Chitosan Nanoparticles Inactivate Alfalfa Mosaic Virus Replication and Boost Innate Immunity in Nicotiana glutinosa Plants
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of Chitosan/Dextran Nanoparticles
2.2. Characterization of Chitosan/Dextran Nanoparticles
2.3. Viral Isolation and Molecular Characterization
2.4. Greenhouse Antiviral Activity Assays and Experimental Design
2.5. Estimation of Total Phenolic Content
2.6. Determination of Total of Soluble Carbohydrates
2.7. Transcriptional Levels of Defense-Related Genes
2.8. Statistical Analyses
3. Results and Discussion
3.1. Structural, Compositional Characterization, and Particle Size of the Synthesized CDNPs
3.2. Infrared Spectrophotometry
3.3. Viral Isolation and Molecular Characterization
3.4. Antiviral Activity of Chitosan/Dextran Nanoparticles (CDNPs)
3.4.1. Effect of CDNPs on Disease Severity and AMV Systemic Accumulation Level
3.4.2. Determination of Total Soluble Carbohydrates and Total Phenolic Contents
3.4.3. Transcriptional Levels of the Defense-Related Genes
Peroxidase (POD)
Pathogenesis-Related Protein 1 (PR-1)
Phenylalanine Ammonia-Lyase (PAL)
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Abdelkhalek, A.; Hafez, E. Plant Viral Diseases in Egypt and Their Control. In Cottage Industry of Biocontrol Agents and Their Applications; Springer: Berlin/Heidelberg, Germany, 2020; pp. 403–421. [Google Scholar]
- El-Helaly, H.S.; Ahmed, A.A.; Awad, M.A.; Soliman, A.M. Biological and molecular characterization of potato infecting alfalfa mosaic virus in Egypt. Int. J. Virol. 2012, 8, 106–113. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Al-Askar, A.A.; Behiry, S.I. Bacillus licheniformis strain POT1 mediated polyphenol biosynthetic pathways genes activation and systemic resistance in potato plants against Alfalfa mosaic virus. Sci. Rep. 2020, 10, 16120. [Google Scholar] [CrossRef]
- Mangeli, F.; Massumi, H.; Alipour, F.; Maddahian, M.; Heydarnejad, J.; Hosseinipour, A.; Amid-Motlagh, M.H.; Azizizadeh, M.; Varsani, A. Molecular and partial biological characterization of the coat protein sequences of Iranian alfalfa mosaic virus isolates. J. Plant Pathol. 2019, 101, 735–742. [Google Scholar] [CrossRef]
- Trucco, V.; Castellanos Collazo, O.; Vaghi Medina, C.G.; Cabrera Mederos, D.; Lenardon, S.; Giolitti, F. Alfalfa mosaic virus (AMV): Genetic diversity and a new natural host. J. Plant Pathol. 2021, 1–8. [Google Scholar] [CrossRef]
- Hosseini, S.A.; Ghaemi, M.; Khayyat, M. Responses of pepper to Alfalfa mosaic virus and manganese nutrition under greenhouse conditions: Preliminary results. J. Hortic. Postharvest Res. 2021, 4, 67–80. [Google Scholar]
- Nie, X.; Dickison, V.; Singh, M.; De Koeyer, D.; Xu, H.; Bai, Y.; Hawkins, G. Potato tuber necrosis induced by alfalfa mosaic virus depends on potato cultivar rather than on virus strain. Plant Dis. 2020, 104, 340–347. [Google Scholar] [CrossRef] [PubMed]
- Ormeño, J.; Sepúlveda, P.; Rojas, R.; Araya, J.E. Datura Genus Weeds as an Epidemiological Factor of Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), and Potato virus Y (PVY) on Solanaceus Crops. Agric. Técnica 2006, 66, 333. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Salem, M.Z.M.; Ali, H.M.; Kordy, A.M.; Salem, A.Z.M.; Behiry, S.I. Antiviral, antifungal, and insecticidal activities of Eucalyptus bark extract: HPLC analysis of polyphenolic compounds. Microb. Pathog. 2020, 147, 104383. [Google Scholar] [CrossRef] [PubMed]
