Next Article in Journal
How Does Quinoa (Chenopodium quinoa Willd.) Respond to Phosphorus Fertilization and Irrigation Water Salinity?
Previous Article in Journal
QTL Mapping Low-Temperature Germination Ability in the Maize IBM Syn10 DH Population
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Characterization of Sedum plumbizincicola HMA Gene Family Provides Functional Implications in Cadmium Response

1
The Institute of Bioinformatics, College of Life Sciences, Anhui Normal University, Wuhu 241000, China
2
State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of Forestry, Beijing 100091, China
3
Key Laboratory of Tree Breeding of Zhejiang Province, The Research Institute of Subtropical Forestry, Chinese Academy of Forestry, Hangzhou 311400, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to the work.
Plants 2022, 11(2), 215; https://doi.org/10.3390/plants11020215
Submission received: 23 December 2021 / Revised: 11 January 2022 / Accepted: 12 January 2022 / Published: 14 January 2022
(This article belongs to the Section Plant Genetics, Genomics and Biotechnology)

Abstract

:
Heavy-metal ATPase (HMA), an ancient family of transition metal pumps, plays important roles in the transmembrane transport of transition metals such as Cu, Zn, Cd, and Co. Although characterization of HMAs has been conducted in several plants, scarcely knowledge was revealed in Sedum plumbizincicola, a type of cadmium (Cd) hyperaccumulator found in Zhejiang, China. In this study, we first carried out research on genome-wide analysis of the HMA gene family in S. plumbizincicola and finally identified 8 SpHMA genes and divided them into two subfamilies according to sequence alignment and phylogenetic analysis. In addition, a structural analysis showed that SpHMAs were relatively conserved during evolution. All of the SpHMAs contained the HMA domain and the highly conserved motifs, such as DKTGT, GDGxNDxP, PxxK S/TGE, HP, and CPx/SPC. A promoter analysis showed that the majority of the SpHMA genes had cis-acting elements related to the abiotic stress response. The expression profiles showed that most SpHMAs exhibited tissue expression specificity and their expression can be regulated by different heavy metal stress. The members of Zn/Co/Cd/Pb subgroup (SpHMA1-3) were verified to be upregulated in various tissues when exposed to CdCl2. Here we also found that the expression of SpHMA7, which belonged to the Cu/Ag subgroup, had an upregulated trend in Cd stress. Overexpression of SpHMA7 in transgenic yeast indicated an improved sensitivity to Cd. These results provide insights into the evolutionary processes and potential functions of the HMA gene family in S. plumbizincicola, laying a theoretical basis for further studies on figuring out their roles in regulating plant responses to biotic/abiotic stresses.

1. Introduction

The rapid development of modern industry, agriculture and urbanization has increased heavy metal contamination [1]. Both essential heavy metals [2] such as cuprum (Cu), zinc (Zn), and manganese (Mn), and some nonessential metals such as cadmium (Cd) can be absorbed by plants. However, excessive accumulation of nonessential heavy metals can produce toxic effects on plants and their toxicity is a problem of increasing significance for they can enter the food chain and finally have a serious impact on the human or environmental system [3,4,5]. To reduce the risks for humans and create a better living environment, soil heavy metal remediation technology has become a research hotspot, among which phytoremediation is widely regarded to have a great prospect [6,7,8].
For the moment, there are more than 720 species of angiosperms have been identified as heavy metal hyperaccumulators, most of which are nickel (Ni) hyperaccumulators [9]. There are about ten kinds of plants that have been identified as Cd hyperaccumulators, among which Sedum plumbizincicola, which is found in a lead-zinc mine in Zhejiang, China, has been extensively studied [10,11,12,13,14]. Normally, Cd hyperaccumulator refers to the accumulation of Cd in the above-ground tissues of the plant at least 100 mg/kg [15], while the accumulation of Cd in the above-ground part of S. plumbizincicola can exceed 7000 mg/kg without showing symptoms of poisoning [16,17]. In addition, it was also found that S. plumbizincicola has a strong Cd transport capacity [18]. At present, researchers have carried out many years of indoor and outdoor experimental research, conducted large-scale farmland restoration experiments and achieved good results. At the same time, they also established the incineration technology of plants containing toxic heavy metals. However, S. plumbizincicola, as an herbaceous plant, has the limitation of low biomass. Therefore, it is of great significance to study the molecular mechanism of high Cd tolerance and enrichment of S. plumbizincicola.
Plants have developed a set of basic strategies to respond to metalliferous soils during their growth and development [19]. It mainly includes the accumulation and transport of heavy metals [20]. Accumulation occurs mainly in the roots and there is a certain limit to the amount of accumulation while transport can realize the absorption and transport of many cations from the root to the shoot and redistribution among aerial parts [21]. Transporters play important roles in these processes. Studies have identified such metal transporters as Zn-regulated transporter-like protein (ZNT/ZIP), metal tolerance protein (MTP), natural resistance associated macrophage protein (NRAMP), heavy-metal ATPase (HMA), and ATP-binding cassette (ABC) to participate in metal transportation [22]. Among these transporters, heavy-metal ATPase (HMA), also known as P1B-type ATPase, belongs to the P-type ATPase superfamily, a large group of enzymes that can pump a wide range of cations across membranes against their electrochemical with the energy resulting from ATP hydrolysis [23]. Structurally, the HMAs usually contain 6–8 transmembrane helices, a CPx/SPC motif in transmembrane domain six and metal-binding domains in the N-terminal and C-terminal regions that can bind and interact with specific metal ions, such as Cd2+ and Pb2+. HMAs can be divided into two groups by the substrate specificity, namely, the Cu/Ag-ATPases group and Zn/Co/Cd/Pb-ATPases group [24,25]. The physiological functions of HMAs were revealed at the genomic scale in Arabidopsis thaliana and Oryza sativa. There are 8 HMAs in A. thaliana and 9 in O. sativa respectively, among which, AtHMA1–4 and OsHMA1–3 belong to the Cu/Ag subgroup, and AtHMA5–8 and OsHMA4–9 belong to the Zn/Co/Cd/Pb subgroup [26]. In A. thaliana, AtHMA1 localizes to the chloroplast envelope and is involved in exporting Zn from the chloroplast [27]. Overexpression of AtHMA3 enhances tolerance and accumulation of Cd, Zn, Pb, and Co in plants [28]. AtHMA4, knockout mutants show more sensitivity to Cd and Zn than the wild type [29,30]. In O. sativa, OsHMA1 is suspected to be involved in Zn transport, whereas OsHMA3 only transports Cd and acts as a Cd isolation agent in root cell vacuoles [23,31,32].
In addition, the HMA gene family has been identified in other species of plants including barley, Populus trichocarpa, and Brassica napus [33,34,35]. To date, researchers working on S. plumbizincicola have revealed that SpHMA1 located in the chloroplast membrane acting as a chloroplast Cd exporter and protecting photosynthesis by preventing the accumulation of Cd in the chloroplast, SpHMA2 was located in plasma membrane and its heterologous expression in yeast increased Cd resistance. SpHMA3 localized in the tonoplast played a crucial part in Cd detoxification in young leaves and stems by sequestrating Cd into the vacuoles instead of directly regulating Cd accumulation [17,36,37]. Nevertheless, current studies on the HMA gene family of S. plumbizincicola are very limited. As such, the present study sets out to perform a genome-wide analysis, phylogenetic analysis, as well as expressional analysis of the SpHMAs to provide a theoretical basis for further studies on the functions and molecular mechanisms of HMA genes in S. plumbizincicola.

2. Results

2.1. Genome-Wide Analysis of the SpHMAs

In this study, a total of 8 HMA genes were identified in S. plumbizincicola (Table S1). These genes were named SpHMA1-SpHMA8 based on phylogenetic relationships in order to be consistent with HMA gene family members in S. plumbizincicola which were confirmed previously and their basic characteristic information is organized in Table 1. The length of their deduced proteins ranged from 694 aa to 995 aa, with an average length of 859.875 aa (Table S2). The predicted isoelectric points of the HMA proteins are in the range of 5.55 (SpHMA1) to 8.67 (SpHMA5) and approximately 90% of them have a molecular weight above 80 KDa. All of the SpHMAs contain the conserved HMA motifs (DKTGT, GDGxNDxP, PxxK S/TGE, HP, and CPx/SPC) and there is basically no significant difference among them. Previous studies in SpHMA1, SpHMA2, and SpHMA3 have shown their subcellular localization is distributed in three different locations of chloroplast membrane, plastid membrane and tonoplast, respectively. Here we predicted the subcellular localizations of the rest of SpHMAs with the Plant-mPLoc software and found that all of them have a cell membrane localization.
By mapping the location of SpHMA genes in the S. plumbizincicola genome, we found that all the candidate HMA gene family members were randomly distributed on different chromosomes and all of them primarily located at the two ends of the chromosomes except SpHMA7 (Figure 1).

2.2. Phylogenetic and Classification of the HMA Gene Family

In order to figure out the evolutionary relationships of S. plumbizincicola HMA genes, we constructed a phylogenetic tree using the HMA protein sequences from A. thaliana, O. sativa, Kalanchoe laciniata, and S. plumbizincicola (Figure 2). According to the phylogenetic analysis, the HMA genes can be separated into two major groups, namely, Zn/Co/Cd/Pb subgroup and Cu/Ag subgroup. AtHMA1-AtHMA4, OsHMA1-OsHMA3, Kaladp0024s0591, Kaladp0515s0200, Kaladp0016s0349, and SpHMA1-SpHMA3 belong to the Zn/Co/Cd/Pb subgroup, while AtHMA5-AtHMA8, OsHMA4-OsHMA9, Kaladp0037s0087, Kaladp0022s0152, Kaladp0037s0088, Kaladp0023s0025, and SpHMA4-SpHMA8 are classified to the Cu/Ag subgroup. The results of this study on the phylogenetic relationships of HMA gene family members in A. thaliana, O. sativa are consistent with previous studies [23]. Remarkably, the relationship between S. plumbizincicola and K. laciniata was closer than that between S. plumbizincicola and other plants.

2.3. Conserved Motifs and Gene Structure of SpHMAs

Previous studies have revealed that the members of the HMA gene family were characterized by conserved motifs (DKTGT, GDGxNDxP, PxxK S/TGE, HP, and CPx/SPC). To further explore structural diversity and predict the potential function of them, 12 motifs were predicted with MEME Online software (Figure 3). Based on the results, we found that members of the same subclass mostly share the same motifs and members of different subclasses have slight differences. For instance, comparing with Cu/Ag-ATPases group, the members of Zn/Co/Cd/Pb subgroup are missing several motifs. The motif 10 is missing in SpHMA1 while motifs 4, 9, and 10 are missing in SpHMA2 and motif 9 is missing in SpHMA2. The order of the motifs is basically the same regardless of the subclasses they belong to.
The intron/exon organization, and the intron types and numbers can play an important role in the evolution of gene families, thus we detected the exon-intron structures of SpHMA genes (Figure 3) and the result shows that the number of introns in each SpHMA gene range from 5 to 17 and SpHMA genes except SpHMA7 have a complete UTR region. The members in the same branch have a similar number of exons and introns, which suggests a conserved relationship in the process of evolution. For example, SpHMA6 and SpHMA8, located in the same clade, have 16 and 22 introns respectively, and SpHMA2 and SpHMA3 have 7 and 8 introns.
Conserved domains are the core of genes and largely determine the function of them (Figure 3C). It was found in this study that all the SpHMA proteins contain domains unique to HMA gene family members reported previous and the type of these domains form consistency with evolutionary relationship.

2.4. Cis-Acting Elements in the Promoter Regions of SpHMA Genes

Cis-acting elements are significant in gene transcription initiation regulation, due to the special functions of transcription factors DNA binding sites and other regulatory motifs. As an important gene family that can regulate heavy metal transport, the cis-acting elements of the promoter of SpHMA genes are worth to be detected. We selected promoters with 2000 bp region upstream of 5′ UTR to analyze with PlantCare (Figure 4). A total of 30 cis-regulatory elements were found in SpHMA genes. Generally, these cis-acting elements can be divided into 3 categories, including cis-acting elements involved in growth and development, phytohormone responsiveness and biotic/abiotic stress. Most of the SpHMA genes contain abiotic stress response elements, such as cis-acting regulatory element essential for the anaerobic induction (ARE) and box4 (part of the conserved DNA module involved in light response) elements. MBS (MYB binding site involved in drought inducibility) were found in promoter sequences of SpHMA2, SpHMA3, SpHMA5, SpHMA6 and LTR low-temperature response (LTR) elements were found in promoter sequences of SpHMA4, SpHMA5, SpHMA6, and SpHMA8. Moreover, phytohormone response elements were also detected in SpHMA genes. The CGTCA-motif and TGACG-motif (cis-acting regulatory element involved in the MeJA-responsiveness) were present in most promoter regions of SpHMA genes. We found ABRE (cis-acting element involved in the abscisic acid responsiveness) in SpHMA1, SpHMA4, SpHMA5 and SpHMA8. These results suggest that the SpHMAs may be regulated by various factors of stress, growth and development, and hormones.

2.5. Co-Expression Analysis of the HMA Genes in S. plumbizincicola

Gene co-expression networks can be used to link genes of unknown function to certain biological processes [38]. In this study, we identified 5 hub genes, including SpHMA1, SpHMA2, SpHMA3, SpHMA4, SpHMA7, which were strongly associated with co-expressed genes. According to the network, there are 653 nodes and 792 edges (Figure 5), and basing on various functions, the edges were divided into 6 groups: binding process (405), catalytic activity (346), antioxidant activity (17), transporter activity (24), transcription factor activity (45), and response to stimulus (18) (Table S3). The co-expressed genes of most SpHMAs contained the above six groups of edges, suggesting that SpHMAs may be responsive to plant stress-related stimuli. Among them, SpHMA2 constitutes the largest module of the network and is associated with Cd stress [37].

2.6. Expression Profiles of SpHMA Genes in Various Tissues

Transcriptome expression analysis can potentially reveal the tissue specificity of the HMA gene family, and the general expressions were presented as a heat map in Figure 6. Based on the result, it was obvious that SpHMA2 was significantly expressed in roots. The SpHMA4, SpHMA5, and SpHMA7 also showed higher root specificity compared with leaves and stems. Besides, SpHMA3 was expressed in roots, stems, and leaves, but a higher expression level was found in stems and leaves while SpHMA6 and SpHMA8 were preferentially expressed in leaves.

2.7. qRT-PCR Expression Analysis of the SpHMAs

The expression levels of SpHMAs were analyzed in different tissues under various treatment (Figure 7). Under Fe deficiency, the expression of SpHMA1, 2 and 3 appeared largely unaffected in various organizations, whereas the genes (SpHMA4, 5, 6 and 8) were found to be upregulated to varying degrees in roots (Figure 7A). The expression of SpHMAs in the Mn deficiency condition was similar to that in the Fe deficiency treatment and most genes tend to be upregulated and then slowly recovered, instead of upregulated continuously. For instance, the SpHMA5 was significantly upregulated in stems at 12 h and subsequently returned to normal levels (Figure 7B). Under the Zn stress, the genes (SpHMA1, 2 and 3) seemed to be upregulated at different time points in various organizations, whereas the members of Cu/Ag subgroup, mostly showed an unaffected or down-regulated trend, except the SpHMA4 and SpHMA7 (Figure 7C). Similarly, our results showed that SpHMA1 and SpHMA2 were significantly more highly expressed in roots in response to Cd, which is consistent with previous studies. Notably, we observed that the expression level of SpHMA7 was also slightly upregulated in roots under Cd treatment and the upregulated trend was more obvious in leaves (Figure 7D).

2.8. Heterologous Expression of SpHMA7 in Yeast

Combined with the above qRT-PCR experimental results, the SpHMA7 was selected to be overexpressed in yeast cells exposed to Cd stress. We cloned the SpHMA7 with a total length of 2085 bp and successfully constructed the heterologous expression vector. The yeast strains expressing SpHMA7 were presented to be more sensitive to 30 μM CdCl2 compared with the empty vector (Figure 8A). According to the results of growth curves, the growth inhibition of SpHMA7 under Cd stress was more severe, which further confirms the above results (Figure 8B). These results altogether indicated that SpHMA7 may prevent the efflux of Cd by some means, and the specific mechanism needs to be further explored.

3. Discussion

The heavy-metal ATPase plays an important role in plants heavy metal transport as a transmembrane transporter [39]. Since S. plumbizincicola tends to grow in mining areas rich in heavy metals and shows an excellent heavy metal resistance, we thought it might contain a great many members of the HMA gene family, but we detected only eight members [40]. In the phylogenetic tree, these HMA genes are divided into two subgroups, among which, of the same genus S. plumbizincicola and K. laciniata, whose genome data have been published, are more closely related. This suggests that the HMA gene family is relatively conserved in the family Crassulaceae, and in other words the existing HMA members can play an important role. Further analysis also revealed that the HMA gene family is well-conserved and still contains some functional conserved sites such as DKTGT, GDGxNDxP, PxxK, TGE, HP, and CPC during the evolution of the S. plumbizincicola genome. However, these sites can be mutated in individual genes, and these changes may lead to the diversity of gene functions. For instance, CPC was an important metal binding sites and even found to be part of the Cd2+ transport sites, here in SpHMA1 protein sequence, it changes to SPC [41]. In addition, we also found other conservative motifs in SpHMAs, such as Motif 9 and Motif 10, whose function is unknown and needs further study.
Subcellular localization is often closely related to the protein function, and here we predicted subcellular localization directly from the SpHMAs protein sequences and found that almost all the SpHMAs were predicted to be localized to the cell membrane except SpHMA1 and SpHMA3, which were confirmed to be located in chloroplast and tonoplast, respectively [42]. From a phylogenetic perspective, SpHMA1-3 belong to the Zn/Co/Cd/Pb-ATPases group, among which, SpHMA2 has a cell membrane localization. The results showed that subcellular localization of different subfamily members can be different, and the same subfamily members are also not share the same subcellular localization completely, suggesting that homologous genes may also play different roles. Of course, the exact location must be verified by specific experiments.
Most of the previous studies on members of the SpHMA gene family were focused on heavy metal stress, SpHMA1 has been identified as a Cd transporter for exporting Cd from the chloroplasts to the cytoplasm, SpHMA2 were identified as candidate Cd transport genes, and SpHMA3 functions to transport Cd from the cytoplasm into the vacuoles [37,43,44]. Therefore, we used bioinformatics methods to predict and analyze cis-acting elements of all candidate SpHMAs promoters, and constructed the co-expression networks. The promoter analysis showed that most members of the HMA gene family contained elements related to biotic/abiotic stress and the co-expression analysis also confirmed its role in stimulus and abiotic responses. These results conformably proved that SpHMAs might play a crucial role in plant abiotic stress.
To better understand the potential functions of SpHMA genes, we studied the expression pattern of SpHMAs in different tissues using RNA-seq data and the result showed that most SpHMAs had tissue expression specificity. The SpHMA5 has the highest expression levels in roots and almost no expression in stems and leaves. Moreover, the SpHMA3 is highly expressed in the stems and leaves, which is consistent with previous studies [17]. To further verify the expression of SpHMA gene obtained from RNA-seq data, qRT-PCR experiments were carried out with three different organizations (roots, stems, and leaves) under different treatments, including 50 μM CdCl2, 100 μM ZnSO4, and Fe/Mn deficiency. It has been confirmed that AtHMA1 and OsHMA1 are involved in Zn and Cd transport and SpHMA1 functions as a chloroplast Cd exporter [45]. AtHMA3 and OsHMA3 can transport Cd and excess Zn into the vacuoles, and SpHMA3 plays an important role in Cd detoxification in the way of sequestrating Cd into the vacuoles, instead of directly regulating Cd hyperaccumulation for detoxification [46]. In this study, we found that both the expression of SpHMA1 and SpHMA3 were upregulated under Zn treatment, suggesting that they may also be involved in Zn transport. AtHMA2 was found to export Zn and Cd in the vascular tissues for root-to-shoot transportation and the SpHMA2 was recently discovered to play a similar role in Cd transport [47]. Here the results of qRT-PCR indicated that it can also be induced by other metals. AtHMA4 belongs to the Zn/Co/Cd/Pb subclass in A. thaliana, which is related to the effluence of Cd. While SpHMA4 in this study belongs to the Cu/Ag subclass, it may be related to Fe transport [48]. AtHMA5 participates in Cu detoxification and OsHMA5 is involved in xylem loading of Cu. AtHMA6 (PAA1) and AtHMA8 (PAA2) are responsible for the transporting of Cu ions across the chloroplast envelope and thylakoids [49]. Our data suggested that the expression levels of the genes (SpHMA4, 5, 6, and 8) were not induced by Cd and Zn, but in response to Mn and Fe to some extent. Specially, the expression level of SpHMA7 was slightly upregulated in stems and leaves in Cd treatment, whereas, the expression was firstly upregulated and subsequently down-regulated in roots.
In view of the results of the co-expression regulatory network and qRT-PCR experiments, we selected the hub gene, SpHMA7, for yeast heterologous expression assays to explore whether it can transport Cd. Recent studies have found that SpHMA2, belonging to the Zn/Co/Cd/Pb-ATPases group, which has a cell membrane location, showed weak Cd accumulation in yeast [37]. In this study, SpHMA7, the Cu/Ag subgroup member, which was predicted to be located in the cell membrane appeared to be sensitive to Cd compared with the control in yeast. In the above qRT-PCR experiment, SpHMA7 showed signs of up-regulation in roots, stems and leaves, suggesting its involvement in Cd stress response. It was speculated that Cd may occupy Cu2+ transport (SpHMA7) to promote the transport of Cd into cytoplasm.

4. Conclusions

In this study, we detected 8 HMA members in S. plumbizincicola which were divided into two subgroups according to phylogenetic relationship. The analysis of gene characterization, phylogenetic relationship, and biological function suggested that the SpHMAs are conservative during the evolution of S. plumbizincicola and play an important role in abiotic stress. The expression profiling of the SpHMAs presented tissue specificity under different metal stress. Heterologous expression of SpHMA7 in yeast showed sensitivity to Cd stress. These results will be beneficial for further analysis of the mechanism of stress resistance of HMAs in S. plumbizincicola.

5. Materials and Methods

5.1. Plant Materials and Treatments

S. plumbizincicola used in this study was obtained from an old Pb/Zn mine in Quzhou City, Zhejiang Province, China and then cultivated in an artificial climate chamber at 25 °C (16 h light, 8 h dark). The seedlings from a single genotype were water-cultivated initially in one-eighth-strength Hoagland nutrient solution and increased to half-strength after 3 days [50]. For about 1-month cultivation, the seedlings were treated with 50 μM CdCl2, 100 μM ZnSO4, Fe/Mn deficiency and samples in the form of roots, stems and leaves were collected at 0, 6, 12, 24 and 48 h with three biological duplications. All the samples were immediately stored at −80 °C for subsequent analysis.

5.2. Identification and Sequence Analysis of HMA Genes in S. plumbizincicola

The whole genome sequences of S. plumbizincicola were obtained from Zhuo’s lab (unpublished), while the protein sequences of HMAs in the model plants A. thaliana and O. sativa were downloaded from Tair (https://www.arabidopsis.org/, accessed on 3 March 2021) and rgap (http://rice.uga.edu/, accessed on 4 March 2021), respectively. To identify the members of the HMA gene family in S. plumbizincicola, two strategies were applied using the above sequences. First, the eight known HMA genes from A. thaliana were used as queries to carry out local BLASTp searches in the S. plumbizincicola Database with a cutoff e-value of 1 × 10−10 Then the SMART (http://smart.embl-heidelberg.de/, accessed on 13 March 2021) and PFAM (http://pfam.xfam.org/, accessed on 13 March 2021) were used to check the candidate sequences that contained the conserved domains belonging to the HMA gene family. Second, a hidden Markov Model (PF00403) was obtained from the Pfam database (http://pfam.xfam.org/, accessed on 13 March 2021) to search putative HMA genes from S. plumbizincicola with default thresholds. Finally, we manually deleted sequences that lacked conserved sequence motifs.
The molecular weight (MW) and isoelectric point (pI) of each HMA protein were calculated by ExPaSy (https://www.expasy.org/resources/protparam, accessed on 15 March 2021), and Plant-mPLoc (http://www.csbio.sjtu.edu.cn/bioinf/plant-multi/#, accessed on 15 March 2021) was employed to forecast their subcellular localization. The chromosomal location of S. plumbizincicola HMA genes were obtained and mapped by the TBtools software (https://github.com/CJ-Chen/TBtools, accessed on 15 March 2021).

5.3. Exon-Intron Structure, Motif Analysis and Promoter Element Analysis

We employed the online program Gene Structure Display Server [51] to generate the exon/intron organization of HMA genes and MEME (http://meme.sdsc.edu, accessed on 18 March 2021) was used to identify the motifs with a maximum motif number of 12. To identify the cis-acting elements of 8 SpHMA genes in the 2000 bp region upstream of 5′ untranslated region, the online software PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 17 March 2021) was utilized. All results were visualized using the TBtools software.

5.4. Phylogenetic Analysis

To study the phylogenetic relationship among HMA genes in S. plumbizincicola, the HMA amino acid sequences from A. thaliana, O. sativa and K. laciniata were downloaded from public databases and then all of them were aligned by MUSCLE and MEGA 7.0 was used to construct a maximum likelihood (ML) phylogenetic tree with 1000 bootstrap replicates. The evolutionary tree was finally visualized using the online tool Evolview (https://evolgenius.info//evolview-v2/#login, accessed on 18 March 2021).

5.5. RNA Isolation and Expression Analysis

The total RNA was isolated from roots, stems, and leaves using the Tiangen RNAprep plant kit (Tiangen, Beijing, China). First-strand cDNA synthesis was carried out with the PrimeScript™ RT reagent kit (Perfect Real Time; Takara, Dalian, China) and stored at −20 °C after diluting five times. To explore the expression of SpHMA genes, we firstly extracted the expression profiles of 8 SpHMA genes in different tissues with 3 biological repetitions from transcriptome data and quantitative real-time PCR (qRT-PCR) was subsequently performed using SYBR® Premix ExTaq™ reagent (TaKaRa, Dalian, China) with an amplification procedure reported previously in the QuantStudio™7 Flex Real-Time PCR instrument (Applied Biosystems, Foster City, California, United States ) to study the expression of genes describe above (5.1. Plant materials and Treatments). All specific primers were designed by Primer Premier 5.0 and the details are shown in Table 2. A total of 20 μL reaction volume was used, including 10 μL SYBR® Premix Ex Taq™ (2×), 0.4 μL gene-specific primers, and 0.4 μL ROX Reference Dye (50 × 5, 2 μL cDNA and 6.8 μL ddH2O. Each sample was performed with three technical replicates to ensure the reliability of the results. Finally, we calculated the gene expression by the 2−ΔΔCT method and selected SpUBC9 as the reference gene.

5.6. Co-Expression Network Construction

The co-expression relationships of 5 selected genes were extracted from the transcriptome dataset of S. plumbizincicola [52] and the GO annotation information was obtained from the online platform (http://www.omicshare.com/tools/Home/Soft/osgo, accessed on 28 September 2021). Eventually, a co-expression network was constructed and visualized using the Cytoscape software.

5.7. Cloning and Construction of Expression Vectors

For further study the functions of HMA genes, we cloned the full length of SpHMA7 with KOD-Fx DNA Polymerase (Toyobo, Japan) and digested the plasmid of vector pYES2.0 with Hind Ⅲ and XbaⅠ (NEB, Nanjing, China). The purified PCR products were then cloned into the vector using ClonExpress II One Step Cloning Kit (Vazyme, Nanjing, China). Positive clones were selected and sequenced to ensure the successful construction of recombinant vector. Primers used in the process above were showed in Table 2.

5.8. Yeast Expression Experiment

To explore the Cd tolerance of HMA in yeast, the recombinant plasmids pYES2.0-SpHMA7 and empty pYES2.0 vector (control) were transformed into Cd-sensitive mutant yeast strain ∆ycf1 by the lithium acetate method [53]. Transformed yeast cells were cultivated in fluid nutrient medium with synthetic galactose-uracil (SG-U) until reaching the same OD600. The cells were spotted on SG-U agar plates supplemented with 0 and 30 μM CdCl2 for about three days at 28 °C in an incubator after gradient dilution (OD600 = 10−0, 10−1, 10−2, 10−3, 10−4, and 10−5). Furthermore, the relative growth of transformants was determined in the way of measuring the optical density at 600 nm every 12 h.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants11020215/s1, Table S1: detailed information of gene sequence of SpHMAs; Table S2: detailed information of protein sequence of SpHMAs; Table S3: annotation of edges connected with hub SpHMAs.

Author Contributions

X.K. and R.Z. conceived and designed the experiments; Data curation, Q.H. and S.L.; Formal analysis, Q.H. and Y.Z.; Investigation, Q.H., M.Y., and Z.L.; Software, Z.L.; Validation, Q.H. and W.Q.; Writing—original draft, Q.H. and W.Q.; Writing—review and editing, W.Q. and R.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Nonprofit Institute Research Grant of CAF (No. CAFYBB2019SZ001 RISFZ-2021-01 and CAFYBB2020SY016).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Conflicts of Interest

The authors declare that the study was conducted in the absence of any commercial or financial relationship that could be construed as a potential conflict of interest.

References

  1. Adimalla, N.; Chen, J.; Qian, H. Spatial characteristics of heavy metal contamination and potential human health risk assessment of urban soils: A case study from an urban region of South India. Ecotoxicol. Environ. Saf. 2020, 194, 110406. [Google Scholar] [CrossRef]
  2. Baker, A.J.; Brooks, R. Terrestrial higher plants which hyperaccumulate metallic elements. A review of their distribution, ecology and phytochemistry. Biorecovery 1989, 1, 81–126. [Google Scholar]
  3. Pedron, T.; Segura, F.R.; da Silva, F.F.; de Souza, A.L.; Maltez, H.F.; Batista, B.L. Essential and non-essential elements in Brazilian infant food and other rice-based products frequently consumed by children and celiac population. J. Food Compos. Anal. 2016, 49, 78–86. [Google Scholar] [CrossRef]
  4. Ali, H.; Khan, E. Trophic transfer, bioaccumulation, and biomagnification of non-essential hazardous heavy metals and metalloids in food chains/webs—Concepts and implications for wildlife and human health. Hum. Ecol. Risk Assess. 2019, 25, 1353–1376. [Google Scholar] [CrossRef]
  5. Halder, D.; Saha, J.K.; Biswas, A. Accumulation of essential and non-essential trace elements in rice grain: Possible health impacts on rice consumers in West Bengal, India. Sci. Total Environ. 2020, 706, 135944. [Google Scholar] [CrossRef] [PubMed]
  6. Huang, Y.; Hao, X.; Lei, M.; Tie, B. The remediation technology and remediation practice of heavy metals-contaminated soil. J. Agro-Environ. Sci. 2013, 32, 409–417. [Google Scholar]
  7. Cunningham, S.D.; Ow, D.W. Promises and Prospects of Phytoremediation. Plant Physiol. 1996, 110, 715–719. [Google Scholar] [CrossRef] [PubMed]
  8. Awa, S.H.; Hadibarata, T. Removal of heavy metals in contaminated soil by phytoremediation mechanism: A review. Water Air Soil Pollut. 2020, 231, 1–15. [Google Scholar] [CrossRef]
  9. Sytar, O.; Ghosh, S.; Malinska, H.; Zivcak, M.; Brestic, M. Physiological and molecular mechanisms of metal accumulation in hyperaccumulator plants. Physiol. Plant. 2021, 173, 148–166. [Google Scholar] [CrossRef]
  10. Verbruggen, N.; Juraniec, M.; Baliardini, C.; Meyer, C.-L. Tolerance to cadmium in plants: The special case of hyperaccumulators. BioMetals 2013, 26, 633–638. [Google Scholar] [CrossRef]
  11. Wu, L.H.; Liu, Y.J.; Zhou, S.B.; Guo, F.G.; Bi, D.; Guo, X.H.; Baker, A.J.M.; Smith, J.A.C.; Luo, Y.M. Sedum plumbizincicola X.H. Guo et S.B. Zhou ex L.H. Wu (Crassulaceae): A new species from Zhejiang Province, China. Plant Syst. Evol. 2013, 299, 487–498. [Google Scholar] [CrossRef]
  12. Song, W.; Wang, J.; Zhai, L.; Ge, L.; Hao, S.; Shi, L.; Lian, C.; Chen, C.; Shen, Z.; Chen, Y. A meta-analysis about the accumulation of heavy metals uptake by Sedum alfredii and Sedum plumbizincicola in contaminated soil. Int. J. Phytoremed. 2021. [Google Scholar] [CrossRef]
  13. Sun, L.; Cao, X.; Tan, C.; Deng, Y.; Cai, R.; Peng, X.; Bai, J. Analysis of the effect of cadmium stress on root exudates of Sedum plumbizincicola based on metabolomics. Ecotoxicol. Environ. Saf. 2020, 205, 111152. [Google Scholar] [CrossRef] [PubMed]
  14. Huang, R.; Dong, M.; Mao, P.; Zhuang, P.; Paz-Ferreiro, J.; Li, Y.; Li, Y.; Hu, X.; Netherway, P.; Li, Z. Evaluation of phytoremediation potential of five Cd (hyper) accumulators in two Cd contaminated soils. Sci. Total Environ. 2020, 721, 137581. [Google Scholar] [CrossRef]
  15. Wong, C.K.E.; Cobbett, C.S. HMA P-type ATPases are the major mechanism for root-to-shoot Cd translocation in Arabidopsis thaliana. New Phytol. 2009, 181, 71–78. [Google Scholar] [CrossRef]
  16. Cao, D.; Zhang, H.; Wang, Y.; Zheng, L. Accumulation and Distribution Characteristics of Zinc and Cadmium in the Hyperaccumulator Plant Sedum plumbizincicola. Bull. Environ. Contam. Toxicol. 2014, 93, 171–176. [Google Scholar] [CrossRef] [PubMed]
  17. Liu, H.; Zhao, H.; Wu, L.; Liu, A.; Zhao, F.J.; Xu, W. Heavy metal ATPase 3 (HMA3) confers cadmium hypertolerance on the cadmium/zinc hyperaccumulator Sedum plumbizincicola. New Phytol. 2017, 215, 687–698. [Google Scholar] [CrossRef] [Green Version]
  18. Li, L.-Z.; Tu, C.; Wu, L.-H.; Peijnenburg, W.J.G.M.; Ebbs, S.; Luo, Y.-M. Pathways of root uptake and membrane transport of Cd2+ in the zinc/cadmium hyperaccumulating plant Sedum plumbizincicola. Environ. Toxicol. Chem. 2017, 36, 1038–1046. [Google Scholar] [CrossRef]
  19. Fasani, E.; Manara, A.; Martini, F.; Furini, A.; DalCorso, G. The potential of genetic engineering of plants for the remediation of soils contaminated with heavy metals. Plant Cell Environ. 2018, 41, 1201–1232. [Google Scholar] [CrossRef] [PubMed]
  20. Verbruggen, N.; Hermans, C.; Schat, H. Molecular mechanisms of metal hyperaccumulation in plants. New Phytol. 2009, 181, 759–776. [Google Scholar] [CrossRef]
  21. Schat, H.; Llugany, M.; Bernhard, R. Metal-specific patterns of tolerance, uptake, and transport of heavy metals in hyperaccumulating and nonhyperaccumulating metallophytes. In Phytoremediation of Contaminated Soil and Water; CRC Press: Boca Raton, FL, USA, 2020; pp. 171–188. [Google Scholar]
  22. Zeng, F.; Chen, G.; Chen, X.; Li, Q.; Wu, X.; Zhang, G.-P. Cadmium accumulation in plants: Insights from physiological/molecular mechanisms to evolutionary biology. Authorea Preprint 2020. [Google Scholar] [CrossRef]
  23. Williams, L.E.; Mills, R.F. P1B-ATPases—An ancient family of transition metal pumps with diverse functions in plants. Trends Plant Sci. 2005, 10, 491–502. [Google Scholar] [CrossRef] [PubMed]
  24. Axelsen, K.B.; Palmgren, M.G. Evolution of substrate specificities in the P-type ATPase superfamily. J. Mol. Evol. 1998, 46, 84–101. [Google Scholar] [CrossRef]
  25. Smith, A.T.; Smith, K.P.; Rosenzweig, A.C. Diversity of the metal-transporting P 1B-type ATPases. J. Biol. Inorg. Chem. 2014, 19, 947–960. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Axelsen, K.B.; Palmgren, M.G. Inventory of the superfamily of P-type ion pumps in Arabidopsis. Plant Physiol. 2001, 126, 696–706. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Kim, Y.Y.; Choi, H.; Segami, S.; Cho, H.T.; Martinoia, E.; Maeshima, M.; Lee, Y. AtHMA1 contributes to the detoxification of excess Zn (II) in Arabidopsis. Plant J. 2009, 58, 737–753. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Morel, M.; Crouzet, J.; Gravot, A.; Auroy, P.; Leonhardt, N.; Vavasseur, A.; Richaud, P. AtHMA3, a P1B-ATPase allowing Cd/Zn/co/Pb vacuolar storage in Arabidopsis. Plant Physiol. 2009, 149, 894–904. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  29. Mills, R.F.; Francini, A.; da Rocha, P.S.F.; Baccarini, P.J.; Aylett, M.; Krijger, G.C.; Williams, L.E. The plant P1B-type ATPase AtHMA4 transports Zn and Cd and plays a role in detoxification of transition metals supplied at elevated levels. FEBS Lett. 2005, 579, 783–791. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  30. Verret, F.; Gravot, A.; Auroy, P.; Leonhardt, N.; David, P.; Nussaume, L.; Vavasseur, A.; Richaud, P. Overexpression of AtHMA4 enhances root-to-shoot translocation of zinc and cadmium and plant metal tolerance. FEBS Lett. 2004, 576, 306–312. [Google Scholar] [CrossRef] [Green Version]
  31. Ueno, D.; Yamaji, N.; Kono, I.; Huang, C.F.; Ando, T.; Yano, M.; Ma, J.F. Gene limiting cadmium accumulation in rice. Proc. Natl. Acad. Sci. USA 2010, 107, 16500–16505. [Google Scholar] [CrossRef] [Green Version]
  32. Miyadate, H.; Adachi, S.; Hiraizumi, A.; Tezuka, K.; Nakazawa, N.; Kawamoto, T.; Katou, K.; Kodama, I.; Sakurai, K.; Takahashi, H. OsHMA3, a P1B-type of ATPase affects root-to-shoot cadmium translocation in rice by mediating efflux into vacuoles. New Phytol. 2011, 189, 190–199. [Google Scholar] [CrossRef] [PubMed]
  33. Fang, X.; Wang, L.; Deng, X.; Wang, P.; Ma, Q.; Nian, H.; Wang, Y.; Yang, C. Genome-wide characterization of soybean P 1B-ATPases gene family provides functional implications in cadmium responses. BMC Genom. 2016, 17, 376. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Li, D.; Xu, X.; Hu, X.; Liu, Q.; Wang, Z.; Zhang, H.; Wang, H.; Wei, M.; Wang, H.; Liu, H. Genome-wide analysis and heavy metal-induced expression profiling of the HMA gene family in Populus trichocarpa. Front. Plant Sci. 2015, 6, 1149. [Google Scholar] [CrossRef] [PubMed]
  35. Li, N.; Xiao, H.; Sun, J.; Wang, S.; Wang, J.; Chang, P.; Zhou, X.; Lei, B.; Lu, K.; Luo, F. Genome-wide analysis and expression profiling of the HMA gene family in Brassica napus under cd stress. Plant Soil 2018, 426, 365–381. [Google Scholar] [CrossRef]
  36. Zhao, H.; Wang, L.; Zhao, F.J.; Wu, L.; Liu, A.; Xu, W. SpHMA1 is a chloroplast cadmium exporter protecting photochemical reactions in the Cd hyperaccumulator Sedum plumbizincicola. Plant Cell Environ. 2019, 42, 1112–1124. [Google Scholar] [CrossRef] [PubMed]
  37. Zhu, Y.; Qiu, W.; Li, Y.; Tan, J.; Han, X.; Wu, L.; Jiang, Y.; Deng, Z.; Wu, C.; Zhuo, R. Quantitative proteome analysis reveals changes of membrane transport proteins in Sedum plumbizincicola under cadmium stress. Chemosphere 2022, 287, 132302. [Google Scholar] [CrossRef]
  38. Van Dam, S.; Vosa, U.; van der Graaf, A.; Franke, L.; de Magalhaes, J.P. Gene co-expression analysis for functional classification and gene–disease predictions. Brief Bioinform. 2018, 19, 575–592. [Google Scholar] [CrossRef]
  39. Nosek, M.; Kaczmarczyk, A.; Jędrzejczyk, R.J.; Supel, P.; Kaszycki, P.; Miszalski, Z. Expression of genes involved in heavy metal trafficking in plants exposed to salinity stress and elevated Cd concentrations. Plants 2020, 9, 475. [Google Scholar] [CrossRef] [Green Version]
  40. Zhang, Z.; Qiu, W.; Liu, W.; Han, X.; Wu, L.; Yu, M.; Qiu, X.; He, Z.; Li, H.; Zhuo, R. Genome-wide characterization of the hyperaccumulator Sedum alfredii F-box family under cadmium stress. Sci. Rep. 2021, 11, 3023. [Google Scholar] [CrossRef]
  41. Bal, N.; Wu, C.C.; Catty, P.; Guillain, F.; Mintz, E. Cd2+ and the N-terminal metal-binding domain protect the putative membranous CPC motif of the Cd2+-ATPase of Listeria monocytogenes. Biochem. J. 2003, 369, 681–685. [Google Scholar] [CrossRef]
  42. Yu, C.-S.; Chen, Y.-C.; Lu, C.-H.; Hwang, J.-K. Prediction of protein subcellular localization. Proteins 2006, 64, 643–651. [Google Scholar] [CrossRef] [PubMed]
  43. Zhang, J.; Martinoia, E.; Lee, Y. Vacuolar transporters for cadmium and arsenic in plants and their applications in phytoremediation and crop development. Plant Cell Physiol. 2018, 59, 1317–1325. [Google Scholar] [CrossRef] [PubMed]
  44. Wu, L.; Hu, P.; Li, Z.; Xu, W.; Zhou, T.; Zhong, D.; Luo, Y. Element case studies: Cadmium and zinc. In Agromining: Farming for Metals; Springer: Berlin/Heidelberg, Germany, 2021; pp. 453–469. [Google Scholar]
  45. Takahashi, R.; Bashir, K.; Ishimaru, Y.; Nishizawa, N.K.; Nakanishi, H. The role of heavy-metal ATPases, HMAs, in zinc and cadmium transport in rice. Plant Signal. Behav. 2012, 7, 1605–1607. [Google Scholar] [CrossRef] [PubMed]
  46. Haque, A.M.; Gohari, G.; EI-Shehawi, A.M.; Dutta, A.K.; Elseehy, M.M.; Kabir, A.H. Genome wide identification, characterization and expression profiles of heavy metal ATPase3 (HMA3) in plants. J. King Saud Univ. Sci. 2022, 34, 101730. [Google Scholar] [CrossRef]
  47. Takahashi, R.; Ishimaru, Y.; Shimo, H.; Ogo, Y.; Senoura, T.; Nishizawa, N.K.; Nakanishi, H. The OsHMA2 transporter is involved in root-to-shoot translocation of Zn and Cd in rice. Plant Cell Environ. 2012, 35, 1948–1957. [Google Scholar] [CrossRef]
  48. Chaudhary, K.; Jan, S.; Khan, S. Heavy metal ATPase (HMA2, HMA3, and HMA4) genes in hyperaccumulation mechanism of heavy metals. In Plant Metal Interaction; Elsevier: Amsterdam, The Netherlands, 2016; pp. 545–556. [Google Scholar]
  49. Abdel-Ghany, S.E.; Müller-Moulé, P.; Niyogi, K.K.; Pilon, M.; Shikanai, T. Two P-type ATPases are required for copper delivery in Arabidopsis thaliana chloroplasts. Plant Cell 2005, 17, 1233–1251. [Google Scholar] [CrossRef] [Green Version]
  50. Hoagland, D.R.; Arnon, D.I. The water-culture method for growing plants without soil. Calif. Agric. Exp. Stn. Circ. 1950, 347, 357–359. [Google Scholar]
  51. Hu, B.; Jin, J.; Guo, A.-Y.; Zhang, H.; Luo, J.; Gao, G. GSDS 2.0: An upgraded gene feature visualization server. Bioinformatics 2015, 31, 1296–1297. [Google Scholar] [CrossRef] [Green Version]
  52. Han, X.; Yin, H.; Song, X.; Zhang, Y.; Liu, M.; Sang, J.; Jiang, J.; Li, J.; Zhuo, R. Integration of small RNA s, degradome and transcriptome sequencing in hyperaccumulator Sedum alfredii uncovers a complex regulatory network and provides insights into cadmium phytoremediation. Plant Biotechnol. J. 2016, 14, 1470–1483. [Google Scholar] [CrossRef] [Green Version]
  53. Szczypka, M.S.; Wemmie, J.A.; Moye-Rowley, W.S.; Thiele, D.J. A yeast metal resistance protein similar to human cystic fibrosis transmembrane conductance regulator (CFTR) and multidrug resistance-associated protein. J. Biol. Chem. 1994, 269, 22853–22857. [Google Scholar] [CrossRef]
Figure 1. Chromosomal locations of SpHMA genes in S. plumbizincicola. Chromosome numbers are shown at the left of the bar with green font. SpHMA genes are labeled at the right of the chromosomes with red font. Scale bar on the left indicates the chromosome lengths (Mb).
Figure 1. Chromosomal locations of SpHMA genes in S. plumbizincicola. Chromosome numbers are shown at the left of the bar with green font. SpHMA genes are labeled at the right of the chromosomes with red font. Scale bar on the left indicates the chromosome lengths (Mb).
Plants 11 00215 g001
Figure 2. Phylogenetic analysis of HMA genes among A. thaliana, O. sativa, K. laciniata, S. plumbizincicola. MEGA 7.0 was used to construct a maximum likelihood (ML) phylogenetic tree with 1000 bootstrap replicates.
Figure 2. Phylogenetic analysis of HMA genes among A. thaliana, O. sativa, K. laciniata, S. plumbizincicola. MEGA 7.0 was used to construct a maximum likelihood (ML) phylogenetic tree with 1000 bootstrap replicates.
Plants 11 00215 g002
Figure 3. Phylogenetic relationships, motif compositions and gene structure of HMA genes in S. plumbizincicola. (A) Phylogenetic relationships of 8 SpHMAs; (B) different motif compositions of SpHMAs were elucidated by MEME. The conserved motifs are represented by boxes with different colors; (C) gene structure and conserved domains of HMA genes in S. plumbizincicola.
Figure 3. Phylogenetic relationships, motif compositions and gene structure of HMA genes in S. plumbizincicola. (A) Phylogenetic relationships of 8 SpHMAs; (B) different motif compositions of SpHMAs were elucidated by MEME. The conserved motifs are represented by boxes with different colors; (C) gene structure and conserved domains of HMA genes in S. plumbizincicola.
Plants 11 00215 g003
Figure 4. Cis-acting elements in promoters of SpHMA genes. All the predicted promoter region is 2000 bp. The different colors of grid represent the different number of promoters and the specific numbers are marked in it.
Figure 4. Cis-acting elements in promoters of SpHMA genes. All the predicted promoter region is 2000 bp. The different colors of grid represent the different number of promoters and the specific numbers are marked in it.
Plants 11 00215 g004
Figure 5. Co-expression regulatory network of SpHMA genes in S. plumbizincicola. Nodes representing individual genes and edges stand for significant co-expressions between genes. Genes involved in the same biological process are grouped together and filled with different colors: binding process (orange), catalytic activity (green), antioxidant activity (red), transporter activity (purple), transcription factor activity (blue) and response to stimulus (yellow).
Figure 5. Co-expression regulatory network of SpHMA genes in S. plumbizincicola. Nodes representing individual genes and edges stand for significant co-expressions between genes. Genes involved in the same biological process are grouped together and filled with different colors: binding process (orange), catalytic activity (green), antioxidant activity (red), transporter activity (purple), transcription factor activity (blue) and response to stimulus (yellow).
Plants 11 00215 g005
Figure 6. Expression pattern of 8 SpHMA genes in different tissues (R: roots; L: leaves; S: stems; 1, 2, and 3 are three biological replicates). The heat map was drawn using log2 transformed values, red and green represent high and low expression levels, respectively.
Figure 6. Expression pattern of 8 SpHMA genes in different tissues (R: roots; L: leaves; S: stems; 1, 2, and 3 are three biological replicates). The heat map was drawn using log2 transformed values, red and green represent high and low expression levels, respectively.
Plants 11 00215 g006
Figure 7. The qRT-PCR expression analysis of 8 SpHMAs under normal and stress condition. The stress treatment conditions were Fe (A), Mn (B) deficiency and Zn (C), Cd (D) excess, respectively. The expression levels of untreated (0 h) group were set to 1 as the control. Error bars were derived from three replicates of each experiment.
Figure 7. The qRT-PCR expression analysis of 8 SpHMAs under normal and stress condition. The stress treatment conditions were Fe (A), Mn (B) deficiency and Zn (C), Cd (D) excess, respectively. The expression levels of untreated (0 h) group were set to 1 as the control. Error bars were derived from three replicates of each experiment.
Plants 11 00215 g007
Figure 8. Effects of the overexpression of SpHMA7 in yeast. (A) the growth of ∆ycf1 yeast mutants transformed with the empty vector pYES2.0 and SpHMA7; (B) growth curves of SpHMA7 and the control heterologously expressed in the strains of yeast in SG-U liquid medium treated with 30 μM CdCl2.
Figure 8. Effects of the overexpression of SpHMA7 in yeast. (A) the growth of ∆ycf1 yeast mutants transformed with the empty vector pYES2.0 and SpHMA7; (B) growth curves of SpHMA7 and the control heterologously expressed in the strains of yeast in SG-U liquid medium treated with 30 μM CdCl2.
Plants 11 00215 g008
Table 1. Characteristics of 8 SpHMAs identified in S. plumbizincicola.
Table 1. Characteristics of 8 SpHMAs identified in S. plumbizincicola.
S.N.Gene NameGene IDChr. No.Protein Length (AA)MW (KDa)PIPredict LocationMotif
1SpHMA1evm.model.000029F.120Chr1184191.758.67ChloroplastTGESPCDKTGTHPPEDKGDGINDAP
2SpHMA2evm.model.000008F.259Chr1877182.227.17Cell membrane TGECPCDKTGTHPPEDKGDGINDAP
3SpHMA3evm.model.000098F.40Chr0380586.875.7tonoplastTGECPCDKTGTHPPEDKGDGINDAP
4SpHMA4evm.model.000053F.243.6Chr06995107.585.61Cell membraneTGECPCDKTGTHPPLGKGDGINDSP
5SpHMA5evm.model.000076F.84Chr01959103.565.55Cell membrane TGECPCDKTGTHPPDQKGDGINDSP
6SpHMA6evm.model.000022F.259Chr3193698.477.92Cell membrane TGECPCDKTGTHPPDEKGDGINDAA
7SpHMA7evm.model.000000F.676Chr0269474.55 7.03Cell membraneTGECPCDKTGTHPPAGKGDGINDSP
8SpHMA8evm.model.000024F.130Chr2787893.065.84Cell membrane TGECPCDKTGTHPPQQKGDGINDAP
Table 2. Primers used in CDS full-length cloning, yeast heterologous expression vector recombining and qRT-PCR.
Table 2. Primers used in CDS full-length cloning, yeast heterologous expression vector recombining and qRT-PCR.
Primer NamePrimer Sequence (5′-3′)Primer Length (bp)
SpHMA7-FATGCAGCTTCCAGTCATATTCA22
SpHMA7-RTTACTCTACAGTTATTTCAAGAATG25
SpHMA7.pyes2-FtcactatagggaatattaATGCAGCTTCCAGTCATATTCA40
SpHMA7.pyes2-RgatgcggccctctagTTACTCTACAGTTATTTCAAGAATG40
SpUBC9-FTGGCGTCGAAAAGGATTCTGA21
SpUBC9-FCCTTCGGTGGCTTGAATGGATA22
qRT.SpHMA1-FTGCTGCTGCTTGTCCTTACT20
qRT.SpHMA1-RAGACGCAAAGGCAGCCATAG22
qRT.SpHMA2-FGTGGCTGTAATCCCTGCTGT20
qRT.SpHMA2-RGATGTGGCCGCCTTTGAAAG21
qRT.SpHMA3-FTAAAATGGGTGGCTGTGGCT21
qRT.SpHMA3-RAACTGCCATGATTGCCAGGA21
qRT.SpHMA4-FTTATGGTGTCACCGCTGCAA20
qRT.SpHMA4-RTCAAACCCTGCATCCTCCAC20
qRT.SpHMA5-FGTTCGGATCGCTAACGTTGC20
qRT.SpHMA5-RTCAGCTCAGCTTCGAAACCA20
qRT.SpHMA6-FCAGAGGTGTTGCTGCTGGTA20
qRT.SpHMA6-RGCTGAAGACACTTGCGGTTG20
qRT.SpHMA7-FGTTGATCGAGCTTTCACCCG20
qRT.SpHMA7-RTGTCACCGGGTTGGATCAAT20
qRT.SpHMA8-FCGAAGAGACGTGTTTCGGGA20
qRT.SpHMA8-RCACAGCACAATGCCACCAAA20
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Huang, Q.; Qiu, W.; Yu, M.; Li, S.; Lu, Z.; Zhu, Y.; Kan, X.; Zhuo, R. Genome-Wide Characterization of Sedum plumbizincicola HMA Gene Family Provides Functional Implications in Cadmium Response. Plants 2022, 11, 215. https://doi.org/10.3390/plants11020215

AMA Style

Huang Q, Qiu W, Yu M, Li S, Lu Z, Zhu Y, Kan X, Zhuo R. Genome-Wide Characterization of Sedum plumbizincicola HMA Gene Family Provides Functional Implications in Cadmium Response. Plants. 2022; 11(2):215. https://doi.org/10.3390/plants11020215

Chicago/Turabian Style

Huang, Qingyu, Wenmin Qiu, Miao Yu, Shaocui Li, Zhuchou Lu, Yue Zhu, Xianzhao Kan, and Renying Zhuo. 2022. "Genome-Wide Characterization of Sedum plumbizincicola HMA Gene Family Provides Functional Implications in Cadmium Response" Plants 11, no. 2: 215. https://doi.org/10.3390/plants11020215

APA Style

Huang, Q., Qiu, W., Yu, M., Li, S., Lu, Z., Zhu, Y., Kan, X., & Zhuo, R. (2022). Genome-Wide Characterization of Sedum plumbizincicola HMA Gene Family Provides Functional Implications in Cadmium Response. Plants, 11(2), 215. https://doi.org/10.3390/plants11020215

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop