Katy, Kusabue, and Saber), differential varieties carrying Pi genes (BL1 for Pib, K1 for Pita, Kanto51 for Pik, and Zenith for Piz [63]), and the susceptible cvs Maratelli and Vialone Nano were used as controls and were evaluated together with the lines carrying four and three Pi genes. The fungal isolates were grown on rice flour agar medium (15 g agar, 20 g rice flour, 2.5 g yeast extract, 1 L of water) for 7 days at 27 °C under fluorescent light (12 h photoperiod). All cvs and lines were sown in a tray (30 × 45 cm) filled with peat soil. Plants were grown in a greenhouse for 4–5 weeks (4-leaf stage) and inoculated by spraying spore suspensions (20 mL of suspension at 20,000 spores/mL per tray). Due to the limited number of seeds per each pyramided line, inoculation was performed a second time on the same plants after removing diseased leaves. Resistance was assessed at 7 days post-inoculation using a 1–6-scale rating system based on lesion type as described by [62]. Plants with scores 1 to 3 (absence of lesions or non-sporulating lesions) were considered as resistant (R), whereas interactions with scores 4 to 6 (sporulating lesions) were considered as susceptible (S). The preliminary evaluation in a paddy field for yield and quality traits of line 154/06/04/127 in comparison with the RP Vialone Nano was carried out in 2022 in Lucedio (Vercelli, Italy) in replicated plots of 50 m2 each. After harvest, analyses of amylose content, grain size, and thousand kernel weight were performed on the same materials using previously defined procedures [64].

5. Conclusions

Progress in rice research has paved the way for overcoming biotic stresses in order to retain high yields, improving the performance of highly appreciated rice cvs, such as Vialone Nano, an IGP Registered Trademark in Northern Italy, but whose cultivation may be hampered by its high susceptibility to blast. Most Pi donor parents for European rice varieties have up to now been tropical varieties that do not fit with European climate conditions [6,7,8,17]. Thanks to the MABC scheme integrated by the molecular KASP markers assays, a temperate japonica variety with a broad spectrum of resistance to blast was obtained in the Vialone Nano genomic background in the relatively short period of four years, retaining the typical features of the RP in terms of amylose content and kernel biometric traits, and showing, in a preliminary field test with heavy blast occurrence, increased yield compared to the RP. In addition, this line might be used as a donor in future breeding programs to yield other European elite varieties resistant to P. oryzae. Disease screening demonstrated the ability of this variety to withstand blast, as it has a complete and broad-range resistance, a very important trait for plant breeders and farmers to guarantee sustainable production.

6. Patents

The donor SJKK and all its derivatives are protected by a patent certificate for industrial invention (Italian Ministry of Economic Development N.102015000076118, 5 May 2018), owned by Bertone Sementi S.p.A.

Supplementary Materials

The following Supplementary files are available online at https://www.mdpi.com/article/10.3390/plants12040757/s1, Table S1: List of primers used to amplify overlapping sequences of the Pita, Pik, and Pita2/Ptr alleles of the Vialone Nano recurrent parent. Table S2: Results of the foreground selection of the BC3F2 lines carried out with the KASP markers. Table S3: Chromosomal and physical position of the KASP markers selected for the background selection. Table S4: Alleles of the KASP markers used for the background selection and percentage of RP observed in the Vialone Nano introgression lines. Figure S1: SNPs polymorphisms between the Pi genes donor SJKK and Vialone Nano (VN) for Pita, Piz, Pib, and Pik blast-resistance gene markers. Figure S2: Molecular markers used along the steps of MABC selection.

Author Contributions

Conceptualization, G.V.; methodology, G.V.; investigation, A.V., F.D., C.B., E.Z., C.M., L.C., D.T., J.M., H.A. and N.P.; resources, M.C. and G.O.; writing—original draft preparation, E.Z.; writing—review and editing, E.Z., A.V., C.M., G.O., F.D., C.B., D.T., P.V. and G.V.; supervision, G.V.; project administration, G.V.; funding acquisition, G.V. All authors have read and agreed to the published version of the manuscript.

Funding

This research was financed by a private funding by Bertone sementi S.P.A.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

We would thank Paolo Bagnaresi (CREA-GB) for the BlastN search within a custom Vialone Nano genome assembly.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

Abbreviation

MABC: Marker-Assisted BackCrossing; BC: BackCross; RP: recurrent parent; DP: donor parent; InDel: Insertion/Deletion; SNP: Single Nucleotide Polymorphism; CAPS: Cleaved Amplified Polymorphic Sequence; dCAPS: derived Cleaved Amplified Polymorphic Sequence; Pres/abs: presence/absence; Ta: Annealing Temperature; RE: restriction enzyme; KASP: Kompetitive Allele Specific; QTLs: quantitative trait loci; cv: cultivar.

References

  1. Couch, B.C.; Kohn, L.M. A multilocus gene genealogy concordant with host preference indicates segregation of a new species, Magnaporthe oryzae, from M. grisea. Mycologia 2002, 94, 683–693. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Zhang, N.; Luo, J.; Rossman, A.Y.; Aoki, T.; Chuma, I.; Crous, P.W.; Dean, R.; de Vries, R.; Donofrio, N.; Hyde, K.D.; et al. Generic names in Magnaporthales. IMA Fungus 2016, 7, 155–159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Savary, S.; Willocquet, L.; Pethybridge, S.J.; Esker, P.; McRoberts, N.; Nelson, A. The global burden of pathogens and pests on major food crops. Nat. Ecol. Evol. 2019, 3, 430–439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Khush, G.S.; Jena, K.K. Current status and future prospects for research on blast resistance in rice (Oryza sativa L.). In Advances in Genetics, Genomics and Control of Rice Blast Disease; Wang, G.L., Valent, B., Eds.; Springer: Dordrecht, The Netherlands, 2009. [Google Scholar] [CrossRef] [Scilit]
  5. Pennisi, E. Armed and Dangerous. Science 2010, 327, 5967. [Google Scholar] [CrossRef] [Scilit]
  6. Faivre-Rampant, O.; Bruschi, G.; Abbruscato, P.; Cavigiolo, S.; Picco, A.M.; Borgo, L.; Lupotto, E.; Piffanelli, P. Assessment of genetic diversity in Italian rice germplasm related to agronomic traits and blast resistance (Magnaporthe oryzae). Mol. Breed. 2011, 27, 233–246. [Google Scholar] [CrossRef] [Scilit]
  7. Tacconi, G.; Baldassarre, V.; Lanzanova, C.; Faivre-Rampant, O.; Cavigiolo, S.; Urso, S.; Lupotto, E.; Valè, G. Polymorphism analysis of genomic regions associated with broad-spectrum effective blast resistance genes for marker development in rice. Mol. Breed. 2011, 26, 595–617. [Google Scholar] [CrossRef] [Scilit]
  8. Volante, A.; Tondelli, A.; Desiderio, F.; Abbruscato, P.; Menin, B.; Biselli, C.; Casella, L.; Singh, N.; McCouch, S.R.; Tharreau, D.; et al. Genome wide association studies for japonica rice resistance to blast in field and controlled conditions. Rice 2020, 13, 71. [Google Scholar] [CrossRef] [Scilit]
  9. Ashkani, S.; Rafii, M.Y.; Shabanimofrad, M.; Miah, G.; Sahebi, M.; Azizi, P.; Tanweer, F.A.; Akhtar, M.S.; Nasehi, A. Molecular Breeding Strategy and Challenges Towards Improvement of Blast Disease Resistance in Rice Crop. Front. Plant Sci. 2015, 6, 886. [Google Scholar] [CrossRef] [Scilit]
  10. Fukuoka, S.; Saka, N.; Mizukami, Y.; Koga, H.; Yamanouchi, U.; Yoshioka, Y.; Hayashi, N.; Ebana, K.; Mizobuchi, R.; Yano, M. Gene pyramiding enhances durable blast disease resistance in rice. Sci. Rep. 2015, 5, 7773. [Google Scholar] [CrossRef] [Scilit]
  11. Xiao, N.; Wu, Y.; Pan, C.; Yu, L.; Chen, Y.; Liu, G.; Li, Y.; Zhang, X.; Wang, Z.; Dai, Z.; et al. Improving of Rice Blast Resistances in Japonica by Pyramiding Major R Genes. Front. Plant Sci. 2017, 7, 1918. [Google Scholar] [CrossRef] [Scilit]
  12. Zhu, D.; Kang, H.; Li, Z.; Liu, M.; Zhu, X.; Wang, Y.; Wang, D.; Wang, Z.; Liu, W.; Wang, G.-L. A Genome-Wide Association Study of Field Resistance to Magnaporthe oryzae in Rice. Rice 2016, 9, 44. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Wang, B.-H.; Ebbole, D.J.; Wang, Z.-H. The arms race between Magnaporthe oryzae and rice: Diversity and interaction of Avr and R genes. J. Integr. Agric. 2017, 16, 2746–2760. [Google Scholar] [CrossRef] [Scilit]
  14. Sahu, P.K.; Sao, R.; Choudhary, D.K.; Thada, A.; Kumar, V.; Mondal, S.; Das, B.K.; Jankuloski, L.; Sharma, D. Advancement in the Breeding, Biotechnological and Genomic Tools towards Development of Durable Genetic Resistance against the Rice Blast Disease. Plants 2022, 11, 2386. [Google Scholar] [CrossRef] [Scilit]
  15. Sreewongchai, T.; Toojinda, T.; Thanintorn, N.; Kosawang, C.; Vanavichit, A.; Tharreau, D.; Sirithunya, P. Development of elite indica rice lines with wide spectrum of resistance to Thai blast isolates by pyramiding multiple resistance QTLs. Plant Breed. 2010, 129, 176–180. [Google Scholar] [CrossRef] [Scilit]
  16. Ashkani, S.; Yusop, M.R.; Shabanimofrad, M.; Azadi, A.; Ghasemzadeh, A.; Azizi, P.; Latif, M.A. Allele Mining Strategies: Principles and Utilisation for Blast Resistance Genes in Rice (Oryza sativa L.). Curr. Issues Mol. Biol. 2015, 17, 57–74. [Google Scholar] [CrossRef] [Scilit]
