Multiple-Genome-Based Simple Sequence Repeat Is an Efficient and Successful Method in Genotyping and Classifying Different Jujube Germplasm Resources
Abstract
1. Introduction
2. Results
2.1. Identification and Screening of SSRs in Three Jujube Genomes
2.2. Primer Designing and PCR Amplification of Polymorphic SSRs
2.3. Population Analysis of Jujube Based on SSR Markers
2.4. Molecular Identity Card of Jujube Varieties
3. Discussion
- (1)
- Efficient SSR screening: The utilization of multiple closely related genomes in the MGB-SSR approach allows for the identification and elimination of invalid sites that are identical across genomes, and this avoids the massive selection from thousands of candidate SRRs. This significantly reduces the time and financial resources required for screening.
- (2)
- Enhanced accuracy with capillary electrophoresis: By combining SSR screening with capillary electrophoresis, the MGB-SSR method overcomes the limitations associated with traditional gel electrophoresis. Issues such as uneven distribution of PCR products between lanes due to variations in gel concentration and voltage are eliminated, resulting in more accurate and reliable test results.
- (3)
- Universal applicability: With advancements in sequencing technology, it has become feasible to obtain 2–3 closely related genomes for most fruit trees. This means that the SSR markers developed using MGB-SSR can be applied across various species within the same family or even different genera. Furthermore, genetic diversity analysis has demonstrated that the SSR markers developed through MGB-SSR exhibit significant polymorphism, as indicated by the Na, Ne, and PIC parameters meeting the standard criteria.
- (4)
- Detectable polyploidy: The MGB-SSR method has shown effectiveness in detecting polyploid jujube germplasm resources. With the increasing number of jujube hybrid varieties, the evaluation and identification of polyploid jujube are becoming more important. In this study, four of the SSR markers utilized effectively characterized polyploidy in jujube, demonstrating their potential for this application.
- (5)
- Compared to utilizing markers from the SNP array and the commonly used WGS strategy, which require a substantial amount of genome re-sequencing for genotyping and classifying different jujube germplasm resources, our method using only 12 SSRs significantly reduces both time and financial costs.
4. Materials and Methods
4.1. Availability of the Jujube Genomic Data
4.2. Plant Material and DNA Extraction
4.3. Preliminary SSR Identification of Jujube Genome
4.4. SSR Screening of Three Jujube Cultivar Genome Polymorphisms
- (1)
- Create Blast databases for the three jujube genomes.
- (2)
- The SSR sequences were subjected to Blast alignment against the corresponding jujube genome database, and subsequently, non-unique results were removed, retaining only the specific SSRs.
- (3)
- The remaining specific SSRs were subjected to a mutual comparison with the other two jujube genome databases. During this comparison, any results that were found to be identical within any of the two jujube genomes were discarded. Additionally, SSRs showing less than 90% consistency across the three genomes were also excluded.
- (4)
- All the remaining results were statistically merged, and those with consistent conservative sequences at both ends but differing core repeat units were selected.
- (5)
- Eliminate the results that show differences only between two genomes, thus highlighting the variations among the three genomes at the SSR level.
4.5. Design and Detection of Polymorphic SSR Primers
- (1)
- They were designed in conserved regions near both ends of the core repeat sequences;
- (2)
- The length of the amplicons ranged between 50 and 300 bp;
- (3)
- The primers had similar annealing temperatures;
- (4)
- To prevent primer dimers, there was no complementary sequence between the primers;
- (5)
- Primer specificity was assessed using NCBI-BLAST;
- (6)
- The upstream primer had an 18 bp M13 linker sequence added to the 5′ end, which matched with fluorescent linker primers of different colors (FAM blue, HEX green, ROX red, and TAME black).
4.6. Primer Performance Evaluation
4.7. PCR Amplification System
4.8. PCR Product Detection by Capillary Electrophoresis
4.9. Data Analysis and Application
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Liu, M.J.; Zhao, Z.H. Germplasm resources and production of jujube in China. Acta Hortic. 2009, 840, 25–32. [Google Scholar] [CrossRef]
- Liu, M.; Wang, J.; Wang, L.; Liu, P.; Zhao, J.; Zhao, Z.; Yao, S.; Stanica, F.; Liu, Z.; Wang, L.; et al. The historical and current research progress on jujube-a superfruit for the future. Hortic. Res. 2020, 7, 119. [Google Scholar] [CrossRef]
- Uddin, N.; Ali, N.; Nisar, M.; Liu, M.; Liu, Z.; Muhammad, N.; Rahman, I.U. SSR-based population structure, molecular diversity and identity cards of Ziziphus species from Pakistan and China. Genet. Resour. Crop Evol. 2021, 68, 2391–2409. [Google Scholar] [CrossRef]
- Xu, C.; Gao, J.; Du, Z.; Li, D.; Wang, Z.; Li, Y.; Pang, X. Identifying the genetic diversity, genetic structure and a core collection of Ziziphus jujuba Mill. Var. Jujuba accessions using microsatellite markers. Sci. Rep. 2016, 6, 31503. [Google Scholar] [CrossRef] [PubMed]
- Muhammad, N.; Luo, Z.; Yang, M.; Liu, Z.; Liu, M. The nutritional, medicinal, and drought-resistance properties of Ziziphus Mill. make it an important candidate for alleviating food insecurity in arid regions—A case of Pakistan. Horticulturae 2022, 8, 867. [Google Scholar] [CrossRef]
- Khadivi, A.; Mirheidari, F.; Moradi, Y.; Paryan, S. Identification of superior jujube (Ziziphus jujuba Mill.) genotypes based on morphological and fruit characterizations. Food Sci. Nutr. 2021, 9, 3165–3176. [Google Scholar] [CrossRef] [PubMed]
- Zarei, A.; Rezaei, A.; Esmailpour, M.; Ebrahimi, A. A comparative assessment of morphological and molecular characterization among three Ziziphus species. Physiol. Mol. Biol. Plants 2021, 27, 1007–1025. [Google Scholar] [CrossRef]
- Pianzzola, M.J.; Moscatelli, M.; Vero, S. Characterization of penicillium isolates associated with blue mold on apple in uruguay. Plant Dis. 2004, 88, 23–28. [Google Scholar] [CrossRef]
- Griffiths, H.M.; Sinclair, W.A.; Boudon-Padieu, E.; Daire, X.; Lee, I.M.; Sfalanga, A.; Bertaccini, A. Phytoplasmas associated with elm yellows: Molecular variability and differentiation from related organisms. Plant Dis. 1999, 83, 1101–1104. [Google Scholar] [CrossRef]
- Lu, Z.; Hui, N.; Wang, L.; Zheng, G.; Wang, S.; Li, J. Genetic diversity of Venturia inaequalis isolates from the scabs in apple trees in Gansu province, China, using AFLP markers. PeerJ 2022, 10, e14512. [Google Scholar] [CrossRef]
- Xu, R.; Hu, D.; Chen, Z.; Zhang, P.; Jiang, X.; Tang, G. Srap analysis on genetic relationships of genotypes in the genus Malus mill. Biotechnol. Biotechnol. Equip. 2014, 28, 602–607. [Google Scholar] [CrossRef]
- Nishio, S.; Kunihisa, M.; Taniguchi, F.; Kajiya-Kanegae, H.; Moriya, S.; Takeuchi, Y.; Sawamura, Y. Development of ssr databases available for both NGS and capillary electrophoresis in apple, pear, and tea. Plants 2021, 10, 2796. [Google Scholar] [CrossRef] [PubMed]
