The Knockdown of AUXIN RESPONSE FACTOR 2 Confers Enhanced Tolerance to Salt and Drought Stresses in Tomato (Solanum lycopersicum L.)
Abstract
1. Introduction
2. Results
2.1. SlARF2 Gene Displays a Strong Expression in Different Tomato Organs
2.2. SlARF2 Is Induced by Salt and Drought Stresses
2.3. Downregulation of SlARF2AB Improves Growth and Physiological Parameters in Salt and Drought Stress Conditions
2.4. Under-Expression of SlARF2-Enhanced Chlorophyll, Sugars, and Proline Contents in Salt and Drought Stress Conditions
2.5. SlARF2AB-RNAi Transgenic Plants Displayed Lower MDA with an Increase in Antioxidant Enzyme Activities in Response to Salt and Drought Stresses
2.6. Stress-Related Genes Are Regulated by Salt and Drought Stresses in SlARF2 Knockdown Mutant
3. Discussion
3.1. SlARF2 Gene Expression Is Induced by Salt and Drought Stresses
3.2. ARF2AB Silencing Confers Enhanced Salt and Drought Tolerance in Tomato
3.3. SlARF2AB-RNAi Modulates the Expression of Stress-Related Genes in Tomato under Salt and Drought Stress Conditions
4. Materials and Methods
4.1. Plant Materials
4.2. Histochemical Analysis of Gus Expression
4.3. Plant Growth and Stress Treatment Assays
4.4. Determination of Morphological and Physiological Traits
4.4.1. Measurement of Chlorophyll Content
4.4.2. Determination of Soluble Sugar Content
4.4.3. Determination of Leaf Stomatal Conductance and Transpiration Rate
4.4.4. Determination of Relative Water Content
4.4.5. Determination of Proline Content
4.4.6. Determination of MDA Content
4.5. Antioxidative Enzyme Activities Test
4.6. RNA Extraction and Quantitative Real-Time PCR Analysis
4.7. Statistical Analysis Method
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Pruthvi, V.; Narasimhan, R.; Nataraja, K.N. Simultaneous Expression of Abiotic Stress Responsive Transcription Factors, AtDREB2A, AtHB7 and AtABF3 Improves Salinity and Drought Tolerance in Peanut (Arachis hypogaea L.). PLoS ONE 2014, 9, e111152. [Google Scholar] [CrossRef] [PubMed]
- Peleg, Z.; Blumwald, E. Hormone Balance and Abiotic Stress Tolerance in Crop Plants. Curr. Opin. Plant Biol. 2011, 14, 290–295. [Google Scholar] [CrossRef] [PubMed]
- Roosjen, M.; Paque, S.; Weijers, D. Auxin Response Factors: Output Control in Auxin Biology. J. Exp. Bot. 2018, 69, 179–188. [Google Scholar] [CrossRef] [PubMed]
- Sharma, E.; Sharma, R.; Borah, P.; Jain, M.; Khurana, J.P. Emerging Roles of Auxin in Abiotic Stress Responses. Elucidation Abiotic Stress Signal. Plants Funct. Genom. Perspect. 2015, 1, 299–328. [Google Scholar]
- Verma, S.; Negi, N.P.; Pareek, S.; Mudgal, G.; Kumar, D. Auxin Response Factors in Plant Adaptation to Drought and Salinity Stress. Physiol. Plant. 2022, 174, e13714. [Google Scholar] [CrossRef]
- Yuan, Y.; Xu, X.; Gong, Z.; Tang, Y.; Wu, M.; Yan, F.; Zhang, X.; Zhang, Q.; Yang, F.; Hu, X. Auxin Response Factor 6A Regulates Photosynthesis, Sugar Accumulation, and Fruit Development in Tomato. Hortic. Res. 2019, 6, 85. [Google Scholar] [CrossRef]
- Zouine, M.; Fu, Y.; Chateigner-Boutin, A.-L.; Mila, I.; Frasse, P.; Wang, H.; Audran, C.; Roustan, J.-P.; Bouzayen, M. Characterization of the Tomato ARF Gene Family Uncovers a Multi-Levels Post-Transcriptional Regulation Including Alternative Splicing. PLoS ONE 2014, 9, e84203. [Google Scholar] [CrossRef]
- Chen, M.; Zhu, X.; Liu, X.; Wu, C.; Yu, C.; Hu, G.; Chen, L.; Chen, R.; Bouzayen, M.; Zouine, M. Knockout of Auxin Response Factor SlARF4 Improves Tomato Resistance to Water Deficit. Int. J. Mol. Sci. 2021, 22, 3347. [Google Scholar] [CrossRef]
- Liscum, E.; Reed, J. Genetics of Aux/IAA and ARF Action in Plant Growth and Development. Plant Mol. Biol. 2002, 49, 387–400. [Google Scholar] [CrossRef]
- Xing, H.; Pudake, R.N.; Guo, G.; Xing, G.; Hu, Z.; Zhang, Y.; Sun, Q.; Ni, Z. Genome-Wide Identification and Expression Profiling of Auxin Response Factor (ARF) Gene Family in Maize. BMC Genom. 2011, 12, 178. [Google Scholar] [CrossRef]
- Wang, D.; Pei, K.; Fu, Y.; Sun, Z.; Li, S.; Liu, H.; Tang, K.; Han, B.; Tao, Y. Genome-Wide Analysis of the Auxin Response Factors (ARF) Gene Family in Rice (Oryza sativa). Gene 2007, 394, 13–24. [Google Scholar] [CrossRef] [PubMed]
- Van Ha, C.; Le, D.T.; Nishiyama, R.; Watanabe, Y.; Sulieman, S.; Tran, U.T.; Mochida, K.; Van Dong, N.; Yamaguchi-Shinozaki, K.; Shinozaki, K. The Auxin Response Factor Transcription Factor Family in Soybean: Genome-Wide Identification and Expression Analyses during Development and Water Stress. DNA Res. 2013, 20, 511–524. [Google Scholar] [CrossRef] [PubMed]
- Tang, Y.; Bao, X.; Liu, K.; Wang, J.; Zhang, J.; Feng, Y.; Wang, Y.; Lin, L.; Feng, J.; Li, C. Genome-Wide Identification and Expression Profiling of the Auxin Response Factor (ARF) Gene Family in Physic Nut. PLoS ONE 2018, 13, e0201024. [Google Scholar] [CrossRef] [PubMed]
- Mun, J.-H.; Yu, H.-J.; Shin, J.Y.; Oh, M.; Hwang, H.-J.; Chung, H. Auxin Response Factor Gene Family in Brassica Rapa: Genomic Organization, Divergence, Expression, and Evolution. Mol. Genet. Genom. 2012, 287, 765–784. [Google Scholar] [CrossRef]
- Kalluri, U.C.; DiFazio, S.P.; Brunner, A.M.; Tuskan, G.A. Genome-Wide Analysis of Aux/IAA and ARF Gene Families in Populus Trichocarpa. BMC Plant Biol. 2007, 7, 59. [Google Scholar] [CrossRef]
- Marin, E.; Jouannet, V.; Herz, A.; Lokerse, A.S.; Weijers, D.; Vaucheret, H.; Nussaume, L.; Crespi, M.D.; Maizel, A. MiR390, Arabidopsis TAS3 TasiRNAs, and Their AUXIN RESPONSE FACTOR Targets Define an Autoregulatory Network Quantitatively Regulating Lateral Root Growth. Plant Cell 2010, 22, 1104–1117. [Google Scholar] [CrossRef]
- Jones, B.; Frasse, P.; Olmos, E.; Zegzouti, H.; Li, Z.G.; Latché, A.; Pech, J.C.; Bouzayen, M. Down-regulation of DR12, an Auxin-response-factor Homolog, in the Tomato Results in a Pleiotropic Phenotype Including Dark Green and Blotchy Ripening Fruit. Plant J. 2002, 32, 603–613. [Google Scholar] [CrossRef]
- Sagar, M.; Chervin, C.; Roustan, J.-P.; Bouzayen, M.; Zouine, M. Under-Expression of the Auxin Response Factor Sl-ARF4 Improves Post-Harvest Behavior of Tomato Fruits. Plant Signal. Behav. 2013, 8, e25647. [Google Scholar] [CrossRef]
- Sagar, M.; Chervin, C.; Mila, I.; Hao, Y.; Roustan, J.-P.; Benichou, M.; Gibon, Y.; Biais, B.; Maury, P.; Latché, A. SlARF4, an Auxin Response Factor Involved in the Control of Sugar Metabolism during Tomato Fruit Development. Plant Physiol. 2013, 161, 1362–1374. [Google Scholar] [CrossRef]
- De Jong, M.; Wolters-Arts, M.; Feron, R.; Mariani, C.; Vriezen, W.H. The Solanum Lycopersicum Auxin Response Factor 7 (SlARF7) Regulates Auxin Signaling during Tomato Fruit Set and Development. Plant J. 2009, 57, 160–170. [Google Scholar] [CrossRef]
- Wilmoth, J.C.; Wang, S.; Tiwari, S.B.; Joshi, A.D.; Hagen, G.; Guilfoyle, T.J.; Alonso, J.M.; Ecker, J.R.; Reed, J.W. NPH4/ARF7 and ARF19 Promote Leaf Expansion and Auxin-induced Lateral Root Formation. Plant J. 2005, 43, 118–130. [Google Scholar] [CrossRef] [PubMed]
- Lim, P.O.; Lee, I.C.; Kim, J.; Kim, H.J.; Ryu, J.S.; Woo, H.R.; Nam, H.G. Auxin Response Factor 2 (ARF2) Plays a Major Role in Regulating Auxin-Mediated Leaf Longevity. J. Exp. Bot. 2010, 61, 1419–1430. [Google Scholar] [CrossRef] [PubMed]
- Yoon, E.K.; Yang, J.H.; Lee, W.S. Auxin and Abscisic Acid Responses of Auxin Response Factor 3 in Arabidopsis Lateral Root Development. J. Plant Biol. 2010, 53, 150–154. [Google Scholar] [CrossRef]
- Zhang, X.; Yan, F.; Tang, Y.; Yuan, Y.; Deng, W.; Li, Z. Auxin Response Gene SlARF3 Plays Multiple Roles in Tomato Development and Is Involved in the Formation of Epidermal Cells and Trichomes. Plant Cell Physiol. 2015, 56, 2110–2124. [Google Scholar]
- Goetz, M.; Hooper, L.C.; Johnson, S.D.; Rodrigues, J.C.M.; Vivian-Smith, A.; Koltunow, A.M. Expression of Aberrant Forms of AUXIN RESPONSE FACTOR8 Stimulates Parthenocarpy in Arabidopsis and Tomato. Plant Physiol. 2007, 145, 351–366. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Zhang, Y.; Feng, Q.; Qin, L.; Pan, C.; Lamin-Samu, A.T.; Lu, G. Tomato AUXIN RESPONSE FACTOR 5 Regulates Fruit Set and Development via the Mediation of Auxin and Gibberellin Signaling. Sci. Rep. 2018, 8, 2971. [Google Scholar] [CrossRef]
- Zhang, H.; Ning, C.; Chunjuan, D.; Shang, Q. Genome-Wide Identification and Expression of ARF Gene Family during Adventitious Root Development in Hot Pepper (Capsicum annuum). Hortic. Plant J. 2017, 3, 151–164. [Google Scholar] [CrossRef]
- Jin, L.; Yarra, R.; Zhou, L.; Cao, H. The Auxin Response Factor (ARF) Gene Family in Oil Palm (Elaeis guineensis Jacq.): Genome-Wide Identification and Their Expression Profiling under Abiotic Stresses. Protoplasma 2022, 259, 47–60. [Google Scholar]
- Hu, W.; Zuo, J.; Hou, X.; Yan, Y.; Wei, Y.; Liu, J.; Li, M.; Xu, B.; Jin, Z. The Auxin Response Factor Gene Family in Banana: Genome-Wide Identification and Expression Analyses during Development, Ripening, and Abiotic Stress. Front. Plant Sci. 2015, 6, 742. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Bai, Y.; Shen, C.; Wu, Y.; Zhang, S.; Jiang, D.; Guilfoyle, T.J.; Chen, M.; Qi, Y. Auxin-Related Gene Families in Abiotic Stress Response in Sorghum Bicolor. Funct. Integr. Genom. 2010, 10, 533–546. [Google Scholar] [CrossRef]
- Bouzroud, S.; Gouiaa, S.; Hu, N.; Bernadac, A.; Mila, I.; Bendaou, N.; Smouni, A.; Bouzayen, M.; Zouine, M. Auxin Response Factors (ARFs) Are Potential Mediators of Auxin Action in Tomato Response to Biotic and Abiotic Stress (Solanum lycopersicum). PLoS ONE 2018, 13, e0193517. [Google Scholar] [CrossRef]
- Bouzroud, S.; Gasparini, K.; Hu, G.; Barbosa, M.A.M.; Rosa, B.L.; Fahr, M.; Bendaou, N.; Bouzayen, M.; Zsögön, A.; Smouni, A. Down Regulation and Loss of Auxin Response Factor 4 Function Using CRISPR/Cas9 Alters Plant Growth, Stomatal Function and Improves Tomato Tolerance to Salinity and Osmotic Stress. Genes 2020, 11, 272. [Google Scholar] [CrossRef] [PubMed]
- Schruff, M.C.; Spielman, M.; Tiwari, S.; Adams, S.; Fenby, N.; Scott, R.J. The AUXIN RESPONSE FACTOR 2 Gene of Arabidopsis Links Auxin Signaling, Cell Division, and the Size of Seeds and Other Organs. Development 2006, 133, 251–261. [Google Scholar] [CrossRef] [PubMed]
- Ellis, C.M.; Nagpal, P.; Young, J.C.; Hagen, G.; Guilfoyle, T.J.; Reed, J.W. AUXIN RESPONSE FACTOR1 and AUXIN RESPONSE FACTOR2 Regulate Senescence and Floral Organ Abscission in Arabidopsis Thaliana. Development 2005, 132, 4563–4574. [Google Scholar] [CrossRef]
- Hao, Y.; Hu, G.; Breitel, D.; Liu, M.; Mila, I.; Frasse, P.; Fu, Y.; Aharoni, A.; Bouzayen, M.; Zouine, M. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato. PLoS Genet. 2015, 11, e1005649. [Google Scholar] [CrossRef] [PubMed]
- Breitel, D.A.; Chappell-Maor, L.; Meir, S.; Panizel, I.; Puig, C.P.; Hao, Y.; Yifhar, T.; Yasuor, H.; Zouine, M.; Bouzayen, M. AUXIN RESPONSE FACTOR 2 Intersects Hormonal Signals in the Regulation of Tomato Fruit Ripening. PLoS Genet. 2016, 12, e1005903. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.; Feng, Z.; Liu, X.; Bian, L.; Xie, H.; Zhang, C.; Mysore, K.S.; Liang, J. MiR393 and MiR390 Synergistically Regulate Lateral Root Growth in Rice under Different Conditions. BMC Plant Biol. 2018, 18, 261. [Google Scholar] [CrossRef]