  17. Orasen, G.; Greco, R.; Puja, E.; Pozzi, C.; Stile, M.R. Blast resistance R genes pyramiding in temperate japonica rice. Euphytica 2020, 216, 40. [Google Scholar] [CrossRef] [Scilit]
  18. Singh, S.; Sidhu, J.S.; Huang, N.; Vikal, Y.; Li, Z.; Brar, D.S.; Dhaliwal, H.S.; Khush, G.S. Pyramiding three bacterial blight resistance genes (xa5, xa13 and Xa21) using marker-assisted selection into indica rice cultivar PR106. Theor. Appl. Genet. 2001, 102, 1011–1015. [Google Scholar] [CrossRef] [Scilit]
  19. Werner, K.; Friedt, W.; Ordon, F. Strategies for Pyramiding Resistance Genes Against the Barley Yellow Mosaic Virus Complex (BaMMV, BaYMV, BaYMV-2). Mol. Breed. 2005, 16, 45–55. [Google Scholar] [CrossRef] [Scilit]
  20. Srivastava, D.; Shamim; Kumar, M.; Mishra, A.; Pandey, P.; Kumar, D.; Yadav, P.; Siddiqui, M.H.; Singh, K.N. Current Status of Conventional and Molecular Interventions for Blast Resistance in Rice. Rice Sci. 2017, 24, 299–321. [Google Scholar] [CrossRef] [Scilit]
  21. Allard, R.W. Principles of Plant Breeding; John Wiley & Sons Inc.: New York, NY, USA, 1960. [Google Scholar]
  22. Hasan, M.M.; Rafii, M.Y.; Ismail, M.R.; Mahmood, M.; Rahim, H.A.; Alam, M.A.; Ashkani, S.; Malek, M.A.; Latif, M.A. Marker-assisted backcrossing: A useful method for rice improvement. Biotechnol. Biotechnol. Equip. 2015, 29, 237–254. [Google Scholar] [CrossRef] [Scilit]
  23. Francia, E.; Tacconi, G.; Crosatti, C.; Barabaschi, D.; Bulgarelli, D.; Dall’Aglio, E.; Valè, G. Marker assisted selection in crop plants. Plant Cell Tissue Organ Cult. (PCTOC) 2005, 82, 317–342. [Google Scholar] [CrossRef] [Scilit]
  24. Reyes, V.P.; Angeles-Shim, R.B.; Mendioro, M.S.; Manuel, M.C.C.; Lapis, R.S.; Shim, J.; Sunohara, H.; Nishiuchi, S.; Kikuta, M.; Makihara, D.; et al. Marker-Assisted Introgression and Stacking of Major QTLs Controlling Grain Number (Gn1a) and Number of Primary Branching (WFP) to NERICA Cultivars. Plants 2021, 10, 844. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Angeles-Shim, R.B.; Reyes, V.P.; del Valle, M.M.; Lapis, R.S.; Shim, J.; Sunohara, H.; Jena, K.K.; Ashikari, M.; Doi, K. Marker-Assisted Introgression of Quantitative Resistance Gene pi21 Confers Broad Spectrum Resistance to Rice Blast. Rice Sci. 2020, 27, 113–123. [Google Scholar] [CrossRef] [Scilit]
  26. Reyes, V.P.; Angeles-Shim, R.B.; Lapis, R.S.; Shim, J.; Sunohara, H.; Jena, K.K.; Ashikari, M.; Doi, K. Improvement of Asian Rice Cultivars through Marker-Assisted Introgression of Yield QTLs Grain Number 1a (Gn1a) and Wealthy Farmer’s Panicle (WFP). Philipp. J. Biochem. Mol. Biol. 2021, 2, 29. [Google Scholar] [CrossRef]
  27. Hospital, F.; Charcosset, A. Marker-Assisted Introgression of Quantitative Trait Loci. Genetics 1997, 147, 1469–1485. [Google Scholar] [CrossRef] [Scilit]
  28. Ashikawa, I.; Hayashi, N.; Yamane, H.; Kanamori, H.; Wu, J.; Matsumoto, T.; Ono, K.; Yano, M. Two Adjacent Nucleotide-Binding Site–Leucine-Rich Repeat Class Genes Are Required to Confer Pikm-Specific Rice Blast Resistance. Genetics 2008, 180, 2267–2276. [Google Scholar] [CrossRef] [Scilit]
  29. De la Concepcion, J.C.; Franceschetti, M.; Maqbool, A.; Saitoh, H.; Terauchi, R.; Kamoun, S.; Banfield, M.J. Polymorphic residues in rice NLRs expand binding and response to effectors of the blast pathogen. Nat. Plants 2018, 4, 576–585. [Google Scholar] [CrossRef] [Scilit]
  30. Maqbool, A.; Saitoh, H.; Franceschetti, M.; Stevenson, C.; Uemura, A.; Kanzaki, H.; Kamoun, S.; Terauchi, R.; Banfield, M. Structural basis of pathogen recognition by an integrated HMA domain in a plant NLR immune receptor. Elife 2015, 4, e08709. [Google Scholar] [CrossRef] [Scilit]
  31. Costanzo, S.; Jia, Y. Sequence variation at the rice blast resistance gene Pikm locus: Implications for the development of allele specific markers. Plant Sci. 2010, 178, 523–530. [Google Scholar] [CrossRef] [Scilit]
  32. Wang, Z.-X.; Yano, M.; Yamanouchi, U.; Iwamoto, M.; Monna, L.; Hayasaka, H.; Katayose, Y.; Sasaki, T. The Pib gene for rice blast resistance belongs to the nucleotide binding and leucine-rich repeat class of plant disease resistance genes. Plant J. 1999, 19, 55–64. [Google Scholar] [CrossRef] [Scilit]
  33. Hayashi, K.; Hashimoto, N.; Daigen, M.; Ashikawa, I. Development of PCR-based SNP markers for rice blast resistance genes at the Piz locus. Theor. Appl. Genet. 2004, 108, 1212–1220. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Zhai, C.; Lin, F.; Dong, Z.; He, X.; Yuan, B.; Zeng, X.; Wang, L.; Pan, Q. The isolation and characterization of Pik, a rice blast resistance gene which emerged after rice domestication. New Phytol. 2011, 189, 321–334. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Bryan, G.T.; Wu, K.-S.; Farrall, L.; Jia, Y.; Hershey, H.P.; McAdams, S.A.; Faulk, K.N.; Donaldson, G.K.; Tarchini, R.; Valent, B. A Single Amino Acid Difference Distinguishes Resistant and Susceptible Alleles of the Rice Blast Resistance Gene Pi-ta. Plant Cell 2000, 12, 2033–2045. [Google Scholar] [CrossRef] [Scilit]
  36. Hayashi, K.; Yoshida, H.; Ashikawa, I. Development of PCR-based allele-specific and InDel marker sets for nine rice blast resistance genes. Theor. Appl. Genet. 2006, 113, 251–260. [Google Scholar] [CrossRef] [Scilit]
  37. Zhou, B.; Qu, S.; Liu, G.; Dolan, M.; Sakai, H.; Lu, G.; Bellizzi, M.; Wang, G.-L. The Eight Amino-Acid Differences Within Three Leucine-Rich Repeats Between Pi2 and Piz-t Resistance Proteins Determine the Resistance Specificity to Magnaporthe grisea. Mol. Plant-Microbe Interact. 2006, 19, 1216–1228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Meng, X.; Xiao, G.; Telebanco-Yanoria, M.J.; Siazon, P.M.; Padilla, J.; Opulencia, R.; Bigirimana, J.; Habarugira, G.; Wu, J.; Li, M.; et al. The broad-spectrum rice blast resistance (R) gene Pita2 encodes a novel R protein unique from Pita. Rice 2020, 13, 19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Zhao, H.; Wang, X.; Jia, Y.; Minkenberg, B.; Wheatley, M.; Fan, J.; Jia, M.H.; Famoso, A.; Edwards, J.D.; Wamishe, Y.; et al. The rice blast resistance gene Ptr encodes an atypical protein required for broad-spectrum disease resistance. Nat. Commun. 2018, 9, 2039. [Google Scholar] [CrossRef] [Scilit]
  40. Tanweer, F.A.; Rafii, M.Y.; Sijam, K.; Rahim, H.A.; Ahmed, F.; Latif, M.A. Current advance methods for the identification of blast resistance genes in rice. Comptes Rendus Biol. 2015, 338, 321–334. [Google Scholar] [CrossRef] [Scilit]
  41. Herzog, E.; Frisch, M. Selection strategies for marker-assisted backcrossing with high-throughput marker systems. Theor. Appl. Genet. 2011, 123, 251–260. [Google Scholar] [CrossRef] [Scilit]
  42. Rafalski, A. Applications of single nucleotide polymorphisms in crop genetics. Curr. Opin. Plant Biol. 2002, 5, 94–100. [Google Scholar] [CrossRef] [Scilit]
  43. Schlötterer, C. The evolution of molecular markers—Just a matter of fashion? Nat. Rev. Genet. 2004, 5, 63–69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Semagn, K.; Babu, R.; Hearne, S.; Olsen, M. Single nucleotide polymorphism genotyping using Kompetitive Allele Specific PCR (KASP): Overview of the technology and its application in crop improvement. Mol. Breed. 2013, 33, 1–14. [Google Scholar] [CrossRef] [Scilit]
  45. Biscarini, F.; Cozzi, P.; Casella, L.; Riccardi, P.; Vattari, A.; Orasen, G.; Perrini, R.; Tacconi, G.; Tondelli, A.; Biselli, C.; et al. Genome-Wide Association Study for Traits Related to Plant and Grain Morphology, and Root Architecture in Temperate Rice Accessions. PLoS ONE 2016, 11, e0155425. [Google Scholar] [CrossRef] [Scilit]
  46. Volante, A.; Desiderio, F.; Tondelli, A.; Perrini, R.; Orasen, G.; Biselli, C.; Riccardi, P.; Vattari, A.; Cavalluzzo, D.; Urso, S.; et al. Genome-Wide Analysis of japonica Rice Performance under Limited Water and Permanent Flooding Conditions. Front. Plant Sci. 2017, 8, 1862. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Huang, X.; Wei, X.; Sang, T.; Zhao, Q.; Feng, Q.; Zhao, Y.; Li, C.; Zhu, C.; Lu, T.; Zhang, Z.; et al. Genome-wide association studies of 14 agronomic traits in rice landraces. Nat. Genet. 2010, 42, 961–967. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. A Mather, K.; Caicedo, A.L.; Polato, N.R.; Olsen, K.M.; McCouch, S.; Purugganan, M.D. The Extent of Linkage Disequilibrium in Rice (Oryza sativa L.). Genetics 2007, 177, 2223–2232. [Google Scholar] [CrossRef] [Scilit]