- De Mori, G.; Cipriani, G. Marker-assisted selection in breeding for fruit trait improvement: A review. Int. J. Mol. Sci. 2023, 24, 8984. [Google Scholar] [CrossRef]
- Chen, W.; Hou, L.; Zhang, Z.; Pang, X.; Li, Y. Genetic diversity, population structure, and linkage disequilibrium of a core collection of Ziziphus jujuba assessed with genome-wide SNPs developed by genotyping-by-sequencing and SSR markers. Front. Plant Sci. 2017, 8, 575. [Google Scholar] [CrossRef] [PubMed]
- Uddin, N.; Muhammad, N.; Ali, S.S.; Ullah, R.; Bari, A.; Hussain, H.; Zhu, D. Characterization of the Genetic Variability within Ziziphus nummularia Genotypes by Phenotypic Traits and SSR Markers with Special Reference to Geographic Distribution. Genes 2023, 14, 155. [Google Scholar] [CrossRef] [PubMed]
- Bao, W.; Wuyun, T.; Wang, L.; Zhao, H. Genetic diversity and population structure of wild apricot in Xinjiang revealed by SSR markers. Acta Bot. Boreali Occident. Sin. 2016, 36, 1757–1763. [Google Scholar]
- Zhang, D.Q.; Zhou, N. Genetic diversity and population structure of the endangered conifer Taxus wallichiana var. mairei (Taxaceae) revealed by Simple Sequence Repeat (SSR) markers. Biochem. Syst. Ecol. 2013, 49, 107–114. [Google Scholar] [CrossRef]
- Aksehirli-Pakyurek, M.; Koubouris, G.C.; Petrakis, P.V.; Hepaksoy, S.; Metzidakis, I.T.; Yalcinkaya, E. Cultivated and Wild Olives in Crete, Greece-Genetic Diversity and Relationships with Major Turkish Cultivars Revealed by SSR Markers. Plant Mol. Biol. Rep. 2017, 35, 575–585. [Google Scholar] [CrossRef]
- Liu, Z.L.; Wan, S.L.; Yan, C.P.; Hu, Z.D.; He, X.H.; Zeng, P.Z. Genetic Diversity of Jinsha Pomelo and Its Closely-related Germplasms Assessed by SSR Molecular Markers. Agric. Biotechnol. 2017, 6, 15–22. [Google Scholar]
- Hinge, V.R.; Shaikh, I.M.; Chavhan, R.L.; Deshmukh, A.S.; Shelake, R.M.; Ghuge, S.A.; Dethe, A.M.; Suprasanna, P.; Kadam, U.S. Assessment of genetic diversity and volatile content of commercially grown banana (Musa spp.) cultivars. Sci. Rep. 2022, 12, 7979. [Google Scholar] [CrossRef]
- Chavhan, R.L.; Sable, S.; Narwade, A.V.; Hinge, V.R.; Kalbande, B.B.; Mukherjee, A.K.; Chakrabarty, P.K.; Kadam, U.S. Multiplex molecular marker-assisted analysis of significant pathogens of cotton (Gossypium sp.). Biocatal. Agric. Biotechnol. 2023, 47, 102557. [Google Scholar] [CrossRef]
- Yılmaz, F.; Shidfar, M.; Hazrati, N.; Kazan, K.; Yüksel Özmen, C.; Uysal, T.; Özer, C.; Yaşasın, A.S.; Söylemezoğlu, G.; Boz, Y.; et al. Genetic analysis of central Anatolian grapevine (Vitis vinifera L.) germplasm by simple sequence repeats. Tree Genet. Genomes 2020, 16, 55. [Google Scholar] [CrossRef]
- Upadhyay, A.; Kadam, U.S.; Chacko, P.; Karibasappa, G.S. Microsatellite and RAPD analysis of grape (Vitis spp.) accessions and identification of duplicates/misnomers in germplasm collection. Indian J. Hortic. 2010, 67, 8–15. [Google Scholar]
- Upadhyay, A.; Kadam, U.S.; Chacko, P.M.; Aher, L.; Karibasappa, G.S. Microsatellite analysis to differentiate clones of thompson seedless grapevine. Indian J. Hortic. 2010, 67, 260–263. [Google Scholar]