- Abdelkhalek, A.; Salem, M.Z.M.; Hafez, E.; Behiry, S.I.; Qari, S.H. The Phytochemical, Antifungal, and First Report of the Antiviral Properties of Egyptian Haplophyllum tuberculatum Extract. Biology 2020, 9, 248. [Google Scholar] [CrossRef]
- Sánchez-Estrada, A.; Tiznado-Hernández, M.E.; Ojeda-Contreras, A.J.; Valenzuela-Quintanar, A.I.; Troncoso-Rojas, R. Induction of Enzymes and Phenolic Compounds Related to the Natural Defence Response of Netted Melon Fruit by a Bio-elicitor. J. Phytopathol. 2009, 157, 24–32. [Google Scholar] [CrossRef]
- McCann, H.C.; Nahal, H.; Thakur, S.; Guttman, D.S. Identification of innate immunity elicitors using molecular signatures of natural selection. Proc. Natl. Acad. Sci. USA 2012, 109, 4215–4220. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Behiry, S.I.; Ashmawy, N.A.; Abdelkhalek, A.A.; Younes, H.A.; Khaled, A.E.; Hafez, E.E. Compatible- and incompatible-type interactions related to defense genes in potato elucidation by Pectobacterium carotovorum. J. Plant Dis. Prot. 2018, 125, 197–204. [Google Scholar] [CrossRef]
- Hadwiger, L.A. Multiple effects of chitosan on plant systems: Solid science or hype. Plant Sci. 2013, 208, 42–49. [Google Scholar] [CrossRef] [PubMed]
- Hassan, O.; Chang, T. Chitosan for eco-friendly control of plant disease. Asian J. Plant Pathol. 2017, 11, 53–70. [Google Scholar] [CrossRef]
- Chirkov, S.N. The antiviral activity of chitosan. Appl. Biochem. Microbiol. 2002, 38, 1–8. [Google Scholar] [CrossRef]
- Davydova, V.N.; Nagorskaya, V.P.; Gorbach, V.I.; Kalitnik, A.A.; Reunov, A.V.; Solov’Eva, T.F.; Ermak, I.M. Chitosan antiviral activity: Dependence on structure and depolymerization method. Appl. Biochem. Microbiol. 2011, 47, 103–108. [Google Scholar] [CrossRef]
- He, X.; Xing, R.; Liu, S.; Qin, Y.; Li, K.; Yu, H.; Li, P. The improved antiviral activities of amino-modified chitosan derivatives on Newcastle virus. Drug Chem. Toxicol. 2021, 44, 335–340. [Google Scholar] [CrossRef] [PubMed]
- Chandra, S.; Chakraborty, N.; Dasgupta, A.; Sarkar, J.; Panda, K.; Acharya, K. Chitosan nanoparticles: A positive modulator of innate immune responses in plants. Sci. Rep. 2015, 5, 15195. [Google Scholar] [CrossRef] [Green Version]
- Chun, S.-C.; Chandrasekaran, M. Chitosan and chitosan nanoparticles induced expression of pathogenesis-related proteins genes enhances biotic stress tolerance in tomato. Int. J. Biol. Macromol. 2019, 125, 948–954. [Google Scholar] [CrossRef]
- Saharan, V.; Kumaraswamy, R.V.; Choudhary, R.C.; Kumari, S.; Pal, A.; Raliya, R.; Biswas, P. Cu-chitosan nanoparticle mediated sustainable approach to enhance seedling growth in maize by mobilizing reserved food. J. Agric. Food Chem. 2016, 64, 6148–6155. [Google Scholar] [CrossRef]
- Kashyap, P.L.; Xiang, X.; Heiden, P. Chitosan nanoparticle based delivery systems for sustainable agriculture. Int. J. Biol. Macromol. 2015, 77, 36–51. [Google Scholar] [CrossRef] [PubMed]
- Sathiyabama, M.; Manikandan, A. Foliar application of chitosan nanoparticle improves yield, mineral content and boost innate immunity in finger millet plants. Carbohydr. Polym. 2021, 258, 117691. [Google Scholar] [CrossRef]
- Kheiri, A.; Jorf, S.A.M.; Malihipour, A.; Saremi, H.; Nikkhah, M. Application of chitosan and chitosan nanoparticles for the control of Fusarium head blight of wheat (Fusarium graminearum) in vitro and greenhouse. Int. J. Biol. Macromol. 2016, 93, 1261–1272. [Google Scholar] [CrossRef]