  49. Kumar, V.; Singh, A.; Mithra, S.V.A.; Krishnamurthy, S.L.; Parida, S.K.; Jain, S.; Tiwari, K.K.; Kumar, P.; Rao, A.R.; Sharma, S.K.; et al. Genome-wide association mapping of salinity tolerance in rice (Oryza sativa). DNA Res. 2015, 22, 133–145. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Xu, X.; Liu, X.; Ge, S.; Jensen, J.D.; Hu, F.; Dong, Y.; Gutenkunst, R.N.; Fang, L.; Huang, L.; Li, J.; et al. Resequencing 50 accessions of cultivated and wild rice yields markers for identifying agronomically important genes. Nat. Biotechnol. 2011, 30, 105–111. [Google Scholar] [CrossRef] [Scilit]
  51. Miah, G.; Rafii, M.Y.; Ismail, M.R.; Puteh, A.B.; Rahim, H.A.; Islam, K.; Latif, M.A. A Review of Microsatellite Markers and Their Applications in Rice Breeding Programs to Improve Blast Disease Resistance. Int. J. Mol. Sci. 2013, 14, 22499–22528. [Google Scholar] [CrossRef] [Scilit]
  52. Cruz, C.M.V.; Bai, J.; Oña, I.; Leung, H.; Nelson, R.J.; Mew, T.-W.; Leach, J.E. Predicting durability of a disease resistance gene based on an assessment of the fitness loss and epidemiological consequences of avirulence gene mutation. Proc. Natl. Acad. Sci. USA 2000, 97, 13500–13505. [Google Scholar] [CrossRef] [Scilit]
  53. Hittalmani, S.; Parco, A.; Mew, T.V.; Zeigler, R.S.; Huang, N. Fine mapping and DNA marker-assisted pyramiding of the three major genes for blast resistance in rice. Theor. Appl. Genet. 2000, 100, 1121–1128. [Google Scholar] [CrossRef] [Scilit]
  54. Chen, Z.; Guan, H.; Wang, X.; Dong, R.; Zhuo, C.; Mao, D.; Pan, R.; Zhou, Y.; Wu, W. Pyramiding of 3-resistant-gene to improve rice blast resistance of a restorer line, Fuhui 673. Sheng Wu Gong Cheng Xue Bao 2019, 35, 837–846. [Google Scholar] [PubMed]
  55. Chen, Y.-C.; Hu, C.-C.; Chang, F.-Y.; Chen, C.-Y.; Chen, W.-L.; Tung, C.-W.; Shen, W.-C.; Wu, C.-W.; Cheng, A.-S.; Liao, D.-J.; et al. Marker-Assisted Development and Evaluation of Monogenic Lines of Rice cv. Kaohsiung 145 Carrying Blast Resistance Genes. Plant Dis. 2021, 105, 3858–3868. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Jiang, H.; Li, Z.; Liu, J.; Shen, Z.; Gao, G.; Zhang, Q.; He, Y. Development and evaluation of improved lines with broad-spectrum resistance to rice blast using nine resistance genes. Rice 2019, 12, 29. [Google Scholar] [CrossRef] [Scilit]
  57. Wu, Y.; Xiao, N.; Chen, Y.; Yu, L.; Pan, C.; Li, Y.; Zhang, X.; Huang, N.; Ji, H.; Dai, Z.; et al. Comprehensive evaluation of resistance effects of pyramiding lines with different broad-spectrum resistance genes against Magnaporthe oryzae in rice (Oryza sativa L.). Rice 2019, 12, 11. [Google Scholar] [CrossRef] [Scilit]
  58. McClung, A.M.; Marchetti, M.A.; Webb, B.D.; Bollich, C.N. Registration of ‘Jefferson’ rice. Crop Sci. 1997, 37, 629–630. [Google Scholar]
  59. Urso, S.; Desiderio, F.; Biselli, C.; Bagnaresi, P.; Crispino, L.; Piffanelli, P.; Abbruscato, P.; Assenza, F.; Guarnieri, G.; Cattivelli, L.; et al. Genetic analysis of durable resistance to Magnaporthe oryzae in the rice accession Gigante Vercelli identified two blast resistance loci. Mol. Genet. Genom. 2015, 291, 17–32. [Google Scholar] [CrossRef] [Scilit]
  60. Devanna, B.N.; Jain, P.; Solanke, A.U.; Das, A.; Thakur, S.; Singh, P.K.; Kumari, M.; Dubey, H.; Jaswal, R.; Pawar, D.; et al. Understanding the Dynamics of Blast Resistance in Rice-Magnaporthe oryzae Interactions. J. Fungi 2022, 8, 584. [Google Scholar] [CrossRef] [Scilit]
  61. Risterucci, A.M.; Grivet, L.; N’Goran, J.A.K.; Pieretti, I.; Flament, M.H.; Lanaud, C. A high-density linkage map of Theobroma cacao L. Theor. Appl. Genet. 2000, 101, 948–955. [Google Scholar] [CrossRef] [Scilit]
  62. Gallet, R.; Fontaine, C.; Bonnot, F.; Milazzo, J.; Tertois, C.; Adreit, H.; Ravigné, V.; Fournier, E.; Tharreau, D. Evolution of Compatibility Range in the Rice−Magnaporthe oryzae System: An Uneven Distribution of R Genes Between Rice Subspecies. Phytopathology 2016, 106, 348–354. [Google Scholar] [CrossRef] [Scilit]
  63. Kiyosawa, S. The inheritance of resistance of the zenith type varieties of rice to the blast fungus. Jpn. J. Breed. 1967, 17, 99–107. [Google Scholar] [CrossRef] [Scilit]