- Vieira, M.L.C.; Santini, L.; Diniz, A.L.; Munhoz, C.D. Microsatellite markers: What they mean and why they are so useful. Genet. Mol. Biol. 2016, 39, 312–328. [Google Scholar] [CrossRef]
- Li, L.; Fang, Z.; Zhou, J.; Chen, H.; Hu, Z.; Gao, L.; Chen, L.; Ren, S.; Ma, H.; Lu, L.; et al. An accurate and efficient method for large-scale ssr genotyping and applications. Nucleic Acids Res. 2017, 45, e88. [Google Scholar] [CrossRef] [PubMed]
- Fan, R.; Ling, P.; Hao, C.Y.; Li, F.P.; Huang, L.F.; Wu, B.D.; Wu, H.S. Construction of a cDNA library and preliminary analysis of expressed sequence tags in Piper hainanense. Genet. Mol. Res. 2015, 14, 12733–12745. [Google Scholar] [CrossRef]
- Aberlenc-Bertossi, F.; Castillo, K.; Tranchant-Dubreuil, C.; Cherif, E.; Ballardini, M.; Abdoulkader, S.; Gros-Balthazard, M.; Chabrillange, N.; Santoni, S.; Mercuri, A.; et al. In silico mining of microsatellites in coding sequences of the date palm (Arecaceae) genome, characterization, and transferability. Appl. Plant Sci. 2014, 2, 1300058. [Google Scholar] [CrossRef]
- Wang, S.; Liu, Y.; Ma, L.; Liu, H.; Tang, Y.; Wu, L.; Wang, Z.; Li, Y.; Wu, R.; Pang, X. Isolation and characterization of microsatellite markers and analysis of genetic diversity in Chinese jujube (Ziziphus jujuba Mill.). PLoS ONE 2014, 9, e99842. [Google Scholar] [CrossRef] [PubMed]
- Borsting, C.; Morling, N. Next-generation sequencing and its applications in forensic genetics. Forensic Sci. Int. Genet. 2015, 18, 78–89. [Google Scholar] [CrossRef]
- Tian, R.; Zhang, C.; Huang, Y.; Guo, X.; Chen, M. A novel software and method for the efficient development of polymorphic SSR loci based on transcriptome data. Genes 2019, 10, 917. [Google Scholar] [CrossRef]
- Meglecz, E.; Pech, N.; Gilles, A.; Dubut, V.; Hingamp, P.; Trilles, A.; Grenier, R.; Martin, J.F. Qdd version 3.1, A user-friendly computer program for microsatellite selection and primer design revisited: Experimental validation of variables determining genotyping success rate. Mol. Ecol. Resour. 2014, 14, 1302–1313. [Google Scholar] [CrossRef] [PubMed]
- Chamberlain, J.S.; Gibbs, R.A.; Ranier, J.E.; Nguyen, P.N.; Caskey, C.T. Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification. Nucleic Acids Res. 1988, 16, 11141–11156. [Google Scholar] [CrossRef] [PubMed]
- Fu, Z.Y.; Sa, K.J.; Park, H.; Jang, S.J.; Kim, Y.J.; Lee, J.K. Utilization of novel perilla ssr markers to assess the genetic diversity of native perilla germplasm accessions collected from South Korea. Plants 2022, 11, 2974. [Google Scholar] [CrossRef] [PubMed]
- Cai, J.; Yang, X.; Yu, W.; Xiang, P.; Zhang, S.; Wang, G. The diversity of Melia azedarach L. From China based on transcriptome-developed ssr marker. Forests 2022, 13, 1011. [Google Scholar] [CrossRef]
- Richards, C.M.; Volk, G.M.; Reilley, A.A.; Henk, A.D.; Lockwood, D.R.; Reeves, P.A.; Forsline, P.L. Genetic diversity and population structure in Malus sieversii, a wild progenitor species of domesticated apple. Tree Genet. Genomes 2009, 5, 339–347. [Google Scholar] [CrossRef]