- Zouine, M.; Maza, E.; Djari, A.; Lauvernier, M.; Frasse, P.; Smouni, A.; Pirrello, J.; Bouzayen, M. TomExpress, a unified tomato RNA-Seq platform for visualization of expression data, clustering and correlation networks. Plant J. 2017, 92, 727–735. [Google Scholar] [CrossRef]
- Ziaf, K.; Loukehaich, R.; Gong, P.; Liu, H.; Han, Q.; Wang, T.; Li, H.; Ye, Z. A multiple stress-responsive gene ERD15 from Solanum pennellii confers stress tolerance in tobacco. Plant Cell Physiol. 2011, 52, 1055–1067. [Google Scholar] [CrossRef]
- Ziaf, K.; Munis, M.F.H.; Samin, G.; Zhang, X.; Li, J.; Zhang, J.; Ye, Z. Characterization of ERD15 gene from cultivated tomato (Solanum lycopersicum). Pak. J. Agric. Sci. 2016, 53, 27–33. [Google Scholar]
- Hu, Y.; Wu, Q.; Sprague, S.A.; Park, J.; Oh, M.; Rajashekar, C.B.; Koiwa, H.; Nakata, P.A.; Cheng, N.; Hirschi, K.D.; et al. Tomato expressing Arabidopsis glutaredoxin gene AtGRXS17 confers tolerance to chilling stress via modulating cold responsive components. Hortic. Res. 2015, 2, 15051. [Google Scholar] [CrossRef] [PubMed]
- Foolad, M.R. Current status of breeding tomatoes for salt and drought tolerance. In Advances in Molecular Breeding toward Drought and Salt Tolerant Crops; Springer: Berlin/Heidelberg, Germany, 2007; pp. 669–700. [Google Scholar]
- Rodriguez-Leal, D.; Lemmon, Z.H.; Man, J.; Bartlett, M.E.; Lippman, Z.B. Engineering quantitative trait variation for crop improvement by genome editing. Cell 2017, 171, 470–480. [Google Scholar] [CrossRef] [PubMed]
- Zsögön, A.; Čermák, T.; Naves, E.R.; Notini, M.M.; Edel, K.H.; Weinl, S.; Freschi, L.; Voytas, D.F.; Kudla, J.; Peres, L.E.P. De novo domestication of wild tomato using genome editing. Nat. Biotechnol. 2018, 36, 1211–1216. [Google Scholar] [CrossRef]
- Liu, L.; Zhang, J.; Xu, J.; Li, Y.; Guo, L.; Wang, Z.; Zhang, X.; Zhao, B.; Guo, Y.D.; Zhang, N. CRISPR/Cas9 targeted mutagenesis of SlLBD40, a lateral organ boundaries domain transcription factor, enhances drought tolerance in tomato. Plant Sci. 2020, 301, 110683. [Google Scholar] [CrossRef]
- Klap, C.; Yeshayahou, E.; Bolger, A.M.; Arazi, T.; Gupta, S.K.; Shabtai, S.; Usadel, B.; Salts, Y.; Barg, R. Tomato facultative parthenocarpy results from SlAGAMOUS-LIKE 6 loss of function. Plant. Biotechnol. J. 2017, 15, 634–647. [Google Scholar] [CrossRef]
- Sun, Y.; Ji, K.; Liang, B.; Du, Y.; Jiang, L.; Wang, J.; Kai, W.; Zhang, Y.; Zhai, X.; Chen, P. Suppressing ABA uridine diphosphate glucosyltransferase (Sl UGT 75C1) alters fruit ripening and the stress response in tomato. Plant J. 2017, 91, 574–589. [Google Scholar] [CrossRef]
- Farcot, E.; Lavedrine, C.; Vernoux, T.A. Modular analysis of the auxin signaling network. PLoS ONE 2015, 10, e0122231. [Google Scholar]
- Park, J.E.; Park, J.Y.; Kim, Y.S.; Staswick, P.E.; Jeon, J.; Yun, J.; Kim, S.Y.; Kim, J.; Lee, Y.H.; Park, C.M. GH3-mediated auxin homeostasis links growth regulation with stress adaptation response in Arabidopsis. J. Biol. Chem. 2007, 282, 10036–10046. [Google Scholar] [CrossRef]
- Chen, L.; Ren, F.; Zhong, H.; Feng, Y.; Jiang, W.; Li, X. Identification and expression analysis of genes in response to high-salinity and drought stresses in Brassica napus. Acta Biochim. Biophys. Sin. 2010, 42, 154–164. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Yuan, Y.; Fu, D.; Shen, C.; Yang, Y. Identification and expression profiling of the auxin response factors in Dendrobium officinale under abiotic stresses. Int. J. Mol. Sci. 2017, 18, 927. [Google Scholar] [CrossRef] [PubMed]
- Ulmasov, T.; Hagen, G.; Guilfoyle, T.J. Activation and repression of transcription by auxin-response factors. Proc. Natl. Acad. Sci. USA 1999, 96, 5844–5849. [Google Scholar] [CrossRef] [PubMed]
- Guilfoyle, T.J.; Hagen, G. Auxin response factors. Curr. Opin. Plant Biol. 2007, 10, 453–460. [Google Scholar] [CrossRef] [PubMed]
- Jain, M.; Khurana, J.P. Transcript profiling reveals diverse roles of auxin-responsive genes during reproductive development and abiotic stress in rice. FEBS J. 2009, 276, 3148–3162. [Google Scholar] [CrossRef]
- Du, H.; Liu, H.; Xiong, L. Endogenous auxin and jasmonic acid levels are differentially modulated by abiotic stresses in rice. Front. Plant Sci. 2013, 4, 397. [Google Scholar] [CrossRef]
- Xu, Y.X.; Mao, J.; Chen, W.; Qian, T.T.; Liu, S.C.; Hao, W.J.; Li, C.F.; Chen, L. Identification and expression profiling of the auxin response factors (ARFs) in the tea plant (Camellia sinensis (L.) O. Kuntze) under various abiotic stresses. Plant Physiol. Biochem. 2016, 98, 46–56. [Google Scholar] [CrossRef]
- Yu, C.; Zhan, Y.; Feng, X.; Huang, Z.A.; Sun, C. Identification and expression profiling of the auxin response factors in Capsicum annuum L. under abiotic stress and hormone treatments. Int. J. Mol. Sci. 2017, 18, e2719. [Google Scholar] [CrossRef]
- Liu, N.; Dong, L.; Deng, X.; Liu, D.; Liu, Y.; Li, M.; Hu, Y.; Yan, Y. Genome-wide identification, molecular evolution, and expression analysis of auxin response factor (ARF) gene family in Brachypodium distachyon L. BMC Plant Biol. 2018, 18, 336. [Google Scholar] [CrossRef]
- Singh, V.K.; Rajkumar, M.; Garg, R.; Jain, M. Genome-wide identification and co-expression network analysis provide insights into the roles of auxin response factor gene family in chickpea. Sci. Rep. 2017, 7, 10895. [Google Scholar] [CrossRef] [PubMed]
- Wen, F.L.; Yue, Y.; He, T.F.; Gao, X.M.; Zhou, Z.S.; Long, X.H. Identification of miR390-TAS3-ARF pathway in response to salt stress in Helianthus tuberosus L. Gene 2020, 738, 144460. [Google Scholar] [CrossRef] [PubMed]
- Kang, C.; He, S.; Zhai, H.; Li, R.; Zhao, N.; Liu, Q. A Sweetpotato Auxin Response Factor Gene (IbARF5) Is Involved in Carotenoid Biosynthesis and Salt and Drought Tolerance in Transgenic Arabidopsis. Front. Plant Sci. 2018, 9, 1307. [Google Scholar] [CrossRef]
- Tang, Y.; Du, G.; Xiang, J.; Hu, C.; Li, X.; Wang, W.; Zhu, H.; Qiao, L.; Zhao, C.; Wang, J.; et al. Genome-wide identification of auxin response factor (ARF) gene family and the miR160-ARF18-mediated response to salt stress in peanut (Arachis hypogaea L.). Genomics 2022, 114, 171–184. [Google Scholar] [CrossRef] [PubMed]
- Okushima, Y.; Mitina, I.; Quach, H.L.; Theologis, A. AUXIN RESPONSE FACTOR 2 (ARF2): A pleiotropic developmental regulator. Plant J. 2005, 43, 29–46. [Google Scholar] [CrossRef]
- Meng, L.S.; Wang, Z.B.; Yao, S.Q.; Liu, A. The ARF2–ANT–COR15A gene cascade regulates ABA signaling-mediated resistance of large seeds to drought in Arabidopsis. J. Cell Sci. 2015, 128, 3922–3932. [Google Scholar] [PubMed]
- Shi, H.; Chen, L.; Ye, T.; Liu, X.; Ding, K.; Chan, Z. Modulation of auxin content in Arabidopsis confers improved drought stress resistance. Plant Physiol. Biochem. 2014, 82, 209–217. [Google Scholar] [CrossRef] [PubMed]
- Lovelli, S.; Scopa, A.; Perniola, M.; Di Tommaso, T.; Sofo, A. Abscisic acid root and leaf concentration in relation to biomass partitioning in salinized tomato plants. J. Plant Physiol. 2012, 169, 226–233. [Google Scholar] [CrossRef] [PubMed]
- Okushima, Y.; Overvoorde, P.J.; Arima, K.; Alonso, J.M.; Chan, A.; Chang, C.; Ecker, J.R.; Hughes, B.; Lui, A.; Nguyen, D.; et al. Functional genomic analysis of the AUXIN RESPONSE FACTOR gene family members in Arabidopsis thaliana: Unique and overlapping functions of ARF7 and ARF19. Plant Cell 2005, 17, 444–463. [Google Scholar] [CrossRef] [PubMed]