  64. Biselli, C.; Cavalluzzo, D.; Perrini, R.; Gianinetti, A.; Bagnaresi, P.; Urso, S.; Orasen, G.; Desiderio, F.; Lupotto, E.; Cattivelli, L.; et al. Improvement of marker-based predictability of Apparent Amylose Content in japonica rice through GBSSI allele mining. Rice 2016, 7, 1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Molecular markers developed in this work for Pik1 (a) and Pita (b). M = molecular weight marker; Ku = Kusabue (Pik original donor); S = SJKK (donor parent); Sa = Saber; Ka = Katy (Pita original donor); VN = Vialone Nano (recurrent parent). Arrows indicate 500 bp size.
Figure 1. Molecular markers developed in this work for Pik1 (a) and Pita (b). M = molecular weight marker; Ku = Kusabue (Pik original donor); S = SJKK (donor parent); Sa = Saber; Ka = Katy (Pita original donor); VN = Vialone Nano (recurrent parent). Arrows indicate 500 bp size.
Plants 12 00757 g001
Figure 2. Position of the Pi markers listed in Table 1 and Table 2 in the Pik, Pib, Pita, and Piz homolog genes on Nipponbare reference genome IRGSP-1.0 (GenBank accessions HM048900.1 (LOC_Os11g46210, Os11g0689100), AB013448.1 (LOC_Os02g57305, Os02g0818450), AF207842.1 (LOC_Os12g18360, Os12g0281300), and RAP-DB accession Os06g0286700 (LOC_Os06g17900), respectively).
Figure 2. Position of the Pi markers listed in Table 1 and Table 2 in the Pik, Pib, Pita, and Piz homolog genes on Nipponbare reference genome IRGSP-1.0 (GenBank accessions HM048900.1 (LOC_Os11g46210, Os11g0689100), AB013448.1 (LOC_Os02g57305, Os02g0818450), AF207842.1 (LOC_Os12g18360, Os12g0281300), and RAP-DB accession Os06g0286700 (LOC_Os06g17900), respectively).
Plants 12 00757 g002
Figure 3. MABC scheme for the introgression of the four Pi genes (Pib, Piz, Pik, and Pita) where SJKK acted as donor parent (DP) and Vialone Nano as recurrent parent (RP). Numbers indicate the tested plants with respect to the number of plants having the desired marker alleles.
Figure 3. MABC scheme for the introgression of the four Pi genes (Pib, Piz, Pik, and Pita) where SJKK acted as donor parent (DP) and Vialone Nano as recurrent parent (RP). Numbers indicate the tested plants with respect to the number of plants having the desired marker alleles.
Plants 12 00757 g003
Table 1. List of the primers. For each primer, the name, sequence, annealing temperature (Ta), polymorphism type, restriction enzyme (RE, in the case of CAPS and dCAPS markers), gene, reference, and application are reported. InDel = Insertion/Deletion; SNP = Single Nucleotide Polymorphism; CAPS = Cleaved Amplified Polymorphic Sequence; dCAPS = derived Cleaved Amplified Polymorphic Sequence; Pres/abs = presence/absence.
Table 1. List of the primers. For each primer, the name, sequence, annealing temperature (Ta), polymorphism type, restriction enzyme (RE, in the case of CAPS and dCAPS markers), gene, reference, and application are reported. InDel = Insertion/Deletion; SNP = Single Nucleotide Polymorphism; CAPS = Cleaved Amplified Polymorphic Sequence; dCAPS = derived Cleaved Amplified Polymorphic Sequence; Pres/abs = presence/absence.
Primer NameSequenceTa
(°C)
Polymorphism TypeREGeneReferenceApplication in:
MABCKASP Marker
/Sequencing
Pib5 f
Pib5 r
CCTACTGCTCTCGCTCCGAATTCC
CAGAATTTTGTCAGGAACCTGCC
58InDel and SNPs-Pib[7] x
Pib3 f
Pib3 r
AGTAGTATCTCCCTACTCACACGACAC
GGATGACCTGAACTGAAACTCACAGT
58dCAPSDdeIPib[7] x
Z6050 f
Z6050 r
CCCGAGCACTTGCAGATCTTGGGCGAAGCA
ATCTCTCCGGCACGACCGAAGC
60dCAPSSphI/PaeIPiz[7,33] x
Z56592 f
Z56592 r
GGACCCGCGTTTTCCACGTGTAA
AGGAATCTATTGCTAAGCATGAC
60SNPs-Piz[36] x
Pik2-2AE f
Pik2-2AE r
TCCTTAGCCCTGTCAACTGA
TGCTGGATCTTGAGGACTGG
53SNPs-Pik2This work x
Pik1-10 f
Pik1-10 r
ACTGTAGTGCATACCATTGG
GAGTGCTCCCCACATACAA
50Pres/abs-Pik1This workx
Pita-10 f
Pita-10 r
TATCTTGCAAATGCGTCCG
GCCAAGAAGATGATCAGCA
60CAPSHincIIPitaThis workxx
Pita2/Ptr -5 f
Pita2/Ptr-5 r
TTGCTTGTTCGGATCAGTGC
TGTTGCTGATCGTCTTGCTG
57SNPs Pita2/PtrThis work x
Table 2. Sequences for each Pi gene marker used for the KASP marker assay development. The selected SNPs are indicated in red. Within the sequences, the IUPAC Code characters R, W, S, Y, M are used, indicating the presence of unselected other SNPs following the encoding R = A/G, W = A/T, S = C/G, Y = C/T, M = A/C. The N character indicates presence of INDEL.