- Heflish, A.A.; Hanfy, A.E.; Ansari, M.J.; Dessoky, E.S.; Attia, A.O.; Elshaer, M.M.; Gaber, M.K.; Kordy, A.; Doma, A.S.; Abdelkhalek, A. Green biosynthesized silver nanoparticles using Acalypha wilkesiana extract control root-knot nematode. J. King Saud Univ. 2021, 33, 101516. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Al-Askar, A.A. Green Synthesized ZnO Nanoparticles Mediated by Mentha Spicata Extract Induce Plant Systemic Resistance against Tobacco mosaic Virus. Appl. Sci. 2020, 10, 5054. [Google Scholar] [CrossRef]
- Fan, W.; Yan, W.; Xu, Z.; Ni, H. Formation mechanism of monodisperse, low molecular weight chitosan nanoparticles by ionic gelation technique. Colloids Surf. B Biointerfaces 2012, 90, 21–27. [Google Scholar] [CrossRef] [PubMed]
- Abu-Saied, M.A.; Soliman, E.A.; Abualnaj, K.M.; El Desouky, E. Highly Conductive Polyelectrolyte Membranes Poly (vinyl alcohol)/Poly (2-acrylamido-2-methyl propane sulfonic acid)(PVA/PAMPS) for Fuel Cell Application. Polymers 2021, 13, 2638. [Google Scholar] [CrossRef] [PubMed]
- Abu-Saied, M.A.; El-Desouky, E.A.; Soliman, E.A.; Abd El-Naim, G. Novel sulphonated poly (vinyl chloride)/poly (2-acrylamido-2-methylpropane sulphonic acid) blends-based polyelectrolyte membranes for direct methanol fuel cells. Polym. Test. 2020, 89, 106604. [Google Scholar] [CrossRef]
- Clark, M.F.; Adams, A.N. Characteristics of the microplate method of enzyme linked immunosorbent assay for the detection of plant viruses. J. Gen. Virol. 1977, 34, 475–483. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Al-Askar, A.A.; Hafez, E. Differential induction and suppression of the potato innate immune system in response to Alfalfa mosaic virus infection. Physiol. Mol. Plant Pathol. 2020, 110, 101485. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Qari, S.H.S.H.; Hafez, E. Iris yellow spot virus–induced chloroplast malformation results in male sterility. J. Biosci. 2019, 44, 142. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Sanan-Mishra, N. A comparative analysis of the suppressor activity of Tobacco mosaic virus proteins in the tomato plant. Jordan J. Biol. Sci. 2018, 11, 469–473. [Google Scholar]
- Abdelkhalek, A. Expression of tomato pathogenesis related genes in response to Tobacco mosaic virus. JAPS J. Anim. Plant Sci. 2019, 29, 1596–1602. [Google Scholar]
- Jindal, K.K.; Singh, R.N. Phenolic content in male and female Carica papaya: A possible physiological marker for sex identification of vegetative seedlings. Physiol. Plant. 1975, 33, 104–107. [Google Scholar] [CrossRef]
- Dubois, M.; Gilles, K.A.; Hamilton, J.K.; Rebers, P.T.; Smith, F. Colorimetric method for determination of sugars and related substances. Anal. Chem. 1956, 28, 350–356. [Google Scholar] [CrossRef]
- Chomczynski, P.; Sacchi, N. The single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction: Twenty-something years on. Nat. Protoc. 2006, 1, 581–585. [Google Scholar] [CrossRef] [PubMed]
- Abdelkhalek, A.; Sanan-Mishra, N. Differential expression profiles of tomato miRNAs induced by Tobacco mosaic virus. J. Agric. Sci. Technol. 2019, 21, 475–485. [Google Scholar]
- Abdelkhalek, A.; Ismail, I.A.I.A.; Dessoky, E.S.E.S.; El-Hallous, E.I.E.I.; Hafez, E. A tomato kinesin-like protein is associated with Tobacco mosaic virus infection. Biotechnol. Biotechnol. Equip. 2019, 33, 1424–1433. [Google Scholar] [CrossRef] [Green Version]
