BrCYP71A15 Negatively Regulates Hg Stress Tolerance by Modulating Cell Wall Biosynthesis in Yeast
Abstract
:1. Introduction
2. Results
2.1. The Effect of Hg Stress on the Chlorophyll Content
2.2. BrCYP71A15 Gene Induced by Hg Stress in Chinese Cabbage
2.3. Expression Patterns of the BrCYP71A15 Gene under Different Abiotic Stresses
2.4. Expression Patterns of the BrCYP71A15 Gene in Different Tissues of Chinese Cabbage
2.5. BrCYP71A15 Protein–Protein Association Network
2.6. BrCYP71A15 Overexpression in Response to Abiotic Stresses in Yeast
2.7. Subcellular Localization of the BrCYP71A15 Gene
2.8. Cell Wall Biosynthesis Gene
3. Discussion
4. Materials and Methods
4.1. Chlorophyll Contents
4.2. Yeast Constructs
4.3. Hg Concentration in Yeast Cells
4.4. Tolerance Assay and Growth Curve
4.5. Total RNA Extraction and qRT-PCR Analysis
4.6. Statistical Analysis
5. Summary
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Gu, M.; Li, N.; Ty, S.; Xh, L.; Brestic, M.; Shao, H.; Li, J.; Rki, S. Accumulation capacity of ions in cabbage (Brassica oleracea L.) supplied with sea water. Plant Soil Environ. 2016, 62, 314–320. [Google Scholar] [CrossRef]
- Park, S.; Valan Arasu, M.; Lee, M.K.; Chun, J.H.; Seo, J.M.; Lee, S.W.; Al-Dhabi, N.A.; Kim, S.J. Quantification of glucosinolates, anthocyanins, free amino acids, and vitamin C in inbred lines of cabbage (Brassica oleracea L.). Food Chem. 2014, 145, 77–85. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Wu, Y.; Wang, X.; Lv, J.; Tang, Z.; Hu, L.; Luo, S.; Wang, R.; Ali, B.; Yu, J. Physiological Mechanism of Exogenous 5-Aminolevulinic Acid Improved the Tolerance of Chinese Cabbage (Brassica pekinensis L.) to Cadmium Stress. Front. Plant Sci. 2022, 13, 845396. [Google Scholar] [CrossRef]
- Anwar, A.; Zhang, S.; Wang, L.X.; Wang, F.; He, L.; Gao, J. Genome-Wide Identification and Characterization of Chinese Cabbage S1fa Transcription Factors and Their Roles in Response to Salt Stress. Antioxidants 2022, 11, 1782. [Google Scholar] [CrossRef] [PubMed]
- Huang, S.Q.; Peng, J.; Qiu, C.X.; Yang, Z.M. Heavy metal-regulated new microRNAs from rice. J. Inorg. Biochem. 2009, 103, 282–287. [Google Scholar] [CrossRef]
- Ghori, N.H.; Ghori, T.; Hayat, M.Q.; Imadi, S.R.; Gul, A.; Altay, V.; Ozturk, M. Heavy metal stress and responses in plants. Int. J. Environ. Sci. Technol. 2019, 16, 1807–1828. [Google Scholar] [CrossRef]
- Anwar, A.; Liu, Y.; Dong, R.; Bai, L.; Yu, X.; Li, Y. The physiological and molecular mechanism of brassinosteroid in response to stress: A review. Biol. Res. 2018, 51, 46. [Google Scholar] [CrossRef]
- He, Y.; Chen, Y.; Song, W.; Zhu, L.; Dong, Z.; Ow, D.W. A Pap1–Oxs1 signaling pathway for disulfide stress in Schizosaccharomyces pombe. Nucleic Acids Res. 2017, 45, 106–114. [Google Scholar] [CrossRef]
- Jing, Y.; Shi, L.; Li, X.; Zheng, H.; Gao, J.; Wang, M.; He, L.; Zhang, W. OXS2 is Required for Salt Tolerance Mainly through Associating with Salt Inducible Genes, CA1 and Araport11, in Arabidopsis. Sci. Rep. 2019, 9, 20341. [Google Scholar] [CrossRef]