- Dirlewanger, E.; Cosson, P.; Tavaud, M.; Aranzana, J.; Poizat, C.; Zanetto, A.; Arus, P.; Laigret, F. Development of microsatellite markers in peach [Prunus persica (L.) batsch] and their use in genetic diversity analysis in peach and sweet cherry (Prunus avium L.). Theor. Appl. Genet. 2002, 105, 127–138. [Google Scholar] [CrossRef]
- Cipriani, G.; Marrazzo, M.T.; Di Gaspero, G.; Pfeiffer, A.; Morgante, M.; Testolin, R. A set of microsatellite markers with long core repeat optimized for grape (Vitis spp.) genotyping. BMC Plant Biol. 2008, 8, 127. [Google Scholar] [CrossRef]
- Carrasco, B.; Diaz, C.; Moya, M.; Gebauer, M.; Garcia-Gonzalez, R. Genetic characterization of Japanese plum cultivars (prunus salicina) using ssr and iSSR molecular markers. Cienc. E Investig. Agrar. 2012, 39, 533–543. [Google Scholar] [CrossRef]
- Mahjbi, A.; Oueslati, A.; Baraket, G.; Salhi-Hannachi, A.; Zehdi Azouzi, S. Assessment of genetic diversity of Tunisian orange, Citrus sinensis (L.) osbeck using microsatellite (SSR) markers. Genet. Mol. Res. 2016, 15, 1–12. [Google Scholar] [CrossRef]
- Nishio, S.; Takada, N.; Saito, T.; Yamamoto, T.; Iketani, H. Estimation of loss of genetic diversity in modern Japanese cultivars by comparison of diverse genetic resources in Asian pear (Pyrus spp.). BMC Genet. 2016, 17, 81. [Google Scholar] [CrossRef]
- Tsai, C.C.; Chen, Y.U.K.H.; Chen, C.H.; Weng, I.S.; Tsai, C.M.; Lee, S.R.; Lin, Y.S.; Chiang, Y.C. Cultivar identification and genetic relationship of mango (Mangifera indica) in Taiwan using 37 SSR markers. Sci. Hortic. 2013, 164, 196–201. [Google Scholar] [CrossRef]
- Lai, J.M.; Tsai, C.C.; Yen, C.R.; Ko, Y.Z.; Chen, S.R.; Weng, I.S.; Lin, Y.S.; Chiang, Y.C. Molecular characterization of twenty polymorphic microsatellite markers in the polyploid fruit tree species Syzygium samarangense (Myrtaceae). Genet. Mol. Res. 2015, 14, 13013–13021. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Zhao, Q.; Wu, G.; Zhang, S.; Jiang, T. Development of novel SSR markers for flax (Linum usitatissimum L.) using reduced-representation genome sequencing. Front. Plant Sci. 2016, 7, 2018. [Google Scholar] [CrossRef]
- Guo, R.; Landis, J.B.; Moore, M.J.; Meng, A.; Jian, S.; Yao, X.; Wang, H. Development and application of transcriptome-derived microsatellites in Actinidia eriantha (Actinidiaceae). Front. Plant Sci. 2017, 8, 1383. [Google Scholar] [CrossRef]
- Malausa, T.; Gilles, A.; Meglecz, E.; Blanquart, H.; Duthoy, S.; Costedoat, C.; Dubut, V.; Pech, N.; Castagnone-Sereno, P.; Delye, C.; et al. High-throughput microsatellite isolation through 454 GS-FLX titanium pyrosequencing of enriched DNA libraries. Mol. Ecol. Resour. 2011, 11, 638–644. [Google Scholar] [CrossRef]
- Chen, L.; Ma, Q.; Chen, Y.; Wang, B.; Pei, D. Identification of major walnut cultivars grown in China based on nut phenotypes and SSR markers. Sci. Hortic. 2014, 168, 240–248. [Google Scholar] [CrossRef]