- Hafez, E.E.; Abdelkhalek, A.A.; Abd El-Wahab, A.S.E.-D.; Galal, F.H. Altered gene expression: Induction/suppression in leek elicited by Iris Yellow Spot Virus infection (IYSV) Egyptian isolate. Biotechnol. Biotechnol. Equip. 2013, 27, 4061–4068. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Kätzel, U.; Vorbau, M.; Stintz, M.; Gottschalk-Gaudig, T.; Barthel, H. Dynamic light scattering for the characterization of polydisperse fractal systems: II. Relation between structure and DLS results. Part. Part. Syst. Charact. 2008, 25, 19–30. [Google Scholar] [CrossRef]
- Mohy Eldin, M.S.; Tamer, T.M.; Abu Saied, M.A.; Soliman, E.A.; Madi, N.K.; Ragab, I.; Fadel, I. Click grafting of chitosan onto PVC surfaces for biomedical applications. Adv. Polym. Technol. 2018, 37, 38–49. [Google Scholar] [CrossRef]
- Abu-Saied, M.A.; Soliman, E.A.; Al Desouki, E.A. Development of Proton Exchange Membranes Based on Chitosan Blended with Poly (2-Acrylamido-2-Methylpropane Sulfonic Acid) for Fuel Cells applications. Mater. Today Commun. 2020, 25, 101536. [Google Scholar] [CrossRef]
- Chavan, C.; Bala, P.; Pal, K.; Kale, S.N. Cross-linked chitosan-dextran sulphate vehicle system for controlled release of ciprofloxaxin drug: An ophthalmic application. OpenNano 2017, 2, 28–36. [Google Scholar] [CrossRef]
- Sarmento, B.; Martins, S.; Ribeiro, A.; Veiga, F.; Neufeld, R.; Ferreira, D. Development and comparison of different nanoparticulate polyelectrolyte complexes as insulin carriers. Int. J. Pept. Res. Ther. 2006, 12, 131–138. [Google Scholar] [CrossRef] [Green Version]
- El-Abhar, M.; El-Abhar, M.A.; Elkady, M.A.; Ghanem, K.M.; Bosila, H.A. Identification, characterization and ultrastructure aspects of Alfalfa mosaic virus infecting potato (Solanum tuberosum L.) in Egypt. J. Virol. Sci. 2018, 3, 68–77. [Google Scholar]
- Zitikaitė, I.; Samuitienė, M. Identification and some properties of Alfalfa mosaic alfamovirus isolated from naturally infected tomato crop. Biologija 2008, 2, 83–88. [Google Scholar] [CrossRef]
- Aleem, E.E.A.; Taha, R.M.; Fattouh, F.A. Biodiversity and full genome sequence of potato viruses Alfalfa mosaic virus and potato leaf roll virus in Egypt. Zeitschrift für Naturforsch. C 2018, 73, 423–438. [Google Scholar] [CrossRef]
- Parrella, G.; Lanave, C.; Marchoux, G.; Sialer, M.M.F.; Di Franco, A.; Gallitelli, D. Evidence for two distinct subgroups of Alfalfa mosaic virus (AMV) from France and Italy and their relationships with other AMV strains. Arch. Virol. 2000, 145, 2659–2667. [Google Scholar] [CrossRef]
- Rendina, N.; Nuzzaci, M.; Scopa, A.; Cuypers, A.; Sofo, A. Chitosan-elicited defense responses in Cucumber mosaic virus (CMV)-infected tomato plants. J. Plant Physiol. 2019, 234, 9–17. [Google Scholar] [CrossRef]
- Van, S.N.; Minh, H.D.; Anh, D.N. Study on chitosan nanoparticles on biophysical characteristics and growth of Robusta coffee in green house. Biocatal. Agric. Biotechnol. 2013, 2, 289–294. [Google Scholar]
- Hong, J.; Wang, C.; Wagner, D.C.; Gardea-Torresdey, J.L.; He, F.; Rico, C.M. Foliar application of nanoparticles: Mechanisms of absorption, transfer, and multiple impacts. Environ. Sci. Nano 2021, 8, 1196–1210. [Google Scholar] [CrossRef]
- Yang, X.X.; Li, C.M.; Huang, C.Z. Curcumin modified silver nanoparticles for highly efficient inhibition of respiratory syncytial virus infection. Nanoscale 2016, 8, 3040–3048. [Google Scholar] [CrossRef] [PubMed]
- Cai, L.; Cai, L.; Jia, H.; Liu, C.; Wang, D.; Sun, X. Foliar exposure of Fe3O4 nanoparticles on Nicotiana benthamiana: Evidence for nanoparticles uptake, plant growth promoter and defense response elicitor against plant virus. J. Hazard. Mater. 2020, 393, 122415. [Google Scholar] [CrossRef]
- Xing, K.; Zhu, X.; Peng, X.; Qin, S. Chitosan antimicrobial and eliciting properties for pest control in agriculture: A review. Agron. Sustain. Dev. 2015, 35, 569–588. [Google Scholar] [CrossRef] [Green Version]
- Noha, K.; Bondok, A.M.; El-Dougdoug, K.A. Evaluation of silver nanoparticles as antiviral agent against ToMV and PVY in tomato plants. Sciences 2018, 8, 100–111. [Google Scholar]
- Nagorskaya, V.; Reunov, A.; Lapshina, L.; Davydova, V.; Yermak, I. Effect of chitosan on tobacco mosaic virus (TMV) accumulation, hydrolase activity, and morphological abnormalities of the viral particles in leaves of N. tabacum L. cv. Samsun. Virol. Sin. 2014, 29, 250–256. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Cai, J.; Du, Y.; Lin, J.; Wang, C.; Xiong, K. Preparation and anti-TMV activity of guanidinylated chitosan hydrochloride. J. Appl. Polym. Sci. 2009, 112, 3522–3528. [Google Scholar] [CrossRef]
- Chirkov, S.N.; Il’ina, A.V.; Surgucheva, N.A.; Letunova, E.V.; Varitsev, Y.A.; Tatarinova, N.Y.; Varlamov, V.P. Effect of chitosan on systemic viral infection and some defense responses in potato plants. Russ. J. Plant Physiol. 2001, 48, 774–779. [Google Scholar] [CrossRef]
- Sinniah, U.R.; Ellis, R.H.; John, P. Irrigation and seed quality development in rapid-cycling brassica: Soluble carbohydrates and heat-stable proteins. Ann. Bot. 1998, 82, 647–655. [Google Scholar] [CrossRef] [Green Version]
- Ahmed, S.; Nawata, E.; Sakuratani, T. Changes of endogenous ABA and ACC, and their correlations to photosynthesis and water relations in mungbean (Vigna radiata (L.) Wilczak cv. KPS1) during waterlogging. Environ. Exp. Bot. 2006, 57, 278–284. [Google Scholar] [CrossRef]
- Nazar, R.; Iqbal, N.; Masood, A.; Khan, M.I.R.; Syeed, S.; Khan, N.A. Cadmium toxicity in plants and role of mineral nutrients in its alleviation. Am. J. Plant Sci. 2012, 10, 1476–1489. [Google Scholar] [CrossRef] [Green Version]
- Hoekstra, F.A.; Golovina, E.A.; Buitink, J. Mechanisms of plant desiccation tolerance. Trends Plant Sci. 2001, 6, 431–438. [Google Scholar] [CrossRef]
- Gaddam, S.A.; Kotakadi, V.S.; Reddy, M.N.; Saigopal, D.V.R. Antigenic relationships of Citrus yellow mosaic virus by immunological methods. Asian J. Plant Sci. Res. 2012, 2, 566–569. [Google Scholar]
- Arias, M.C.; Lenardon, S.; Taleisnik, E. Carbon metabolism alterations in sunflower plants infected with the Sunflower chlorotic mottle virus. J. Phytopathol. 2003, 151, 267–273. [Google Scholar] [CrossRef]
- Goodman, P.J.; Watson, M.A.; Hill, A.R.C. Sugar and fructosan accumulation in virus-infected plants: Rapid testing by circular-paper chromatography. Ann. Appl. Biol. 1965, 56, 65–72. [Google Scholar] [CrossRef]
- Khalid, M.; Siddiqui, H.H.; Freed, S. In-vitro assessment of antioxidant activity of Dalbergia latifolia barks extract against free radicals. Am. J. Sci. Res. 2011, 6, 172–177. [Google Scholar]
- Behiry, S.I.; Okla, M.K.; Alamri, S.A.; El-Hefny, M.; Salem, M.Z.M.; Alaraidh, I.A.; Ali, H.M.; Al-Ghtani, S.M.; Monroy, J.C.; Salem, A.Z.M. Antifungal and antibacterial activities of Musa paradisiaca L. peel extract: HPLC analysis of phenolic and flavonoid contents. Processes 2019, 7, 215. [Google Scholar] [CrossRef] [Green Version]
- Al-Huqail, A.A.; Behiry, S.I.; Salem, M.Z.M.; Ali, H.M.; Siddiqui, M.H.; Salem, A.Z.M. Antifungal, antibacterial, and antioxidant activities of Acacia saligna (Labill.) HL Wendl. flower extract: HPLC analysis of phenolic and flavonoid compounds. Molecules 2019, 24, 700. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ashmawy, N.A.; Behiry, S.I.; Al-Huqail, A.A.; Ali, H.M.; Salem, M.Z.M. Bioactivity of Selected Phenolic Acids and Hexane Extracts from Bougainvilla spectabilis and Citharexylum spinosum on the Growth of Pectobacterium carotovorum and Dickeya solani Bacteria: An Opportunity to Save the Environment. Processes 2020, 8, 482. [Google Scholar] [CrossRef]
- Aly, A.A.; Mansour, M.T.M.; Mohamed, H.I. Association of increase in some biochemical components with flax resistance to powdery mildew. Gesunde Pflanz. 2017, 69, 47–52. [Google Scholar] [CrossRef]
- Radwan, D.E.M.; Fayez, K.A.; Mahmoud, S.Y.; Lu, G. Modifications of antioxidant activity and protein composition of bean leaf due to Bean yellow mosaic virus infection and salicylic acid treatments. Acta Physiol. Plant. 2010, 32, 891–904. [Google Scholar] [CrossRef]
- Mejía-Teniente, L.; Durán-Flores, F.D.D.; Chapa-Oliver, A.M.; Torres-Pacheco, I.; Cruz-Hernández, A.; González-Chavira, M.M.; Ocampo-Velázquez, R.V.; Guevara-González, R.G. Oxidative and molecular responses in Capsicum annuum L. after hydrogen peroxide, salicylic acid and chitosan foliar applications. Int. J. Mol. Sci. 2013, 14, 10178–10196. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Isamah, G.K.; Asagba, S.O.; Thomas, A.E. Lipid peroxidation, o-diphenolase, superoxide dismutase and catalase profile along the three physiological regions of Dioscorea rotundata Poir cv Omi. Food Chem. 2000, 69, 1–4. [Google Scholar] [CrossRef]
- Han, Y.; Luo, Y.; Qin, S.; Xi, L.; Wan, B.; Du, L. Induction of systemic resistance against tobacco mosaic virus by Ningnanmycin in tobacco. Pestic. Biochem. Physiol. 2014, 111, 14–18. [Google Scholar] [CrossRef] [PubMed]
- Venkatesan, S.; Radjacommare, R.; Nakkeeran, S.; Chandrasekaran, A. Effect of biocontrol agent, plant extracts and safe chemicals in suppression of mungbean yellow mosaic virus (MYMV) in black gram (Vigna mungo). Arch. Phytopathol. Plant Prot. 2010, 43, 59–72. [Google Scholar] [CrossRef]
- Gonçalves, L.S.A.; Rodrigues, R.; Diz, M.S.S.; Robaina, R.R.; Júnior, A.; Carvalho, A.; Gomes, V. Peroxidase is involved in Pepper yellow mosaic virus resistance in Capsicum baccatum var. pendulum. Genet. Mol. Res. 2013, 12, 1411–1420. [Google Scholar] [CrossRef] [PubMed]
- Batra, G.K.; Kuhn, C.W. Polyphenoloxidase and peroxidase activities associated with acquired resistance and its inhibition by 2-thiouracil in virus-infected soybean. Physiol. Plant Pathol. 1975, 5, 239–248. [Google Scholar] [CrossRef]
- Buonaurio, R.; Montalbini, P. Tobacco mosaic virus induced systemic changes in the peroxidase activity and isoperoxidase pattern in tobacco leaves and the relation to acquired resistance to powdery mildew infection. Phytopathol. Mediterr. 1995, 34, 184–191. [Google Scholar]
- Sathiyabama, M.; Manikandan, A. Chitosan nanoparticle induced defense responses in fingermillet plants against blast disease caused by Pyricularia grisea (Cke.) Sacc. Carbohydr. Polym. 2016, 154, 241–246. [Google Scholar] [CrossRef]
- Liu, R.; Wang, Z.-Y.; Li, T.-T.; Wang, F.; An, J. The role of chitosan in polyphenols accumulation and induction of defense enzymes in Pinus koraiensis seedlings. Chin. J. Plant Ecol. 2014, 38, 749. [Google Scholar]
- Siddaiah, C.N.; Prasanth, K.V.H.; Satyanarayana, N.R.; Mudili, V.; Gupta, V.K.; Kalagatur, N.K.; Satyavati, T.; Dai, X.-F.; Chen, J.-Y.; Mocan, A. Chitosan nanoparticles having higher degree of acetylation induce resistance against pearl millet downy mildew through nitric oxide generation. Sci. Rep. 2018, 8, 2485. [Google Scholar] [CrossRef] [Green Version]
- Yang, F.; Hu, J.; Li, J.; Wu, X.; Qian, Y. Chitosan enhances leaf membrane stability and antioxidant enzyme activities in apple seedlings under drought stress. Plant Growth Regul. 2009, 58, 131–136. [Google Scholar] [CrossRef]
- Choudhary, R.C.; Kumaraswamy, R.V.; Kumari, S.; Sharma, S.S.; Pal, A.; Raliya, R.; Biswas, P.; Saharan, V. Cu-chitosan nanoparticle boost defense responses and plant growth in maize (Zea mays L.). Sci. Rep. 2017, 7, 9754. [Google Scholar] [CrossRef] [PubMed]
- Vlot, A.C.; Dempsey, D.A.; Klessig, D.F. Salicylic acid, a multifaceted hormone to combat disease. Annu. Rev. Phytopathol. 2009, 47, 177–206. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- D’Maris Amick Dempsey, A.C.; Vlot, M.C.W.; Daniel, F.K.; Dempsey, D.A.; Vlot, A.C.; Wildermuth, M.C.; Klessig, D.F.; D’Maris Amick Dempsey, A.C.; Vlot, M.C.W.; Daniel, F.K.; et al. Salicylic acid biosynthesis and metabolism. Arab. Book/Am. Soc. Plant Biol. 2011, 9, e0156. [Google Scholar] [CrossRef] [Green Version]
- Lincoln, J.E.; Sanchez, J.P.; Zumstein, K.; Gilchrist, D.G. Plant and animal PR1 family members inhibit programmed cell death and suppress bacterial pathogens in plant tissues. Mol. Plant Pathol. 2018, 19, 2111–2123. [Google Scholar] [CrossRef] [Green Version]
- Heflish, A.A.; Abdelkhalek, A.; Al-Askar, A.A.; Behiry, S.I. Protective and Curative Effects of Trichoderma asperelloides Ta41 on Tomato Root Rot Caused by Rhizoctonia solani Rs33. Agronomy 2021, 11, 1162. [Google Scholar] [CrossRef]
- Ali, S.; Ganai, B.A.; Kamili, A.N.; Bhat, A.A.; Mir, Z.A.; Bhat, J.A.; Tyagi, A.; Islam, S.T.; Mushtaq, M.; Yadav, P. Pathogenesis-related proteins and peptides as promising tools for engineering plants with multiple stress tolerance. Microbiol. Res. 2018, 212, 29–37. [Google Scholar] [CrossRef]
- Cutt, J.R.; Harpster, M.H.; Dixon, D.C.; Carr, J.P.; Dunsmuir, P.; Klessig, D.F. Disease response to tobacco mosaic virus in transgenic tobacco plants that constitutively express the pathogenesis-related PR1b gene. Virology 1989, 173, 89–97. [Google Scholar] [CrossRef]
- Su, H.; Song, S.; Yan, X.; Fang, L.; Zeng, B.; Zhu, Y. Endogenous salicylic acid shows different correlation with baicalin and baicalein in the medicinal plant Scutellaria baicalensis Georgi subjected to stress and exogenous salicylic acid. PLoS ONE 2018, 13, e0192114. [Google Scholar]
- Abdelkhalek, A.; Dessoky, E.S.; Hafez, E. Polyphenolic genes expression pattern and their role in viral resistance in tomato plant infected with Tobacco mosaic virus. Biosci. Res. 2018, 15, 3349–3356. [Google Scholar]
- Hao, Q.; Wang, W.; Han, X.; Wu, J.; Lyu, B.; Chen, F.; Caplan, A.; Li, C.; Wu, J.; Wang, W. Isochorismate-based salicylic acid biosynthesis confers basal resistance to Fusarium graminearum in barley. Mol. Plant Pathol. 2018, 19, 1995–2010. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, Z.; Zheng, Z.; Huang, J.; Lai, Z.; Fan, B. Biosynthesis of salicylic acid in plants. Plant Signal. Behav. 2009, 4, 493–496. [Google Scholar] [CrossRef]
- Nehela, Y.; Hijaz, F.; Elzaawely, A.A.; El-Zahaby, H.M.; Killiny, N. Citrus phytohormonal response to Candidatus Liberibacter asiaticus and its vector Diaphorina citri. Physiol. Mol. Plant Pathol. 2018, 102, 24–35. [Google Scholar] [CrossRef]
- Iriti, M.; Faoro, F. Chitosan as a MAMP, searching for a PRR. Plant Signal. Behav. 2009, 4, 66–68. [Google Scholar] [CrossRef] [Green Version]
- Xu, X.L.; Olson, J.M.; Zhao, L.P. A regression-based method to identify differentially expressed genes in microarray time course studies and its application in an inducible Huntington’s disease transgenic model. Hum. Mol. Genet. 2002, 11, 1977–1985. [Google Scholar] [CrossRef] [Green Version]
- Liu, S.; Lu, M.; Li, H.; Zuo, Y. Prediction of gene expression patterns with generalized linear regression model. Front. Genet. 2019, 10, 120. [Google Scholar] [CrossRef] [PubMed]
- Mallik, S.; Seth, S.; Bhadra, T.; Zhao, Z. A linear regression and deep learning approach for detecting reliable genetic alterations in cancer using dna methylation and gene expression data. Genes 2020, 11, 931. [Google Scholar] [CrossRef] [PubMed]
- Duren, Z.; Chen, X.; Jiang, R.; Wang, Y.; Wong, W.H. Modeling gene regulation from paired expression and chromatin accessibility data. Proc. Natl. Acad. Sci. USA 2017, 114, E4914–E4923. [Google Scholar] [CrossRef] [Green Version]
- Liu, H.; Tarima, S.; Borders, A.S.; Getchell, T.V.; Getchell, M.L.; Stromberg, A.J. Quadratic regression analysis for gene discovery and pattern recognition for non-cyclic short time-course microarray experiments. BMC Bioinform. 2005, 6, 106. [Google Scholar] [CrossRef] [Green Version]
Primer Name | Abbreviation | Direction | Sequence (5′…………………3′) |
---|---|---|---|
Alfalfa mosaic virus-coat protein | AMV-CP | Forward | CCATCATGAGTTCTTCACAAAAG |
Reverse | TCGTCACGTCATCAGTGAGAC | ||
Peroxidase | POD | Forward | TGGAGGTCCAACATGGCAAGTTCT |
Reverse | TGCCACATCTTGCCCTTCCAAATG | ||
Pathogenesis related protein-1 | PR-1 | Forward | GTTCCTCCTTGCCACCTTC |
Reverse | TATGCACCCCCAGCATAGTT | ||
Phenylalanine ammonia-lyase | PAL | Forward | GTTATGCTCTTAGAACGTCGCCC |
Reverse | CCGTGTAATGCCTTGTTTCTTGA | ||
Beta-actin | β-actin | Forward | TGGCATACAAAGACAGGACAGCCT |
Reverse | ACTCAATCCCAAGGCCAACAGAGA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abdelkhalek, A.; Qari, S.H.; Abu-Saied, M.A.A.-R.; Khalil, A.M.; Younes, H.A.; Nehela, Y.; Behiry, S.I. Chitosan Nanoparticles Inactivate Alfalfa Mosaic Virus Replication and Boost Innate Immunity in Nicotiana glutinosa Plants. Plants 2021, 10, 2701. https://doi.org/10.3390/plants10122701
Abdelkhalek A, Qari SH, Abu-Saied MAA-R, Khalil AM, Younes HA, Nehela Y, Behiry SI. Chitosan Nanoparticles Inactivate Alfalfa Mosaic Virus Replication and Boost Innate Immunity in Nicotiana glutinosa Plants. Plants. 2021; 10(12):2701. https://doi.org/10.3390/plants10122701
Chicago/Turabian StyleAbdelkhalek, Ahmed, Sameer H. Qari, Mohamed Abd Al-Raheem Abu-Saied, Abdallah Mohamed Khalil, Hosny A. Younes, Yasser Nehela, and Said I. Behiry. 2021. "Chitosan Nanoparticles Inactivate Alfalfa Mosaic Virus Replication and Boost Innate Immunity in Nicotiana glutinosa Plants" Plants 10, no. 12: 2701. https://doi.org/10.3390/plants10122701
APA StyleAbdelkhalek, A., Qari, S. H., Abu-Saied, M. A. A.-R., Khalil, A. M., Younes, H. A., Nehela, Y., & Behiry, S. I. (2021). Chitosan Nanoparticles Inactivate Alfalfa Mosaic Virus Replication and Boost Innate Immunity in Nicotiana glutinosa Plants. Plants, 10(12), 2701. https://doi.org/10.3390/plants10122701