Elevated CO2 Can Worsen Fusarium Head Blight Disease Severity in Wheat but the Fhb1 QTL Provides Reliable Disease Resistance
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Fhb1 Near-Isogenic Lines
4.2. Wheat Growing Conditions
4.3. Disease Assays
4.4. Mycotoxin Analyses
4.5. Estimation of Host and Pathogen Biomass
4.6. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Goswami, R.S.; Kistler, H.C. Heading for disaster: Fusarium graminearum on cereal crops. Mol. Plant Pathol. 2004, 5, 515–525. [Google Scholar] [CrossRef]
- Windels, C.E. Economic and social impacts of Fusarium head blight: Changing farms and rural communities in the Northern Great Plains. Phytopathology 2000, 90, 17–21. [Google Scholar] [CrossRef] [PubMed]
- O’Donnell, K.; Ward, T.J.; Geiser, D.M.; Kistler, H.C.; Aoki, T. Genealogical concordance between the mating type locus and seven other nuclear genes supports formal recognition of nine phylogenetically distinct species within the Fusarium graminearum clade. Fungal Genet. Biol. 2004, 41, 600–623. [Google Scholar] [CrossRef]
- Ward, T.J.; Clear, R.M.; Rooney, A.P.; O’Donnell, K.; Gaba, D.; Patrick, S.; Starkey, D.E.; Gilbert, J.; Geiser, D.M.; Nowicki, T.W. An adaptive evolutionary shift in Fusarium head blight pathogen populations is driving the rapid spread of more toxigenic Fusarium graminearum in North America. Fungal Genet. Biol. 2008, 45, 473–484. [Google Scholar] [CrossRef] [PubMed]
- Brown, N.A.; Urban, M.; van de Meene, A.M.L.; Hammond-Kosack, K.E. The infection biology of Fusarium graminearum: Defining the pathways of spikelet to spikelet colonisation in wheat ears. Fungal Biol. 2010, 114, 555–571. [Google Scholar] [CrossRef] [PubMed]
- Argyris, J.; Van Sanford, D.; TeKrony, D. Fusarium graminearum infection during wheat seed development and its effect on seed quality. Crop Sci. 2003, 43, 1782–1788. [Google Scholar] [CrossRef]
- Awad, W.A.; Ghareeb, K.; Dadak, A.; Hess, M.; Böhm, J. Single and combined effects of deoxynivalenol mycotoxin and a microbial feed additive on lymphocyte DNA damage and oxidative stress in broiler chickens. PLoS ONE 2014, 9, e88028. [Google Scholar] [CrossRef] [PubMed]
- Manstretta, V.; Rossi, V. Effects of temperature and moisture on development of Fusarium graminearum perithecia in maize stalk residues. Appl. Environ. Microbiol. 2016, 82, 184–191. [Google Scholar] [CrossRef]
- McMullen, M.; Jones, R.; Gallenberg, D. Scab of wheat and barley: A re-emerging disease of devastating impact. Plant Dis. 1997, 81, 1340–1348. [Google Scholar] [CrossRef]
- Jung, J.-Y.; Kim, J.-H.; Baek, M.; Cho, C.; Cho, J.; Kim, J.; Pavan, W.; Kim, K.-H. Adapting to the projected epidemics of Fusarium head blight of wheat in Korea under climate change scenarios. Front. Plant Sci. 2022, 13, 1040752. [Google Scholar] [CrossRef]
- Torres, A.M.; Palacios, S.A.; Yerkovich, N.; Palazzini, J.M.; Battilani, P.; Leslie, J.; Logrieco, A.; Chulze, S.N. Fusarium head blight and mycotoxins in wheat: Prevention and control strategies across the food chain. World Mycotoxin J. 2019, 12, 333–355. [Google Scholar] [CrossRef]
- Zhang, X.; Halder, J.; White, R.P.; Hughes, D.; Ye, Z.; Wang, C.; Xu, R.; Gan, B.; Fitt, B.D. Climate change increases risk of fusarium ear blight on wheat in central China. Ann. Appl. Biol. 2014, 164, 384–395. [Google Scholar] [CrossRef]
- Valverde-Bogantes, E.; Bianchini, A.; Herr, J.R.; Rose, D.J.; Wegulo, S.N.; Hallen-Adams, H.E. Recent population changes of Fusarium head blight pathogens: Drivers and implications. Can. J. Plant Pathol. 2020, 42, 315–329. [Google Scholar] [CrossRef]
- Shah, L.; Ali, A.; Yahya, M.; Zhu, Y.; Wang, S.; Si, H.; Rahman, H.; Ma, C. Integrated control of fusarium head blight and deoxynivalenol mycotoxin in wheat. Plant Pathol. 2018, 67, 532–548. [Google Scholar] [CrossRef]
- Blandino, M.; Haidukowski, M.; Pascale, M.; Plizzari, L.; Scudellari, D.; Reyneri, A. Integrated strategies for the control of Fusarium head blight and deoxynivalenol contamination in winter wheat. Field Crops Res. 2012, 133, 139–149. [Google Scholar] [CrossRef]
- Bencze, S.; Puskás, K.; Vida, G.; Karsai, I.; Balla, K.; Komáromi, J.; Veisz, O. Rising atmospheric CO2 concentration may imply higher risk of Fusarium mycotoxin contamination of wheat grains. Mycotoxin Res. 2017, 33, 229–236. [Google Scholar] [CrossRef]
- Cuperlovic-Culf, M.; Vaughan, M.M.; Vermillion, K.; Surendra, A.; Teresi, J.; McCormick, S.P. Effects of atmospheric CO2 level on the metabolic response of resistant and susceptible wheat to Fusarium graminearum infection. Mol. Plant-Microbe Interact. 2019, 32, 379–391. [Google Scholar] [CrossRef] [PubMed]
- Mesterhazy, A. Types and components of resistance to Fusarium head blight of wheat. Plant Breed. 1995, 114, 377–386. [Google Scholar] [CrossRef]
- Berthiller, F.; Krska, R.; Dall’Asta, C.; Lemmens, M.; Adam, G.; Schuhmacher, R. Determination of DON-3-Glucoside in artificially and naturally contaminated wheat with LC-MS/MS. Mycotoxin Res. 2005, 21, 205–208. [Google Scholar] [CrossRef]
- Khan, M.K.; Pandey, A.; Athar, T.; Choudhary, S.; Deval, R.; Gezgin, S.; Hamurcu, M.; Topal, A.; Atmaca, E.; Santos, P.A. Fusarium head blight in wheat: Contemporary status and molecular approaches. 3 Biotech 2020, 10, 172. [Google Scholar] [CrossRef]
- Bai, G.; Kolb, F.L.; Shaner, G.; Domier, L.L. Amplified fragment length polymorphism markers linked to a major quantitative trait locus controlling scab resistance in wheat. Phytopathology 1999, 89, 343–348. [Google Scholar] [CrossRef]
- Waldron, B.; Moreno-Sevilla, B.; Anderson, J.; Stack, R.; Frohberg, R. RFLP mapping of QTL for Fusarium head blight resistance in wheat. Crop Sci. 1999, 39, 805–811. [Google Scholar] [CrossRef]
- Anderson, J.A.; Stack, R.; Liu, S.; Waldron, B.; Fjeld, A.; Coyne, C.; Moreno-Sevilla, B.; Fetch, J.M.; Song, Q.; Cregan, P. DNA markers for Fusarium head blight resistance QTLs in two wheat populations. Theor. Appl. Genet. 2001, 102, 1164–1168. [Google Scholar] [CrossRef]
- Hao, Y.; Rasheed, A.; Zhu, Z.; Wulff, B.B.H.; He, Z. Harnessing Wheat Fhb1 for Fusarium Resistance. Trends Plant Sci. 2020, 25, 1–3. [Google Scholar] [CrossRef] [PubMed]
- Lemmens, M.; Scholz, U.; Berthiller, F.; Dall’Asta, C.; Koutnik, A.; Schuhmacher, R.; Adam, G.; Buerstmayr, H.; Mesterházy, Á.; Krska, R. The ability to detoxify the mycotoxin deoxynivalenol colocalizes with a major quantitative trait locus for Fusarium head blight resistance in wheat. Mol. Plant-Microbe Interact. 2005, 18, 1318–1324. [Google Scholar] [CrossRef] [PubMed]
- Rawat, N.; Pumphrey, M.O.; Liu, S.; Zhang, X.; Tiwari, V.K.; Ando, K.; Trick, H.N.; Bockus, W.W.; Akhunov, E.; Anderson, J.A. Wheat Fhb1 encodes a chimeric lectin with agglutinin domains and a pore-forming toxin-like domain conferring resistance to Fusarium head blight. Nat. Genet. 2016, 48, 1576–1580. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Zhang, X.; Zhang, Y.; Ahmad, D.; Wu, L.; Jiang, P.; Ma, H. Molecular characterization and expression of PFT, an FHB resistance gene at the Fhb1 QTL in wheat. Phytopathology 2018, 108, 730–736. [Google Scholar] [CrossRef]
- Soni, N.; Hegde, N.; Dhariwal, A.; Kushalappa, A.C. Role of laccase gene in wheat NILs differing at QTL-Fhb1 for resistance against Fusarium head blight. Plant Sci. 2020, 298, 110574. [Google Scholar] [CrossRef]
- Soni, N.; Altartouri, B.; Hegde, N.; Duggavathi, R.; Nazarian-Firouzabadi, F.; Kushalappa, A.C. TaNAC032 transcription factor regulates lignin-biosynthetic genes to combat Fusarium head blight in wheat. Plant Sci. 2021, 304, 110820. [Google Scholar] [CrossRef]
- Jia, H.; Zhou, J.; Xue, S.; Li, G.; Yan, H.; Ran, C.; Zhang, Y.; Shi, J.; Jia, L.; Wang, X. A journey to understand wheat Fusarium head blight resistance in the Chinese wheat landrace Wangshuibai. Crop J. 2018, 6, 48–59. [Google Scholar] [CrossRef]
- Su, Z.; Bernardo, A.; Tian, B.; Chen, H.; Wang, S.; Ma, H.; Cai, S.; Liu, D.; Zhang, D.; Li, T. A deletion mutation in TaHRC confers Fhb1 resistance to Fusarium head blight in wheat. Nat. Genet. 2019, 51, 1099–1105. [Google Scholar] [CrossRef]
- Li, G.; Zhou, J.; Jia, H.; Gao, Z.; Fan, M.; Luo, Y.; Zhao, P.; Xue, S.; Li, N.; Yuan, Y. Mutation of a histidine-rich calcium-binding-protein gene in wheat confers resistance to Fusarium head blight. Nat. Genet. 2019, 51, 1106–1112. [Google Scholar] [CrossRef]
- Gunnaiah, R.; Kushalappa, A.C. Metabolomics deciphers the host resistance mechanisms in wheat cultivar Sumai-3, against trichothecene producing and non-producing isolates of Fusarium graminearum. Plant Physiol. Biochem. 2014, 83, 40–50. [Google Scholar] [CrossRef]
- Zhu, Z.; Hao, Y.; Mergoum, M.; Bai, G.; Humphreys, G.; Cloutier, S.; Xia, X.; He, Z. Breeding wheat for resistance to Fusarium head blight in the Global North: China, USA and Canada. Crop J. 2019, 7, 730–738. [Google Scholar] [CrossRef]
- Zhang, Y.; Yang, Z.; Ma, H.; Huang, L.; Ding, F.; Du, Y.; Jia, H.; Li, G.; Kong, Z.; Ran, C. Pyramiding of Fusarium Head Blight resistance quantitative trait loci, Fhb1, Fhb4, and Fhb5, in modern Chinese wheat cultivars. Front. Plant Sci. 2021, 12, 694023. [Google Scholar] [CrossRef]
- Bai, G.; Su, Z.; Cai, J. Wheat resistance to Fusarium head blight. Can. J. Plant Pathol. 2018, 40, 336–346. [Google Scholar] [CrossRef]
- Hay, W.T.; Anderson, J.A.; McCormick, S.P.; Hojilla-Evangelista, M.P.; Selling, G.W.; Utt, K.D.; Bowman, M.J.; Doll, K.M.; Ascherl, K.L.; Berhow, M.A. Fusarium head blight resistance exacerbates nutritional loss of wheat grain at elevated CO2. Sci. Rep. 2022, 12, 15. [Google Scholar] [CrossRef] [PubMed]
- Hay, W.T.; Anderson, J.A.; Garvin, D.F.; McCormick, S.P.; Vaughan, M.M. Fhb1 disease resistance QTL does not exacerbate wheat grain protein loss at elevated CO2. Front. Plant Sci. 2022, 13, 1034406. [Google Scholar] [CrossRef] [PubMed]
- Walkowiak, S.; Subramaniam, R. A nitrogen-responsive gene affects virulence in Fusarium graminearum. Can. J. Plant Pathol. 2014, 36, 224–234. [Google Scholar] [CrossRef]
- Trail, F.; Xu, J.-R.; San Miguel, P.; Halgren, R.G.; Kistler, H.C. Analysis of expressed sequence tags from Gibberella zeae (anamorph Fusarium graminearum). Fungal Genet. Biol. 2003, 38, 187–197. [Google Scholar] [CrossRef]
- Snoeijers, S.S.; Pérez-García, A.; Joosten, M.H.A.J.; De Wit, P.J.G.M. The effect of nitrogen on disease development and gene expression in bacterial and fungal plant pathogens. Eur. J. Plant Pathol. 2000, 106, 493–506. [Google Scholar] [CrossRef]
- Hay, W.T.; McCormick, S.P.; Hojilla-Evangelista, M.P.; Bowman, M.J.; Dunn, R.O.; Teresi, J.M.; Berhow, M.A.; Vaughan, M.M. Changes in wheat nutritional content at elevated [CO2] alter Fusarium graminearum growth and mycotoxin production on grain. J. Agric. Food Chem. 2020, 68, 6297–6307. [Google Scholar] [CrossRef]
- Nawrot, R.; Barylski, J.; Nowicki, G.; Broniarczyk, J.; Buchwald, W.; Goździcka-Józefiak, A. Plant antimicrobial peptides. Folia Microbiol. 2014, 59, 181–196. [Google Scholar] [CrossRef]
- Bent, A.F.; Mackey, D. Elicitors, effectors, and R genes: The new paradigm and a lifetime supply of questions. Annu. Rev. Phytopathol. 2007, 45, 399–436. [Google Scholar] [CrossRef]
- He, Y.; Wu, L.; Liu, X.; Jiang, P.; Yu, L.; Qiu, J.; Wang, G.; Zhang, X.; Ma, H. TaUGT6, a novel UDP-Glycosyltransferase gene enhances the resistance to FHB and DON accumulation in wheat. Front. Plant Sci. 2020, 11, 574775. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Hall, M.D.; Griffey, C.A.; McKendry, A.L. Meta-analysis of QTL associated with Fusarium head blight resistance in wheat. Crop Sci. 2009, 49, 1955–1968. [Google Scholar] [CrossRef]
- Steiner, B.; Buerstmayr, M.; Michel, S.; Schweiger, W.; Lemmens, M.; Buerstmayr, H. Breeding strategies and advances in line selection for Fusarium head blight resistance in wheat. Trop. Plant Pathol. 2017, 42, 165–174. [Google Scholar] [CrossRef]
- Nannuru, V.K.R.; Windju, S.S.; Belova, T.; Dieseth, J.A.; Alsheikh, M.; Dong, Y.; McCartney, C.A.; Henriques, M.A.; Buerstmayr, H.; Michel, S. Genetic architecture of fusarium head blight disease resistance and associated traits in Nordic spring wheat. Theor. Appl. Genet. 2022, 135, 2247–2263. [Google Scholar] [CrossRef] [PubMed]
- Boutigny, A.-L.; Richard-Forget, F.; Barreau, C. Natural mechanisms for cereal resistance to the accumulation of Fusarium trichothecenes. Eur. J. Plant Pathol. 2008, 121, 411–423. [Google Scholar] [CrossRef]
- Zhang, W.; Wang, S.; Yang, J.; Kang, C.; Huang, L.; Guo, L. Glycosylation of plant secondary metabolites: Regulating from chaos to harmony. Environ. Exp. Bot. 2022, 194, 104703. [Google Scholar] [CrossRef]
- Gachon, C.M.; Langlois-Meurinne, M.; Saindrenan, P. Plant secondary metabolism glycosyltransferases: The emerging functional analysis. Trends Plant Sci. 2005, 10, 542–549. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Ahmad, D.; Zhang, X.; Zhang, Y.; Wu, L.; Jiang, P.; Ma, H. Genome-wide analysis of family-1 UDP glycosyltransferases (UGT) and identification of UGT genes for FHB resistance in wheat (Triticum aestivum L.). BMC Plant Biol. 2018, 18, 67. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Sun, S.; Ge, W.; Zhao, L.; Hou, B.; Wang, K.; Lyu, Z.; Chen, L.; Xu, S.; Guo, J. Horizontal gene transfer of Fhb7 from fungus underlies Fusarium head blight resistance in wheat. Science 2020, 368, eaba5435. [Google Scholar] [CrossRef]
- McMullen, M.; Bergstrom, G.; De Wolf, E.; Dill-Macky, R.; Hershman, D.; Shaner, G.; Van Sanford, D. A unified effort to fight an enemy of wheat and barley: Fusarium head blight. Plant Dis. 2012, 96, 1712–1728. [Google Scholar] [CrossRef]
- Busch, R.; McVey, D.; Wiersma, J.; Warnes, D.; Wilcoxson, R.; Hareland, G. Registration of ‘Norm’Wheat. Crop Sci. 1993, 33, 880–881. [Google Scholar] [CrossRef]
- Busch, R.; McVey, D.; Rauch, T.; Baumer, J.; Elsayed, F. Registration of Wheaton wheat. Crop Sci. 1984, 24, 622. [Google Scholar] [CrossRef]
- Bugbee, B.; Koerner, G.; Albbrechtsen, R.; Dewey, W.; Clawson, S. Registration of ‘USU-Apogee’Wheat. Crop Sci. 1997, 37, 626. [Google Scholar] [CrossRef]
- Mackintosh, C.A.; Garvin, D.F.; Radmer, L.E.; Heinen, S.J.; Muehlbauer, G.J. A model wheat cultivar for transformation to improve resistance to Fusarium Head Blight. Plant Cell Rep. 2006, 25, 313–319. [Google Scholar] [CrossRef]
- Röder, M.S.; Korzun, V.; Wendehake, K.; Plaschke, J.; Tixier, M.-H.; Leroy, P.; Ganal, M.W. A microsatellite map of wheat. Genetics 1998, 149, 2007–2023. [Google Scholar] [CrossRef]
- Liu, S.; Zhang, X.; Pumphrey, M.O.; Stack, R.W.; Gill, B.S.; Anderson, J.A. Complex microcolinearity among wheat, rice, and barley revealed by fine mapping of the genomic region harboring a major QTL for resistance to Fusarium head blight in wheat. Funct. Integr. Genom. 2006, 6, 83–89. [Google Scholar] [CrossRef]
- Canadell, J.G.; Monteiro, P.M.; Costa, M.H.; Da Cunha, L.C.; Cox, P.M.; Eliseev, A.V.; Henson, S.; Ishii, M.; Jaccard, S.; Koven, C. Global carbon and other biogeochemical cycles and feedbacks. In Proceedings of the AGU Fall Meeting Abstracts, New Orleans, LA, USA, 13–17 December 2021. [Google Scholar]
Genotype | Genetic Background | Fhb1 QTL | Group | Pedigree |
---|---|---|---|---|
Apogee | S | − | S− | Apogee |
Norm | S | − | S− | Norm |
Wheaton | S | − | S− | Wheaton |
A73 | S | + | S+ | Apogee*5/Sumai 3 |
N1 | S | + | S+ | Norm*5/Sumai 3 |
W4 | S | + | S+ | Wheaton*5/Sumai 3 |
260-4 | M | − | M− | Sumai 3/Stoa RIL 63–4//MN97448 |
HR 45 | M | − | M− | Sumai 3/Stoa RIL 63–4//MN97448 |
HR 123 | M | − | M− | Sumai 3/Stoa RIL 63–4//MN97448 |
260-2 | M | + | M+ | Sumai 3/Stoa RIL 63–4//MN97448 |
HR 56 | M | + | M+ | Sumai 3/Stoa RIL 63–4//MN97448 |
HR 58 | M | + | M+ | Sumai 3/Stoa RIL 63–4//MN97448 |
Primer Name | Organism | Gene Product | Primer Sequence |
---|---|---|---|
Fg.Tri101 Forward | F. graminearum | Trichothecene 3-O-acetyltransferase | GGACTCTGGGATTACGACTTTG |
Fg.Tri101 Reverse | F. graminearum | Trichothecene 3-O-acetyltransferase | ATCAGGCTTCTTGGGCATAAA |
Fg.Tri101 Probe | F. graminearum | Trichothecene 3-O-acetyltransferase | CGAGACTGTGAGACGGCCAATCTTT |
Fg.TEF Forward | F. graminearum | Translation elongation factor | CAGTCACTAACCACCTGTCAAT |
Fg.TEF Reverse | F. graminearum | Translation elongation factor | AATGGTGATACCACGCTCAC |
Fg.TEF Probe | F. graminearum | Translation elongation factor | AACCCAGGCGTACTTGAAGGAACC |
Fg.RED Forward | F. graminearum | Reductase | TGACAGCTTTGGTTGTGTTTG |
Fg.RED Reverse | F. graminearum | Reductase | CTTGGCTGGAATGAGTCTGT |
Fg.RED Probe | F. graminearum | Reductase | CGGAAGACTGCTGAGTAACGCCAA |
Ta.Ef1 Forward | T. aestivum | Elongation factor | GATTGACAGGCGATCTGGTAAG |
Ta.Ef1 Reverse | T. aestivum | Elongation factor | GGCTTGGTGGGAATCATCTT |
Ta.Ef1 Probe | T. aestivum | Elongation factor | TCCTCAAGAATGGTGATGCTGGCA |
Ta.Actin Forward | T. aestivum | Actin | CCAAGGCCAACAGAGAGAAA |
Ta.Actin Reverse | T. aestivum | Actin | GCTGGCATACAAGGACAGAA |
Ta.Actin Probe | T. aestivum | Actin | TGCCCAGCAATGTATGTCGCAATC |
Ta.PAL Forward | T. aestivum | Phenylalanine ammonia-lyase | GTGTTCTGCGAGGTGATGAA |
Ta.PAL Reverse | T. aestivum | Phenylalanine ammonia-lyase | GTATGAGCTTCCCTCCAAGATG |
Ta.PAL Probe | T. aestivum | Phenylalanine ammonia-lyase | AAGCACCACCCTGGACAGATTGAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hay, W.T.; Anderson, J.A.; Garvin, D.F.; McCormick, S.P.; Busman, M.; Vaughan, M.M. Elevated CO2 Can Worsen Fusarium Head Blight Disease Severity in Wheat but the Fhb1 QTL Provides Reliable Disease Resistance. Plants 2023, 12, 3527. https://doi.org/10.3390/plants12203527
Hay WT, Anderson JA, Garvin DF, McCormick SP, Busman M, Vaughan MM. Elevated CO2 Can Worsen Fusarium Head Blight Disease Severity in Wheat but the Fhb1 QTL Provides Reliable Disease Resistance. Plants. 2023; 12(20):3527. https://doi.org/10.3390/plants12203527
Chicago/Turabian StyleHay, William T., James A. Anderson, David F. Garvin, Susan P. McCormick, Mark Busman, and Martha M. Vaughan. 2023. "Elevated CO2 Can Worsen Fusarium Head Blight Disease Severity in Wheat but the Fhb1 QTL Provides Reliable Disease Resistance" Plants 12, no. 20: 3527. https://doi.org/10.3390/plants12203527