- Pavan Kumar, P.; Janakiram, T.; Bhat, K.V. Microsatellite based DNA fingerprinting and assessment of genetic diversity in bougainvillea cultivars. Gene 2020, 753, 144794. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Xu, X.; Wu, P.; Zhang, G.; Zhang, X. Establishment of molecular identity cards for Cucumis melo cultivars using ssr markers. HortScience 2018, 53, 138–143. [Google Scholar] [CrossRef]
- Luan, M.B.; Chen, B.F.; Zou, Z.Z.; Zhu, J.J.; Wang, X.F.; Xu, Y.; Sun, Z.M.; Chen, J.H. Molecular identity of ramie germplasms using simple sequence repeat markers. Genet. Mol. Res. 2015, 14, 2302–2311. [Google Scholar] [CrossRef]
- Liu, M.J.; Zhao, J.; Cai, Q.L.; Liu, G.C.; Wang, J.R.; Zhao, Z.H.; Liu, P.; Dai, L.; Yan, G.; Wang, W.J.; et al. The complex jujube genome provides insights into fruit tree biology. Nat. Commun. 2014, 5, 5315. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Zhang, C.; Zhao, X.; Fei, Z.; Wan, K.; Zhang, Z.; Pang, X.; Yin, X.; Bai, Y.; Sun, X.; et al. The jujube genome provides insights into genome evolution and the domestication of sweetness/acidity taste in fruit trees. PLoS Genet. 2016, 12, e1006433. [Google Scholar] [CrossRef] [PubMed]
- Shen, L.Y.; Luo, H.; Wang, X.L.; Wang, X.M.; Qiu, X.J.; Liu, H.; Zhou, S.S.; Jia, K.H.; Nie, S.; Bao, Y.T.; et al. Chromosome-scale genome assembly for Chinese sour jujube and insights into its genome evolution and domestication signature. Front. Plant Sci. 2021, 12, 773090. [Google Scholar] [CrossRef] [PubMed]
- Doyle, J.J. Isolation of plant DNA from fresh tissue. Focus 1990, 12, 13–15. [Google Scholar]
- Beier, S.; Thiel, T.; Munch, T.; Scholz, U.; Mascher, M. Misa-web: A web server for microsatellite prediction. Bioinformatics 2017, 33, 2583–2585. [Google Scholar] [CrossRef]
- Singh, V.K.; Mangalam, A.K.; Dwivedi, S.; Naik, S. Primer premier: Program for design of degenerate primers from a protein sequence. Biotechniques 1998, 24, 318–319. [Google Scholar] [CrossRef] [PubMed]
- Paradis, E.; Schliep, K. Ape 5.0, An environment for modern phylogenetics and evolutionary analyses in R. Bioinformatics 2019, 35, 526–528. [Google Scholar] [CrossRef]
- Yu, G. Using ggtree to visualize data on tree-like structures. Curr. Protoc. Bioinform. 2020, 69, e96. [Google Scholar] [CrossRef]
- Yu, G.; Lam, T.T.; Zhu, H.; Guan, Y. Two methods for mapping and visualizing associated data on phylogeny using ggtree. Mol. Biol. Evol. 2018, 35, 3041–3043. [Google Scholar] [CrossRef]
- Gao, Y.; Liu, F.Z.; Wang, K.; Wang, D.J.; Gong, X.; Liu, L.J. Establishment of molecular id for some apple germplasm resources. Sci. Agric. Sin. 2015, 48, 3887–3898. [Google Scholar]
Core Sequence (bp) | 3 | 4 | 5 | 6 | Total |
---|---|---|---|---|---|
‘Dongzao’ (437.7 Mb) | 361,995 (71.12%) | 102,275 (20.09%) | 28,154 (5.53%) | 16,542 (3.25%) | 508,966 (100%) |
‘JunZao’ (351 Mb) | 324,838 (71.29%) | 90,541 (19.87%) | 25,444 (5.58%) | 14,831 (3.25%) | 455,654 (100%) |
‘SuanZao’ (406 Mb) | 359,973 (71.04%) | 102,309 (20.19%) | 28,076 (5.54%) | 16,372 (3.23%) | 506,730 (100%) |
SSR Marker | Lengths | Primer Orientation | Primer Sequence 5′-3′ | Core Unit | Dye |
---|---|---|---|---|---|
LSSR-4 | 209 | Reverse | ATGCTGCCAGGAGTGTTCAATA | (GCA)7 | ROX |
Forward | GCCTTCGTCTAATTCCTCTCTGAT | ||||
LSSR-6 | 309 | Reverse | GCTCTATTTCTCTACCATTCTCACACT | (CAT)4 | ROX |
Forward | CATTCAGCATCAACAATATCCTCCA | ||||
LSSR-8 | 252 | Reverse | CCATTGGTAACAGCAAGTT | (GAA)6 | TAME |
Forward | TAGTCTCTTCTCTGGCTATAC | ||||
LSSR-10 | 129 | Reverse | GAAAGCCATAACTCGTTGATCTTGT | (CTTG)5 | FAM |
Forward | GCTCGCCACATAACAGGATACA | ||||
LSSR-17 | 141 | Reverse | CAAGAAGATACAAACCCACCAATCA | (GACA)4 | HEX |
Forward | TGGAGGACTGTTCCTACCAATAC | ||||
LSSR-22 | 267 | Reverse | AACAGACATGGCTATGGTGGAATT | (TTA)6 | TAME |
Forward | CAAAGACCGAAAGAAAGTTCAGCAA | ||||
LSSR-23 | 217 | Reverse | ATGAAGTCGTCGCTGTCAAGTG | (TAT)4 | ROX |
Forward | CAAGATCCAGCCAAAGTCAAAGTTT | ||||
LSSR-25 | 121 | Reverse | CCAGAACTACTCAGAACTTCTATCATC | (AAT)4 | FAM |
Forward | TAGCGTTTGCAGGTTGCTTAGT | ||||
LSSR-26 | 172 | Reverse | GGAAGGACTTTGTCAGCATGGTAG | (GTT)12 | HEX |
Forward | AACAGCATATTTGGATCCATTTCG | ||||
LSSR-27 | 136 | Reverse | CACTGCAAATGCTTTGTCATCTTT | (TATG)6 | FAM |
Forward | AAAGCATCACCCATCCTCTACATC | ||||
LSSR-28 | 257 | Reverse | CGTGGACCAAGTCTATACCAAAATG | (ATA)9 | TAME |
Forward | TGGTTTTTCTTCTCCTAATCCATGTG | ||||
LSSR-29 | 145 | Reverse | TCAATAATTCCAGCCGAATCCTTA | (TATA)5 | HEX |
Forward | TGGGAGTCTAGCTTCATTCAAACA |
SSR Marker | Na | Ne | HObs | HExp | PIC |
---|---|---|---|---|---|
LSSR-4 | 5 | 2.0396 | 0.485 | 0.511 | 0.431 |
LSSR-6 | 5 | 2.922 | 0.845 | 0.659 | 0.598 |
LSSR-8 | 11 | 6.1057 | 0.732 | 0.839 | 0.818 |
LSSR-10 | 10 | 2.994 | 0.576 | 0.68 | 0.624 |
LSSR-17 | 9 | 2.919 | 0.604 | 0.663 | 0.633 |
LSSR-22 | 15 | 6.198 | 0.551 | 0.841 | 0.823 |
LSSR-23 | 9 | 5.2615 | 0.752 | 0.812 | 0.783 |
LSSR-25 | 6 | 2.2674 | 0.461 | 0.56 | 0.461 |
LSSR-26 | 15 | 7.8924 | 0.853 | 0.875 | 0.861 |
LSSR-27 | 9 | 4.3823 | 0.506 | 0.786 | 0.751 |
LSSR-28 | 6 | 2.1094 | 0.444 | 0.527 | 0.426 |
LSSR-29 | 6 | 2.7283 | 0.646 | 0.635 | 0.564 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, B.; Muhammad, N.; Zhang, S.; Lan, Y.; Yang, Y.; Han, S.; Liu, M.; Yang, M. Multiple-Genome-Based Simple Sequence Repeat Is an Efficient and Successful Method in Genotyping and Classifying Different Jujube Germplasm Resources. Plants 2023, 12, 2885. https://doi.org/10.3390/plants12152885
Li B, Muhammad N, Zhang S, Lan Y, Yang Y, Han S, Liu M, Yang M. Multiple-Genome-Based Simple Sequence Repeat Is an Efficient and Successful Method in Genotyping and Classifying Different Jujube Germplasm Resources. Plants. 2023; 12(15):2885. https://doi.org/10.3390/plants12152885
Chicago/Turabian StyleLi, Bin, Noor Muhammad, Shufeng Zhang, Yunxin Lan, Yihan Yang, Shoukun Han, Mengjun Liu, and Meng Yang. 2023. "Multiple-Genome-Based Simple Sequence Repeat Is an Efficient and Successful Method in Genotyping and Classifying Different Jujube Germplasm Resources" Plants 12, no. 15: 2885. https://doi.org/10.3390/plants12152885
APA StyleLi, B., Muhammad, N., Zhang, S., Lan, Y., Yang, Y., Han, S., Liu, M., & Yang, M. (2023). Multiple-Genome-Based Simple Sequence Repeat Is an Efficient and Successful Method in Genotyping and Classifying Different Jujube Germplasm Resources. Plants, 12(15), 2885. https://doi.org/10.3390/plants12152885