Table 2. Sequences for each Pi gene marker used for the KASP marker assay development. The selected SNPs are indicated in red. Within the sequences, the IUPAC Code characters R, W, S, Y, M are used, indicating the presence of unselected other SNPs following the encoding R = A/G, W = A/T, S = C/G, Y = C/T, M = A/C. The N character indicates presence of INDEL.
AmpliconDonor Parent Sequence SJKKRecurrent Parent Sequence Vialone Nano
Pib5TCAAGAGAATTTGAGAAGCAAGAGAGGC
TCTGATACCAGATTGTCAGGATCTCAAGAA
ATCARCAANGARMAACAAGAACACACAA
GGATTCAGGCAACTAGTTTGGATTGATCTG
CTCCAACCCAACAGG
TCAAGAGAATTTGAGAAGCAAGAGAGGC
TCTGATACCAGATTGTCAGGATCTCAAGAA
ATTARCAANGARMAACAAGAACACACAA
GGATTCAGGCAACTAGTTTGGATTGATCTG
CTCCAACCCAACAGG
Z56592CGATGTTCGAGAGCCCATGGATGTTTAGTT
GTTTAGACATGGTGTTGGACGGTCGAATGG
TGGGCCTGTTGTAGGTATGGTGGCATCTGG
CAACCAGTCAT
CGATGTTCGAGAGCCCATGGATGTTTAGTT
GTTTAGACATGGTGTTGGACAGTCGAATGG
TGGGCCTGTTGTAGGTATGGTGGCATCTGG
CAACCAGTCAT
Pik2-2AECCTTGAGGYGACGGGTTTTTMATTGSCTTMTT
WCTTTTTTCTTGAGGCAACCTCAGCCCCTTCC
GTGTGTTTTTRTTCCCYCCAAGTATGCTAMTG
ATCCGTTTTAGCTGGMCTAYWGACTTAGGCA
GSTCCYYGACATATGTCTCCCTTATGT
CCTTGAGGYGACGGGTTTTTMATTGSCTTMTT
WCTTTTTTCTTGAGGCAACCTCAGCCCCTTCC
GTGTATTTTTRTTCCCYCCAAGTATGCTAMTG
ATCCGTTTTAGCTGGMCTAYWGACTTAGGCA
GSTCCYYGACATATGTCTCCCTTATGT
Pita-10GTCAGCGACAGAAACCGGCGGCGTTCGTTG
CCGGCGGAGTCCTCGCGATCGTCGTCGTCGT
CTTCTTCTCTCGGCCTCGAGCTCGAGGTGCG
CCTGCCAAGATGGTAGCTC
GTCAGCGACAGAAACCGGCGGCGTTCGTTG
CCGGCGGAGTCCTCGCGATCGTCGTCGTCGA
CTTCTTCTCTCGGCCTCGAGCTCGAGGTGCG
CCTGCCAAGATGGTAGCTC
Pita2/PtrTATACACAGTAGACAATATTGGATTGAGTTT
CTGATGAACACAGTAGGAATTCTTCTCAATA
CGGTGTGTGCGTGTAGAGAATAATCAACAAT
GGTACGTCGTGCTGCTTGCCTCGGCGCACGG
CAACA
TATACACAGTAGACAATATTGGATTGAGTTT
CTGATGAACACAGTAGGAATTCTTCTCGATA
CGGTGTGTGCGTGTAGAGAATAATCAACAAT
GGTACGTCGTGCTGCTTGCCTCGGCGCACGG
CAACA
Table 3. Number of plants for each Pi gene combination out of 2364 BC3F2 screened lines.
Table 3. Number of plants for each Pi gene combination out of 2364 BC3F2 screened lines.
LocusNumber of Plants
PizPibPikPita
++++8
+++-5
++-+27
-+++40
+-++10
-+-+147
+--+45
-++-44
--++65
+-+-51
++--19
---+241
-+--139
+---176
--+-283
Table 4. Screening of resistance to 4 multivirulent strains of P. oryzae. The original donors of the Pi genes are in bold. ND = not determined, because most of the plants were resistant in most of the experiments but a few lesions were observed in at least one replicate.
Table 4. Screening of resistance to 4 multivirulent strains of P. oryzae. The original donors of the Pi genes are in bold. ND = not determined, because most of the plants were resistant in most of the experiments but a few lesions were observed in at least one replicate.
VarietyPi Gene(s)Phenotypic Scores
BN0013BN0040NG0190TG0015
SaberPibRRRR
BL1PibSSRS
KatyPita and Pita2/PtrRRRR
K1PitaSSSR
KusabuePikRRRR
Kanto 51 PikRSSS
JeffersonPizRRRR
ZenithPizSRSS
Vialone Nano-SSSS
Maratelli-SSSS
154/05/3/154/APiz + Pib + Pik + Pita + Pita2RRRR
154/06/04/127Piz + Pib + Pik + Pita+ Pita2RRRR
154/05/01/219/CPiz + Pib + PikRRRR
154/05/01/185Piz + Pib + Pita+ Pita2RRRND
154/05/11/135Piz + Pik + Pita+ Pita2RRRR
154/05/11/65Piz + Pib + PikNDRRND
154/16/70/310Pib + Pik + Pita+ Pita2RRRND
Table 5. Comparison of some agronomic, biometric, and qualitative traits for a selected introgression line (154/06/04/127) and the RP Vialone Nano.
Table 5. Comparison of some agronomic, biometric, and qualitative traits for a selected introgression line (154/06/04/127) and the RP Vialone Nano.
ParametersLine 154/06/04/127Vialone Nano
Amylose (% d.m.)25.9026.80
Grain length, L—milled (mm)5.575.51
Grain width, W—milled (mm)3.133.21
L/W (milled)1.781.72
Grain length, L—hulled (mm)6.096.12
Grain width, W—hulled (mm)3.303.56
L/W (hulled)1.851.72
Thousand kernel weight (g)3736
Sowing–flowering (days)102103
Grain yield (t/ha)9.15.8
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zampieri, E.; Volante, A.; Marè, C.; Orasen, G.; Desiderio, F.; Biselli, C.; Canella, M.; Carmagnola, L.; Milazzo, J.; Adreit, H.; et al. Marker-Assisted Pyramiding of Blast-Resistance Genes in a japonica Elite Rice Cultivar through Forward and Background Selection. Plants 2023, 12, 757. https://doi.org/10.3390/plants12040757

AMA Style

Zampieri E, Volante A, Marè C, Orasen G, Desiderio F, Biselli C, Canella M, Carmagnola L, Milazzo J, Adreit H, et al. Marker-Assisted Pyramiding of Blast-Resistance Genes in a japonica Elite Rice Cultivar through Forward and Background Selection. Plants. 2023; 12(4):757. https://doi.org/10.3390/plants12040757

Chicago/Turabian Style

Zampieri, Elisa, Andrea Volante, Caterina Marè, Gabriele Orasen, Francesca Desiderio, Chiara Biselli, Marco Canella, Lorena Carmagnola, Joëlle Milazzo, Henri Adreit, and et al. 2023. "Marker-Assisted Pyramiding of Blast-Resistance Genes in a japonica Elite Rice Cultivar through Forward and Background Selection" Plants 12, no. 4: 757. https://doi.org/10.3390/plants12040757

APA Style

Zampieri, E., Volante, A., Marè, C., Orasen, G., Desiderio, F., Biselli, C., Canella, M., Carmagnola, L., Milazzo, J., Adreit, H., Tharreau, D., Poncelet, N., Vaccino, P., & Valè, G. (2023). Marker-Assisted Pyramiding of Blast-Resistance Genes in a japonica Elite Rice Cultivar through Forward and Background Selection. Plants, 12(4), 757. https://doi.org/10.3390/plants12040757

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop