Biocontrol Potential of PeBL2, a Novel Entomopathogenic Bacterium from Brevibacillus laterosporus A60, Induces Systemic Resistance against Rice Leaf Folder Cnaphalocrocis exigua (Butler) in Rice (Oryza sativa L.)
Abstract
1. Introduction
2. Results
2.1. Expression, Purification, and Evaluation of PeBL2 Elicitor Protein
2.2. Cnaphalocrocis exigua Indoors
2.3. PeBL2 Influence on C. exigua
2.4. PeBL2 Impact on O. sativa
2.5. Concentration of SA, JA, and ET
2.6. Relative Fold Changes in the Expressions of Defense-Related Genes
3. Discussion
4. Materials and Methods
4.1. Colonies of Plant, Insect, and Bacterial Culture
4.2. Isolation and Detection of Crude Protein
4.3. Protein Purification
4.4. Mass Spectrometry Analysis
4.5. Gene Cloning
4.6. Expression and Purification of the Recombinant PeBL2 Elicitor Protein
4.7. Cnaphalocrocis exigua Infestation on the Plant
4.8. Cnaphalocrocis exigua Development
4.9. Cnaphalocrocis exigua Bioassay
4.10. PeBL2 Influences on C. exigua
4.11. SA, JA, and ET Quantity with HPLC/MS
4.12. Isolation of RNA and cDNA Synthesis
4.13. Real-Time Quantitative Reverse Transcription PCR (qRT-PCR)
4.14. Data Examination
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Silipo, A.; Erbs, G.; Shinya, T.; Maxwell Dow, J.M.; Parrilli, M.; Lanzetta, R.; Shibuya, N.; Newman, M.A.; Molinaro, A. Glycoconjugates as elicitors or suppressors of plant innate immunity. Glycobiology 2009, 20, 406–419. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, W.; Berkowitz, G.A. The grateful dead: Calcium and cell death in plant innate immunity. Cell. Microbiol. 2007, 9, 2571–2585. [Google Scholar] [CrossRef] [Scilit]
- Garcia-Brugger, A.; Lamotte, O.; Vandelle, E.; Bourque, S.; Lecourieux, D.; Poinssot, B.; Wendehenne, D.; Pugin, A. Early signaling events induced by elicitors of plant defenses. Mol. Plant-Microbe Interact. 2006, 19, 711–724. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nürnberger, T.; Brunner, F. Innate immunity in plants and animals: Emerging parallels between the recognition of general elicitors and pathogen-associated molecular patterns. Curr. Opin. Plant Biol. 2002, 5, 318–324. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thomma, B.P.H.J.; Nu, T.; Joosten, M.H.A.J. Of PAMPs and Effectors: The Blurred PTI-ETI Dichotomy. Plant Cell 2011, 23, 4–15. [Google Scholar] [CrossRef] [Scilit]
- Yano, A.; Suzuki, K.; Uchimiya, H.; Shinshi, H. Induction of hypersensitive cell death by a fungal protein in cultures of tobacco cells. Mol. Plant-Microbe Interact. 1998, 11, 115–123. [Google Scholar] [CrossRef] [Scilit]
- Zhao, L.Y.; Chen, J.L.; Cheng, D.F.; Sun, J.R.; Liu, Y.; Tian, Z. Biochemical and molecular characterizations of Sitobion avenae-induced wheat defense responses. Crop Prot. 2009, 28, 435–442. [Google Scholar] [CrossRef] [Scilit]
- Ellis, J.G.; Rafiqi, M.; Gan, P.; Chakrabarti, A.; Dodds, P.N. Recent progress in discovery and functional analysis of effector proteins of fungal and oomycete plant pathogens. Curr. Opin. Plant Biol. 2009, 12, 399–405. [Google Scholar] [CrossRef] [Scilit]
- Bent, A.F.; Mackey, D. Elicitors, effectors, and R genes: The new paradigm and a lifetime supply of questions. Annu. Rev. Phytopathol. 2008, 45, 399–436. [Google Scholar] [CrossRef] [Scilit]