- He, L.; Jing, Y.; Shen, J.; Li, X.; Liu, H.; Geng, Z.; Wang, M.; Li, Y.; Chen, D.; Gao, J.; et al. Mitochondrial Pyruvate Carriers Prevent Cadmium Toxicity by Sustaining the TCA Cycle and Glutathione Synthesis. Plant Physiol. 2019, 180, 198–211. [Google Scholar] [CrossRef] [Green Version]
- Shao, R.; Zhang, J.; Shi, W.; Wang, Y.; Tang, Y.; Liu, Z.; Sun, W.; Wang, H.; Guo, J.; Meng, Y.; et al. Mercury stress tolerance in wheat and maize is achieved by lignin accumulation controlled by nitric oxide. Environ. Pollut. 2022, 307, 119488. [Google Scholar] [CrossRef]
- Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909–930. [Google Scholar] [CrossRef]
- Nath, M.; Bhatt, D.; Jain, A.; Saxena, S.C.; Saifi, S.K.; Yadav, S.; Negi, M.; Prasad, R.; Tuteja, N. Salt stress triggers augmented levels of Na+, Ca2+ and ROS and alter stress-responsive gene expression in roots of CBL9 and CIPK23 knockout mutants of Arabidopsis thaliana. Environ. Exp. Bot. 2019, 161, 265–276. [Google Scholar] [CrossRef]
- Pandian, B.A.; Sathishraj, R.; Djanaguiraman, M.; Prasad, P.V.V.; Jugulam, M. Role of Cytochrome P450 Enzymes in Plant Stress Response. Antioxidants 2020, 9, 454. [Google Scholar] [CrossRef]
- Liu, Z.; Boachon, B.; Lugan, R.; Tavares, R.; Erhardt, M.; Mutterer, J.; Demais, V.; Pateyron, S.; Brunaud, V.; Ohnishi, T.; et al. A Conserved Cytochrome P450 Evolved in Seed Plants Regulates Flower Maturation. Mol. Plant 2015, 8, 1751–1765. [Google Scholar] [CrossRef]
- Mao, G.; Seebeck, T.; Schrenker, D.; Yu, O. CYP709B3, a cytochrome P450 monooxygenase gene involved in salt tolerance in Arabidopsis thaliana. BMC Plant Biol. 2013, 13, 169. [Google Scholar] [CrossRef]
- Tamiru, M.; Undan, J.R.; Takagi, H.; Abe, A.; Yoshida, K.; Undan, J.Q.; Natsume, S.; Uemura, A.; Saitoh, H.; Matsumura, H.; et al. A cytochrome P450, OsDSS1, is involved in growth and drought stress responses in rice (Oryza sativa L.). Plant Mol. Biol. 2015, 88, 85–99. [Google Scholar] [CrossRef]
- Kushiro, T.; Okamoto, M.; Nakabayashi, K.; Yamagishi, K.; Kitamura, S.; Asami, T.; Hirai, N.; Koshiba, T.; Kamiya, Y.; Nambara, E. The Arabidopsis cytochrome P450 CYP707A encodes ABA 8′-hydroxylases: Key enzymes in ABA catabolism. Embo J. 2004, 23, 1647–1656. [Google Scholar] [CrossRef]
- Okamoto, M.; Kuwahara, A.; Seo, M.; Kushiro, T.; Asami, T.; Hirai, N.; Kamiya, Y.; Koshiba, T.; Nambara, E. CYP707A1 and CYP707A2, which encode abscisic acid 8′-hydroxylases, are indispensable for proper control of seed dormancy and germination in Arabidopsis. Plant Physiol. 2006, 141, 97–107. [Google Scholar] [CrossRef]
- Xiao, F.; Goodwin, S.M.; Xiao, Y.; Sun, Z.; Baker, D.; Tang, X.; Jenks, M.A.; Zhou, J.M. Arabidopsis CYP86A2 represses Pseudomonas syringae type III genes and is required for cuticle development. Embo J. 2004, 23, 2903–2913. [Google Scholar] [CrossRef]
- Wang, M.; Yuan, J.; Qin, L.; Shi, W.; Xia, G.; Liu, S. TaCYP81D5, one member in a wheat cytochrome P450 gene cluster, confers salinity tolerance via reactive oxygen species scavenging. Plant Biotechnol. J. 2020, 18, 791–804. [Google Scholar] [CrossRef] [PubMed]
- Helliwell, C.A.; Chandler, P.M.; Poole, A.; Dennis, E.S.; Peacock, W.J. The CYP88A cytochrome P450, ent-kaurenoic acid oxidase, catalyzes three steps of the gibberellin biosynthesis pathway. Proc. Natl. Acad. Sci. USA 2001, 98, 2065–2070. [Google Scholar] [CrossRef] [PubMed]
- Techo, T.; Charoenpuntaweesin, S.; Auesukaree, C. Involvement of the Cell Wall Integrity Pathway of Saccharomyces cerevisiae in Protection against Cadmium and Arsenate Stresses. Appl. Environ. Microbiol. 2020, 86, e01339-20. [Google Scholar] [CrossRef] [PubMed]
- Grosjean, N.; Le Jean, M.; Chalot, M.; Mora-Montes, H.M.; Armengaud, J.; Gross, E.M. Genome-Wide Mutant Screening in Yeast Reveals that the Cell Wall is a First Shield to Discriminate Light From Heavy Lanthanides. Front. Microbiol. 2022, 13, 881535. [Google Scholar] [CrossRef] [PubMed]
- Anwar, A.; Kim, J.K. Transgenic Breeding Approaches for Improving Abiotic Stress Tolerance: Recent Progress and Future Perspectives. Int. J. Mol. Sci. 2020, 21, 2965. [Google Scholar] [CrossRef]
- van Zelm, E.; Zhang, Y.; Testerink, C. Salt Tolerance Mechanisms of Plants. Annu. Rev. Plant Biol. 2020, 71, 403–433. [Google Scholar] [CrossRef]
- Malik, B.; Pirzadah, T.B.; Tahir, I.; Ul Rehman, R. Growth and physiological responses in chicory towards mercury induced in vitro oxidative stress. Plant Physiol. Rep. 2019, 24, 236–248. [Google Scholar] [CrossRef]
- Bustos-Sanmamed, P.; Mao, G.; Deng, Y.; Elouet, M.; Khan, G.A.; Bazin, J.R.M.; Turner, M.; Subramanian, S.; Yu, O.; Crespi, M.; et al. Overexpression of miR160 affects root growth and nitrogen-fixing nodule number in Medicago truncatula. Funct. Plant Biol. 2013, 40, 1208–1220. [Google Scholar] [CrossRef]
- Singh, S.; Singh, A. A prescient evolutionary model for genesis, duplication and differentiation of MIR160 homologs in Brassicaceae. Mol. Genet. Genom. 2021, 296, 985–1003. [Google Scholar] [CrossRef]
- Yang, T.; Wang, Y.; Teotia, S.; Wang, Z.; Shi, C.; Sun, H.; Gu, Y.; Zhang, Z.; Tang, G. The interaction between miR160 and miR165/166 in the control of leaf development and drought tolerance in Arabidopsis. Sci. Rep. 2019, 9, 2832. [Google Scholar] [CrossRef] [Green Version]
- Sanz, A.B.; García, R.; Rodríguez-Peña, J.M.; Arroyo, J. The CWI Pathway: Regulation of the Transcriptional Adaptive Response to Cell Wall Stress in Yeast. J. Fungi 2017, 4, 1. [Google Scholar] [CrossRef]
- Zagorchev, L.; Kamenova, P.; Odjakova, M. The Role of Plant Cell Wall Proteins in Response to Salt Stress. Sci. World J. 2014, 2014, 764089. [Google Scholar] [CrossRef]
- Gerik, K.J.; Donlin, M.J.; Soto, C.E.; Banks, A.M.; Banks, I.R.; Maligie, M.A.; Selitrennikoff, C.P.; Lodge, J.K. Cell wall integrity is dependent on the PKC1 signal transduction pathway in Cryptococcus neoformans. Mol. Microbiol. 2005, 58, 393–408. [Google Scholar] [CrossRef]
- Ying, S.; Zhang, D.F.; Fu, J.; Shi, Y.S.; Song, Y.C.; Wang, T.Y.; Li, Y. Cloning and characterization of a maize bZIP transcription factor, ZmbZIP72, confers drought and salt tolerance in transgenic Arabidopsis. Planta 2012, 235, 253–266. [Google Scholar] [CrossRef]
- Anwar, A.; Di, Q.; Yan, Y.; He, C.; Li, Y.; Yu, X. Exogenous 24-epibrassinolide alleviates the detrimental effects of suboptimal root zone temperature in cucumber seedlings. Arch. Agron. Soil Sci. 2019, 65, 1927–1940. [Google Scholar] [CrossRef]
- Song, W.Y.; Sohn, E.J.; Martinoia, E.; Lee, Y.J.; Yang, Y.Y.; Jasinski, M.; Forestier, C.; Hwang, I.; Lee, Y. Engineering tolerance and accumulation of lead and cadmium in transgenic plants. Nat. Biotechnol. 2003, 21, 914–919. [Google Scholar] [CrossRef]
miRNA | Gene | Length | Start | End | miRNA Aligned Fragment | Alignment | Targeted Fragment | Inhibition |
---|---|---|---|---|---|---|---|---|
ath-miR5644 | Bra033509 | 20 | 81 | 100 | GUGGGUUGCGGAUAACGGUA | ::: :: :::.::::.:: | CACCUCUAACCGUAACCUAC | Cleavage |
ath-miR8183 | Bra033509 | 21 | 232 | 252 | UUUAGUUGACGGAAUUGUGGC | ....:.::.:::::.::.: | CUUGUAGUUUCGUCAGCUGAC | Cleavage |
ath-miR854a | Bra033509 | 21 | 217 | 237 | GAUGAGGAUAGGGAGGAGGAG | .: : ::::::::::..: | GGUCGCGUCCCUAUCCUUGUA | Cleavage |
ath-miR854b | Bra033509 | 21 | 217 | 237 | GAUGAGGAUAGGGAGGAGGAG | .: : ::::::::::..: | GGUCGCGUCCCUAUCCUUGUA | Cleavage |
ath-miR854c | Bra033509 | 21 | 217 | 237 | GAUGAGGAUAGGGAGGAGGAG | .: : ::::::::::..: | GGUCGCGUCCCUAUCCUUGUA | Cleavage |
ath-miR854d | Bra033509 | 21 | 217 | 237 | GAUGAGGAUAGGGAGGAGGAG | .: : ::::::::::..: | GGUCGCGUCCCUAUCCUUGUA | Cleavage |
ath-miR854e | Bra033509 | 21 | 217 | 237 | GAUGAGGAUAGGGAGGAGGAG | .: : ::::::::::..: | GGUCGCGUCCCUAUCCUUGUA | Cleavage |
ath-miR2934-5p | Bra033509 | 21 | 733 | 753 | UCUUUCUGCAAACGCCUUGGA | :..: :: :::: .::::.:: | UUUAUGGAGUUUCUAGAAGGA | Cleavage |
ath-miR426 | Bra033509 | 21 | 1268 | 1288 | UUUUGGAAAUUUGUCCUUACG | : :::::::. ::.:::. | UUUCAGGACAAGAUUUCAAGU | Cleavage |
ath-miR5632-3p | Bra033509 | 21 | 808 | 828 | UUGGAUUUAUAGUUGGAUAAG | ::: : ..:: ::::.::: | GAUAUGCUGUUACAAAUUCAA | Cleavage |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Anwar, A.; Zhang, S.; Wang, L.; He, L.; Gao, J. BrCYP71A15 Negatively Regulates Hg Stress Tolerance by Modulating Cell Wall Biosynthesis in Yeast. Plants 2023, 12, 723. https://doi.org/10.3390/plants12040723
Anwar A, Zhang S, Wang L, He L, Gao J. BrCYP71A15 Negatively Regulates Hg Stress Tolerance by Modulating Cell Wall Biosynthesis in Yeast. Plants. 2023; 12(4):723. https://doi.org/10.3390/plants12040723
Chicago/Turabian StyleAnwar, Ali, Shu Zhang, Lixia Wang, Lilong He, and Jianwei Gao. 2023. "BrCYP71A15 Negatively Regulates Hg Stress Tolerance by Modulating Cell Wall Biosynthesis in Yeast" Plants 12, no. 4: 723. https://doi.org/10.3390/plants12040723
APA StyleAnwar, A., Zhang, S., Wang, L., He, L., & Gao, J. (2023). BrCYP71A15 Negatively Regulates Hg Stress Tolerance by Modulating Cell Wall Biosynthesis in Yeast. Plants, 12(4), 723. https://doi.org/10.3390/plants12040723