- Okushima, Y.; Fukaki, H.; Onoda, M.; Theologis, A.; Tasaka, M. ARF7 and ARF19 regulate lateral root formation via direct activation of LBD/ASL genes in Arabidopsis. Plant Cell 2007, 19, 118–130. [Google Scholar] [CrossRef]
- Narise, T.; Kobayashi, K.; Baba, S.; Shimojima, M.; Masuda, S.; Fukaki, H.; Ohta, H. Involvement of auxin signaling mediated by IAA14 and ARF7/19 in membrane lipid remodeling during phosphate starvation. Plant Mol. Biol. 2010, 72, 533–544. [Google Scholar] [CrossRef]
- Hou, Q.; Li, X.; Qiu, Z.; Hong, Y.; Tian, T.; Li, S.; Ran, J.; Qiao, G. Chinese Cherry (Cerasus pseudocerasus Lindl.) ARF7 Participates in Root Development and Responds to Drought and Low Phosphorus. Horticulturae 2022, 8, 158. [Google Scholar] [CrossRef]
- Wang, L.; Hua, D.; He, J.; Duan, Y.; Chen, Z.; Hong, X.; Gong, Z. Auxin Response Factor2 (ARF2) and its regulated homeodomain gene HB33 mediate abscisic acid response in Arabidopsis. PLoS Genet. 2011, 7, e1002172. [Google Scholar] [CrossRef]
- Wu, B.; Li, Y.H.; Wu, J.Y.; Chen, Q.Z.; Huang, X.; Chen, Y.F.; Huang, X.L. Over-expression of mango (Mangifera indica L.) MiARF2 inhibits root and hypocotyl growth of Arabidopsis. Mol. Biol. Rep. 2011, 38, 3189–3194. [Google Scholar] [CrossRef] [PubMed]
- Zhao, S.; Zhang, M.L.; Ma, T.L.; Wang, Y. Phosphorylation of ARF2 relieves its repression of transcription of the K+ transporter gene HAK5 in response to low potassium stress. Plant Cell 2016, 28, 3005–3019. [Google Scholar] [CrossRef] [PubMed]
- Hao, Y.J.; Wei, W.; Song, Q.X.; Chen, H.W.; Zhang, Y.Q.; Wang, F.; Zou, H.-F.; Lei, G.; Tian, A.-G.; Zhang, W.K.; et al. Soybean NAC transcription factors promote abiotic stress tolerance and lateral root formation in transgenic plants. Plant J. 2011, 68, 302–313. [Google Scholar] [CrossRef] [PubMed]
- Tiwari, S.; Gupta, S.C.; Chauhan, P.S.; Lata, C. An OsNAM gene plays important role in root rhizobacteria interaction in transgenic Arabidopsis through abiotic stress and phytohormone crosstalk. Plant Cell Rep. 2021, 40, 143–155. [Google Scholar] [CrossRef]
- Kirolinko, C.; Hobecker, K.; Wen, J.; Mysore, K.S.; Niebel, A.; Blanco, F.A.; Zanetti, M.E. Auxin Response Factor 2 (ARF2), ARF3, and ARF4 Mediate Both Lateral Root and Nitrogen Fixing Nodule Development in Medicago truncatula. Front. Plant Sci. 2021, 12, 659061. [Google Scholar] [CrossRef] [PubMed]
- Choi, H.S.; Seo, M.; Cho, H.T. Two TPL-Binding Motifs of ARF2 Are Involved in Repression of Auxin Responses. Front. Plant Sci. 2018, 9, 372. [Google Scholar] [CrossRef]
- Promchuea, S.; Zhu, Y.; Chen, Z.; Zhang, J.; Gong, Z. ARF2 coordinates with PLETHORAs and PINs to orchestrate ABA-mediated root meristem activity in Arabidopsis . J. Integr. Plant Biol. 2017, 59, 30–43. [Google Scholar] [CrossRef]
- Lavenus, J.; Goh, T.; Guyomarc’h, S.; Hill, K.; Lucas, M.; Voß, U.; Kenobi, K.; Wilson, M.H.; Farcot, E.; Hagen, G.; et al. Inference of the Arabidopsis lateral root gene regulatory network suggests a bifurcation mechanism that defines primordia flanking and central zones. Plant Cell 2015, 27, 1368–1388. [Google Scholar] [CrossRef]
- Zhao, Y.Y.; Zhao, Y.Y.; Yan, F.; Hu, L.P.; Zhou, X.T.; Zou, Z.R.; Cui, L.R. Effects of exogenous 5-aminolevulinic acid on photosynthesis, stomatal conductance, transpiration rate, and PIP gene expression of tomato seedlings subject to salinity stress. Genet. Mol. Res. 2015, 14, 6401–6412. [Google Scholar] [CrossRef]
- Parvanova, D.; Ivanov, S.; Konstantinova, T.; Karanov, E.; Atanassov, A.; Tsvetkov, T.; Alexieva, V.; Djilianov, D. Transgenic tobacco plants accumulating osmolytes show reduced oxidative damage under freezing stress. Plant Physiol. Biochem. 2004, 42, 57–63. [Google Scholar] [CrossRef]
- Davey, M.W.; Stals, E.; Panis, B.; Keulemans, J.; Swennen, R.L. High-throughput determination of malondialdehyde in plant tissues. Anal. Biochem. 2005, 347, 201–207. [Google Scholar] [CrossRef]
- Xu, G.Y.; Rocha, P.S.; Wang, M.L.; Xu, M.L.; Cui, Y.C.; Li, L.Y.; Zhu, Y.X.; Xia, X. A novel rice calmodulin-like gene, OsMSR2, enhances drought and salt tolerance and increases ABA sensitivity in Arabidopsis. Planta 2011, 234, 47–59. [Google Scholar] [CrossRef] [PubMed]
- Fischer, I.; Steige, K.A.; Stephan, W.; Mboup, M. Sequence evolution and expression regulation of stress-responsive genes in natural populations of wild tomato. PLoS ONE 2013, 8, e78182. [Google Scholar] [CrossRef] [PubMed]
- Golan, I.; Dominguez, P.G.; Konrad, Z.; Shkolnik-Inbar, D.; Carrari, F.; Bar-Zvi, D. Tomato ABSCISIC ACID STRESS RIPENING (ASR) gene family revisited. PLoS ONE 2014, 9, e107117. [Google Scholar] [CrossRef] [PubMed]
- Frankel, N.; Carrari, F.; Hasson, E.; Iusem, N.D. Evolutionary history of the Asr gene family. Gene 2006, 378, 74–83. [Google Scholar] [CrossRef]
- Maskin, L.; Gudesblat, G.E.; Moreno, J.E.; Carrari, F.O.; Frankel, N.; Sambade, A.; Rossi, M.; Iusem, N.D. Differential expression of the members of the Asr gene family in tomato (Lycopersicon esculentum). Plant Sci. 2001, 161, 739–746. [Google Scholar] [CrossRef]
- Hsieh, T.H.; Lee, J.; Charng, Y.; Chan, M.T. Tomato plants ectopically expressing Arabidopsis CBF1 show enhanced resistance to water deficit stress. Plant Physiol. 2002, 130, 618–626. [Google Scholar] [CrossRef]
- Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909–939. [Google Scholar] [CrossRef]
- Apel, K.; Hirt, H. Reactive oxygen species: Metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 2004, 55, 373–399. [Google Scholar] [CrossRef]
- Choudhury, S.; Panda, P.; Sahoo, L.; Panda, S.K. Reactive oxygen species signaling in plants under abiotic stress. Plant Signal. Behav. 2013, 8, e23681. [Google Scholar] [CrossRef] [PubMed]
- Harb, A.; Krishnan, A.; Ambavaram, M.M.R.; Pereira, A. Molecular and physiological analysis of drought stress in Arabidopsis reveals early responses leading to acclimation in plant growth. Plant Physiol. 2010, 154, 1254–1271. [Google Scholar] [CrossRef]
- Sakuma, Y.; Maruyama, K.; Osakabe, Y.; Qin, F.; Seki, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Functional analysis of an Arabidopsis transcription factor, DREB2A, involved in drought-responsive gene expression. Plant Cell 2006, 18, 1292–1309. [Google Scholar] [CrossRef] [PubMed]
- Sakuma, Y.; Liu, Q.; Dubouzet, J.G.; Abe, H.; Shinozaki, K.; Yamaguchi-Shinozaki, K. DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration-and cold-induced gene expression. Biochem. Biophys. Res. Commun. 2002, 290, 998–1009. [Google Scholar] [CrossRef] [PubMed]
- Hichri, I.; Muhovski, Y.; Clippe, A.; Žižková, E.; Dobrev, P.I.; Motyka, V.; Lutts, S. SlDREB2, a tomato dehydration-responsive element-binding 2 transcription factor, mediates salt stress tolerance in tomato and Arabidopsis. Plant Cell Environ. 2016, 39, 62–79. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Zhang, H.; Zhao, Y.; Feng, Z.; Li, Q.; Yang, H.Q.; Luan, S.; Li, J.; He, Z.H. Auxin controls seed dormancy through stimulation of abscisic acid signaling by inducing ARF-mediated ABI3 activation in Arabidopsis. Proc. Natl. Acad. Sci. USA 2013, 110, 15485–15490. [Google Scholar] [CrossRef] [PubMed]
- Sripinyowanich, S.; Klomsakul, P.; Boonburapong, B.; Bangyeekhun, T.; Asami, T.; Gu, H.; Buaboocha, T.; Chadchawan, S. Exogenous ABA induces salt tolerance in indica rice (Oryza sativa L.): The role of OsP5CS1 and OsP5CR gene expression during salt stress. Environ. Exp. Bot. 2013, 86, 94–105. [Google Scholar] [CrossRef]
- Broughton, W.; Dilworth, M. Control of leghaemoglobin synthesis in snake beans. Biochem. J. 1971, 125, 1075–1080. [Google Scholar] [CrossRef]
- Wellburn, A.R. The spectral determination of chlorophylls a and b, as well as total carotenoids, using various solvents with spectrophotometers of different resolution. J. Plant Physiol. 1994, 144, 307–313. [Google Scholar] [CrossRef]
- Riazi, A.; Matsuda, K.; Arslan, A. Water-stress induced changes in concentrations of proline and other solutes in growing regions of young barley leaves. J. Exp. Bot. 1985, 172, 1716–1725. [Google Scholar] [CrossRef]
- Jin, Z.M.; Wang, C.H.; Liu, Z.P.; Gong, W.J. Physiological and ecological characters studies on Aloe vera under soil salinity and seawater irrigation. Process Biochem. 2007, 42, 710–714. [Google Scholar] [CrossRef]
- Zhang, G.; Chen, M.; Li, L.; Xu, Z.; Chen, X.; Guo, J.; Ma, Y. Overexpression of the soybean GmERF3 gene, an AP2/ERF type transcription factor for increased tolerances to salt, drought, and diseases in transgenic tobacco. J. Exp. Bot. 2009, 60, 3781–3796. [Google Scholar] [CrossRef] [PubMed]
- Miao, B.H.; Han, X.G.; Zhang, W.H. The ameliorative effect of silicon on soybean seedlings grown in potassium-deficient medium. Ann. Bot. 2010, 105, 967–973. [Google Scholar] [CrossRef] [PubMed]
- Sekmen, A.H.; Ozgur, R.; Uzilday, B.; Turkan, I. Reactive oxygen species scavenging capacities of cotton (Gossypium hirsutum) cultivars under combined drought and heat induced oxidative stress. Environ. Exp. Bot. 2014, 99, 141–149. [Google Scholar] [CrossRef]










| Gene | Solyc ID | Forward Primer Sequence (5′–3′) | Reverse Primer Sequence (5′–3′) |
|---|---|---|---|
| Sl-Actin | Solyc03g078400 | TGTCCCTATCTACGAGGGTTATGC | AGTTAAATCACGACCAGCAAGAT |
| SlASR1 | Solyc04g071610.2.1 | GGGACACCACCATCTCTTCTAAA | CCAAATATGGAAATTCCACGAATAT |
| SlASR2 | Solyc04g071580.2.1 | GACATTAATTTAAGAGAAGCAATACAATATGG | GGTGGAACAAATGGTGATGGT |
| SlASR4 | Solyc04g071620.2.1 | GGTAATGAGGAAGGTGGCTATGG | TGGTTCCACTATCATCATTCTCTTCA |
| CI7 | Solyc04g082200.2.1 | GGCAATTTCATCTGAGTTGTCTGA | CTATTTGATCGATGAAGTTTCTTTTCC |
| SlSOD | Solyc01g067740.2.1 | TGAATTGGGGTTGAACCATT | GCAGGCACTGTAATCTGCAA |
| SlCAT | Solyc12g094620.1.1 | TCCCAGTTAATGCTCCCAAG | CTCAGCAGGACGACAAGGAT |
| SlPOD | Solyc04g071900.2 | CTTGCCCTAATGCTCTCACC | GCATCACAACCCTGAACAAA |
| SlDREB1 | Solyc06g050520.1.1 | GCAATGTCAGGAGCCGAATG | TCTTCTTGCCTGCCTGGTTT |
| SlDREB2 | Solyc05g052410.1.1 | GCAAGAGGACTTCCACTTCT | GCCATGTTGCCAATGCACCAA |
| SlP5CS | Solyc08g043170.2.1 | TGCTGTAGGTGTTGGTCGTCA | TGCCATCAAGCTCAGTTTGTG |
| SlERD15 | Solyc04g017690.2.1 | AGGCATCAAGTCATCACTCTCTGGT | GAGGTAAATGTGAGTAAGAACCAACG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
El Mamoun, I.; Bouzroud, S.; Zouine, M.; Smouni, A. The Knockdown of AUXIN RESPONSE FACTOR 2 Confers Enhanced Tolerance to Salt and Drought Stresses in Tomato (Solanum lycopersicum L.). Plants 2023, 12, 2804. https://doi.org/10.3390/plants12152804
El Mamoun I, Bouzroud S, Zouine M, Smouni A. The Knockdown of AUXIN RESPONSE FACTOR 2 Confers Enhanced Tolerance to Salt and Drought Stresses in Tomato (Solanum lycopersicum L.). Plants. 2023; 12(15):2804. https://doi.org/10.3390/plants12152804
Chicago/Turabian StyleEl Mamoun, Ibtihaj, Sarah Bouzroud, Mohamed Zouine, and Abdelaziz Smouni. 2023. "The Knockdown of AUXIN RESPONSE FACTOR 2 Confers Enhanced Tolerance to Salt and Drought Stresses in Tomato (Solanum lycopersicum L.)" Plants 12, no. 15: 2804. https://doi.org/10.3390/plants12152804
APA StyleEl Mamoun, I., Bouzroud, S., Zouine, M., & Smouni, A. (2023). The Knockdown of AUXIN RESPONSE FACTOR 2 Confers Enhanced Tolerance to Salt and Drought Stresses in Tomato (Solanum lycopersicum L.). Plants, 12(15), 2804. https://doi.org/10.3390/plants12152804