- Foyer, C.H.; Noctor, G. Oxidant and antioxidant signalling in plants: A re-evaluation of the concept of oxidative stress in a physiological context. Plant Cell Environ. 2005, 28, 1056–1071. [Google Scholar] [CrossRef] [Scilit]
- Montesano, M.; Brader, G.; Palva, E.T. Pathogen derived elicitors: Searching for receptors in plants. Mol. Plant Pathol. 2003, 4, 73–79. [Google Scholar] [CrossRef] [Scilit]
- Hael-Conrad, V.; Perato, S.M.; Arias, M.E.; Martínez-Zamora, M.G.; Di Peto, P.D.L.Á.; Martos, G.G.; Castagnaro, A.P.; Díaz-Ricci, J.C.; Chalfoun, N.R. The elicitor protein AsES induces a systemic acquired resistance response accompanied by systemic microbursts and micro-hypersensitive responses in Fragaria ananassa. Mol. Plant-Microbe Interact. 2018, 31, 46–60. [Google Scholar] [CrossRef] [Scilit]
- Javed, K.; Javed, H.; Qiu, D. Biocontrol Potential of Purified Elicitor Protein PeBL1 Extracted from Brevibacillus laterosporus Strain A60 and Its Capacity in the Induction of Defense Process against Cucumber Aphid (Myzus persicae ) in Cucumber (Cucumis sativus). Biology 2020, 9, 179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Javed, K.; Qiu, D. Protein Elicitor PeBL1 of Brevibacillus laterosporus Enhances Resistance Against Myzus persicae in Tomato. Pathogens 2020, 9, 57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Javed, K.; Talha, H.; Ayesha, H.; Wang, Y.; Javed, H. PeaT1 and PeBC1 Microbial Protein Elicitors Enhanced Resistance against Myzus persicae Sulzer in Chili Capsicum annum L. Microorganisms 2021, 9, 2197. [Google Scholar] [CrossRef] [Scilit]
- Javed, K.; Javed, H.; Qiu, D. PeBL1 of Brevibacillus laterosporus a new biocontrol tool for wheat aphid management (Sitobion avenae) in triticum aestivum. Int. J. Trop. Insect Sci. 2021, 42, 535–544. [Google Scholar] [CrossRef] [Scilit]
- Javed, K.; Javed, H.; Mukhtar, T.; Qiu, D. Pathogenicity of some entomopathogenic fungal strains to green peach aphid, Myzus persicae Sulzer (Homoptera: Aphididae). Egypt. J. Biol. Pest Control 2019, 29, 92. [Google Scholar] [CrossRef] [Scilit]
- Javed, K.; Javed, H.; Mukhtar, T.; Qiu, D. Efficacy of Beauveria bassiana and Verticillium lecanii for the management of whitefly and aphid. Pak. J. Agric. Sci. 2019, 56, 669–674. [Google Scholar] [CrossRef]
- Nouri-Ganbalani, G.; Borzoui, E.; Shahnavazi, M.; Nouri, A. Induction of resistance against Plutella xylostella (L.) (Lepidoptera: Plutellidae) by jasmonic acid and mealy cabbage aphid feeding in Brassica napus L. Front. Physiol. 2018, 9, 859. [Google Scholar] [CrossRef] [Scilit]
- Salzman, R.A.; Brady, J.A.; Finlayson, S.A.; Buchanan, C.D.; Summer, E.J.; Sun, F.; Klein, P.E.; Klein, R.R.; Pratt, L.H.; Cordonnier-Pratt, M.M.; et al. Transcriptional profiling of sorghum induced by methyl jasmonate, salicylic acid, and aminocyclopropane carboxylic acid reveals cooperative regulation and novel gene responses. Plant Physiol. 2005, 138, 352–368. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lazebnik, J.; Frago, E.; Dicke, M.; van Loon, J.J.A. Phytohormone Mediation of Interactions Between Herbivores and Plant Pathogens. J. Chem. Ecol. 2014, 40, 730–741. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ali, J.G.; Agrawal, A.A. Asymmetry of plant-mediated interactions between specialist aphids and caterpillars on two milkweeds. Funct. Ecol. 2014, 28, 1404–1412. [Google Scholar] [CrossRef] [Scilit]
- Sandoya, G.V.; de Oliveira Buanafina, M.M. Differential responses of Brachypodium distachyon genotypes to insect and fungal pathogens. Physiol. Mol. Plant Pathol. 2014, 85, 53–64. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Yang, X.; Guo, L.; Zeng, H.; Qiu, D. PeBL1, a novel protein elicitor from Brevibacillus laterosporus strain A60, activates defense responses and systemic resistance in Nicotiana benthamiana. Appl. Environ. Microbiol. 2015, 81, 2706–2716. [Google Scholar] [CrossRef] [Scilit]
- Jatoi, G.H.; Lihua, G.; Xiufen, Y.; Gadhi, M.A.; Keerio, A.U.; Abdulle, Y.A.; Qiu, D. A novel protein elicitor PeBL2, from Brevibacillus laterosporus A60, induces systemic resistance against Botrytis cinerea in tobacco plant. Plant Pathol. J. 2019, 35, 208–218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marche, M.G.; Mura, M.E.; Falchi, G.; Ruiu, L. Spore surface proteins of Brevibacillus laterosporus are involved in insect pathogenesis. Sci. Rep. 2017, 7, 43805. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barbieri, G.; Ferrari, C.; Mamberti, S.; Gabrieli, P.; Castelli, M.; Sassera, D.; Ursino, E.; Scoffone, V.C.; Radaelli, G.; Clementi, E.; et al. Identification of a Novel Brevibacillus laterosporus Strain With Insecticidal Activity Against Aedes albopictus Larvae. Front. Microbiol. 2021, 12, 624014. [Google Scholar] [CrossRef] [Scilit]
- Bale, J.S.; Masters, G.J.; Hodkinson, I.D.; Awmack, C.; Bezemer, T.M.; Brown, V.K.; Butterfield, J.; Buse, A.; Coulson, J.C.; Farrar, J.; et al. Herbivory in global climate change research: Direct effects of rising temperature on insect herbivores. Glob. Chang. Biol. 2002, 8, 1–16. [Google Scholar] [CrossRef] [Scilit]
- Boughton, A.J.; Hoover, K.; Felton, G.W. Impact of chemical elicitor applications on greenhouse tomato plants and population growth of the green peach aphid, Myzus persicae. Entomol. Exp. Appl. 2006, 120, 175–188. [Google Scholar] [CrossRef] [Scilit]
- Mallinger, R.E.; Hogg, D.B.; Gratton, C. Methyl Salicylate Attracts Natural Enemies and Reduces Populations of Soybean Aphids (Hemiptera: Aphididae) in Soybean Agroecosystems. J. Econ. Entomol. 2011, 104, 115–124. [Google Scholar] [CrossRef] [Scilit]
- Schaller, F.; Schaller, A.; Stintzi, A. Biosynthesis and metabolism of jasmonates. J. Plant Growth Regul. 2004, 23, 179–199. [Google Scholar] [CrossRef] [Scilit]
- Glas, J.J.; Schimmel, B.C.J.; Alba, J.M.; Escobar-Bravo, R.; Schuurink, R.C.; Kant, M.R. Plant glandular trichomes as targets for breeding or engineering of resistance to herbivores. Int. J. Mol. Sci. 2012, 13, 17077–17103. [Google Scholar] [CrossRef] [Scilit]
- Tian, D.; Tooker, J.; Peiffer, M.; Chung, S.H.; Felton, G.W. Role of trichomes in defense against herbivores: Comparison of herbivore response to woolly and hairless trichome mutants in tomato (Solanum lycopersicum). Planta 2012, 236, 1053–1066. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- dos Santos Tozin, L.R.; Marques, M.O.M.; Rodrigues, T.M. Herbivory by leaf-cutter ants changes the glandular trichomes density and the volatile components in an aromatic plant model. AoB Plants 2017, 9, plx057. [Google Scholar] [CrossRef] [Scilit]
- Boughton, A.J.; Hoover, K.; Felton, G.W. Methyl jasmonate application induces increased densities of glandular trichomes on tomato, Lycopersicon esculentum. J. Chem. Ecol. 2005, 31, 2211–2216. [Google Scholar] [CrossRef] [Scilit]
- Ni, Y.; Wang, J.; Song, C.; Xia, R.-E.; Sun, Z.-Y.; Guo, Y.-J.; Li, J.-N. Effects of SA Induction on Leaf Cuticular Wax and Resistance to Sclerotinia sclerotiorurn in Brassica napus. Acta Agron. Sin. 2013, 39, 110–117. [Google Scholar] [CrossRef] [Scilit]
- Farmer, E.E.; Johnson, R.R.; Ryan, C.A. Regulation of expression of proteinase inhibitor genes by methyl jasmonate and jasmonic acid. Plant Physiol. 1992, 98, 995–1002. [Google Scholar] [CrossRef] [Scilit]
- Mahmoud, F.; Mahfouz, H. Effects of salicylic acid elicitor against aphids on wheat and detection of infestation using infrared thermal imaging technique in Ismailia, Egypt. Pestic. Phytomedicine/Pestic. I Fitomedicina 2015, 30, 91–97. [Google Scholar] [CrossRef] [Scilit]
- Cooper, W.R.; Goggin, F.L. Effects of jasmonate-induced defenses in tomato on the potato aphid, Macrosiphum euphorbiae. Entomol. Exp. Appl. 2005, 115, 107–115. [Google Scholar] [CrossRef] [Scilit]
- Hammond-Kosack, K.E.; Parker, J.E. Deciphering plant-pathogen communication: Fresh perspectives for molecular resistance breeding. Curr. Opin. Biotechnol. 2003, 14, 177–193. [Google Scholar] [CrossRef] [Scilit]
- Thaler, J.S.; Humphrey, P.T.; Whiteman, N.K. Evolution of jasmonate and salicylate signal crosstalk. Trends Plant Sci. 2012, 17, 260–270. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, H.S.; Delaney, T.P. Over-expression of TGA5, which encodes a bZIP transcription factor that interacts with NIM1/NPR1, confers SAR-independent resistance in Arabidopsis thaliana to Peronospora parasitica. Plant J. 2002, 32, 151–163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chaerle, L.; Lenk, S.; Hagenbeek, D.; Buschmann, C.; Van Der Straeten, D. Multicolor fluorescence imaging for early detection of the hypersensitive reaction to tobacco mosaic virus. J. Plant Physiol. 2007, 164, 253–262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nicholson, R.L.; Hammerschmidt, R. Phenolic Compounds And Their Role In Disease Resistance. Annu. Rev. Phytopathol. 1992, 30, 369–389. [Google Scholar] [CrossRef]
- De Vos, M.; Van Oosten, V.R.; Van Poecke, R.M.P.; Van Pelt, J.A.; Pozo, M.J.; Mueller, M.J.; Buchala, A.J.; Métraux, J.P.; Van Loon, L.C.; Dicke, M.; et al. Signal signature and transcriptome changes of Arabidopsis during pathogen and insect attack. Mol. Plant-Microbe Interact. 2005, 18, 923–937. [Google Scholar] [CrossRef] [Scilit]
- Ali, J.G.; Agrawal, A.A. Specialist versus generalist insect herbivores and plant defense. Trends Plant Sci. 2012, 17, 293–302. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.H.; Wei, F.; Dong, X.Y.; Peng, J.H.; Liu, S.Y.; Chen, H. Simultaneous analysis of multiple endogenous plant hormones in leaf tissue of oilseed rape by solid-phase extraction coupled with high-performance liquid chromatography-electrospray ionisation tandem mass spectrometry. Phytochem. Anal. 2011, 22, 442–449. [Google Scholar] [CrossRef] [Scilit]
- Jarošová, J.; Kundu, J.K. Validation of reference genes as internal control for studying viral infections in cereals by quantitative real-time RT-PCR. BMC Plant Biol. 2010, 10, 146. [Google Scholar] [CrossRef] [Scilit]
- Basit, A.; Farhan, M.; Essa, M.; Abbas, M.; Wang, Y.; Zhao, D.G.; Maridha, A.U.; Amjad Bashir, M.; Hussain, A.; Hanan, A.; et al. Effect of two protein elicitors extracted from Alternaria tenuissima and Beauveria bassiana against rice leaf folder (Marasmia exigua). J. King Saud Univ. Sci. 2021, 33, 101652. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]









| JA/SA/ET Pathways | Test Genes | Forward Sequence (5′…… 3′) | Reverse Sequence (5′…… 3′) |
|---|---|---|---|
| JA | LOC_Os12g37350.1 | CTCCATGGTTGGTGGAACGA | TAGGGGTACTGGCCGAAGTT |
| JA | LOC_Os11g39220.1 | GCTCACACTTGCGGAATCAC | GGCTTTGTTTGGGGCAACAT |
| JA | LOC_Os06g23760.1 | AGCTCAGGTCACCGACTTTG | ATGAAACGGGAATTCGGCCT |
| JA | LOC_Os08g39850.1 | GAGATGAGGAGTTCGCGAGG | ACGGCAAGAAGAGGTCATGG |
| SA | LOC_Os11g15040.4 | TTCAATGCAGGAGGGACGAC | AGTCATGCATGCGGTTCTCA |
| SA | LOC_Os01g56380.1 | GCATCAACGTCGTGCCTTTC | GATCGGAGCAGTAGACGACG |
| SA | LOC_Os03g53200.1 | TCTTCGACAAGAACGGCGAT | AGGCCAAGAGAACGAGTCAC |
| SA | LOC_Os05g41210.1 | GCGACGGTTGCATCACTACT | GCCTCAGTTGGGTTCTGACC |
| ET | LOC_Os11g08380.1 | TAGCAATGGCCGCTTCAAGA | CTTGAAGCTCGGGTAGTCGG |
| ET | LOC_Os03g01130.1 | GCGGAGCTGTACCTCAACAT | CTTGGAAGACTCCGCTGGTT |
| ET | LOC_Os01g10940.1 | CGGAGACGTTCCTCTTCACC | CTTCTCGTAGTCGACGCTGG |
| ET | LOC_Os03g37710.1 | TGAGAGGAGCCATAGGTGGT | GTAGCGGCTCATGTCGAAGT |
| 18S | GTGACGGGTGACGGAGAATT | GACACTAATGCGCCCGGTAT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Javed, K.; Humayun, T.; Humayun, A.; Shaheen, S.; Wang, Y.; Javed, H. Biocontrol Potential of PeBL2, a Novel Entomopathogenic Bacterium from Brevibacillus laterosporus A60, Induces Systemic Resistance against Rice Leaf Folder Cnaphalocrocis exigua (Butler) in Rice (Oryza sativa L.). Plants 2022, 11, 3350. https://doi.org/10.3390/plants11233350
Javed K, Humayun T, Humayun A, Shaheen S, Wang Y, Javed H. Biocontrol Potential of PeBL2, a Novel Entomopathogenic Bacterium from Brevibacillus laterosporus A60, Induces Systemic Resistance against Rice Leaf Folder Cnaphalocrocis exigua (Butler) in Rice (Oryza sativa L.). Plants. 2022; 11(23):3350. https://doi.org/10.3390/plants11233350
Chicago/Turabian StyleJaved, Khadija, Talha Humayun, Ayesha Humayun, Shahida Shaheen, Yong Wang, and Humayun Javed. 2022. "Biocontrol Potential of PeBL2, a Novel Entomopathogenic Bacterium from Brevibacillus laterosporus A60, Induces Systemic Resistance against Rice Leaf Folder Cnaphalocrocis exigua (Butler) in Rice (Oryza sativa L.)" Plants 11, no. 23: 3350. https://doi.org/10.3390/plants11233350
APA StyleJaved, K., Humayun, T., Humayun, A., Shaheen, S., Wang, Y., & Javed, H. (2022). Biocontrol Potential of PeBL2, a Novel Entomopathogenic Bacterium from Brevibacillus laterosporus A60, Induces Systemic Resistance against Rice Leaf Folder Cnaphalocrocis exigua (Butler) in Rice (Oryza sativa L.). Plants, 11(23), 3350. https://doi.org/10.3390/plants11233350

