Hd1 Allele Types and Their Associations with Major Agronomic Traits in Korean Rice Cultivars
Abstract
:1. Introduction
2. Results
2.1. Major Agronomic Traits of Korean Rice Cultivars under Different Environments
2.2. Hd1 Allele Types of 293 Korean Rice Cultivars
2.3. Association of Hd1 Allele Types with Major Agronomic Traits
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Phenotyping
4.2. Hd1 Genotyping
4.3. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Cho, L.-H.; Yoon, J.; An, G. The control of flowering time by environmental factors. Plant J. 2017, 90, 708–719. [Google Scholar] [CrossRef] [PubMed]
- Kinoshita, A.; Richter, R. Genetic and molecular basis of floral induction in Arabidopsis thaliana. J. Exp. Bot. 2020, 71, 2490–2504. [Google Scholar] [CrossRef] [PubMed]
- Blümel, M.; Dally, N.; Jung, C. Flowering time regulation in crops—What did we learn from arabidopsis? Curr. Opin. Biotechnol. 2015, 32, 121–129. [Google Scholar] [CrossRef]
- Shrestha, R.; Gómez-Ariza, J.; Brambilla, V.; Fornara, F. Molecular control of seasonal flowering in rice, arabidopsis and temperate cereals. Ann. Bot. 2014, 114, 1445–1458. [Google Scholar] [CrossRef] [Green Version]
- Xue, W.; Xing, Y.; Weng, X.; Zhao, Y.; Tang, W.; Wang, L.; Zhou, H.; Yu, S.; Xu, C.; Li, X.; et al. Natural variation in Ghd7 is an important regulator of heading date and yield potential in rice. Nat. Genet. 2008, 40, 761–767. [Google Scholar] [CrossRef] [PubMed]
- Gómez-Ariza, J.; Galbiati, F.; Goretti, D.; Brambilla, V.; Shrestha, R.; Pappolla, A.; Courtois, B.; Fornara, F. Loss of floral repressor function adapts rice to higher latitudes in Europe. J. Exp. Bot. 2015, 66, 2027–2039. [Google Scholar] [CrossRef] [Green Version]
- Itoh, H.; Wada, K.C.; Sakai, H.; Shibasaki, K.; Fukuoka, S.; Wu, J.; Yonemaru, J.; Yano, M.; Izawa, T. Genomic adaptation of flowering-time genes during the expansion of rice cultivation area. Plant J. 2018, 94, 895–909. [Google Scholar] [CrossRef]
- Fujino, K.; Obara, M.; Ikegaya, T. Establishment of adaptability to the northern-limit of rice production. Mol. Genet. Genom. 2019, 294, 729–737. [Google Scholar] [CrossRef]
- Saito, H.; Okumoto, Y.; Tsukiyama, T.; Xu, C.; Teraishi, M.; Tanisaka, T. Allelic differentiation at the E1/Ghd7 locus has allowed expansion of rice cultivation area. Plants 2019, 8, 550. [Google Scholar] [CrossRef] [Green Version]
- Tamaki, S.; Matsuo, S.; Hann, L.W.; Yokoi, S.; Shimamoto, K. Hd3a Protein is a mobile flowering signal in rice. Science 2007, 316, 1033–1036. [Google Scholar] [CrossRef]
- Komiya, R.; Yokoi, S.; Shimamoto, K. A Gene network for long-day flowering activates RFT1 encoding a mobile flowering signal in rice. Development 2009, 136, 3443–3450. [Google Scholar] [CrossRef] [Green Version]
- Takahashi, Y.; Teshima, K.M.; Yokoi, S.; Innan, H.; Shimamoto, K. Variations in Hd1 proteins, Hd3a promoters, and Ehd1 expression levels contribute to diversity of flowering time in cultivated rice. Proc. Natl. Acad. Sci. USA 2009, 106, 4555–4560. [Google Scholar] [CrossRef] [Green Version]
- Zhang, J.; Zhou, X.; Yan, W.; Zhang, Z.; Lu, L.; Han, Z.; Zhao, H.; Liu, H.; Song, P.; Hu, Y.; et al. Combinations of the Ghd7, Ghd8 and Hd1 genes largely define the ecogeographical adaptation and yield potential of cultivated rice. New Phytol. 2015, 208, 1056–1066. [Google Scholar] [CrossRef]
- Matsubara, K.; Yano, M. Genetic and molecular dissection of flowering time control in rice. In Rice Genomics, Genetics and Breeding; Sasaki, T., Ashikari, M., Eds.; Springer: Singapore, 2018; pp. 177–190. [Google Scholar]
- Kim, S.R.; Torollo, G.; Yoon, M.R.; Kwak, J.; Lee, C.K.; Prahalada, G.D.; Choi, I.R.; Yeo, U.S.; Jeong, O.Y.; Jena, K.K.; et al. Loss-of-function alleles of Heading Date 1 (Hd1) are associated with adaptation of temperate japonica rice plants to the tropical region. Front. Plant Sci. 2018, 9, 1827. [Google Scholar] [CrossRef] [Green Version]
- Yano, M.; Katayose, Y.; Ashikari, M.; Yamanouchi, U.; Monna, L.; Fuse, T.; Baba, T.; Yamamoto, K.; Umehara, Y.; Nagamura, Y.; et al. Hd1, a major photoperiod sensitivity quantitative trait locus in rice, is closely related to the Arabidopsis flowering time gene CONSTANS. Plant Cell 2000, 12, 2473–2483. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Leng, Y.; Gao, Y.; Chen, L.; Yang, Y.; Huang, L.; Dai, L.; Ren, D.; Xu, Q.; Zhang, Y.; Ponce, K.; et al. Using Heading date 1 preponderant alleles from indica cultivars to breed high-yield, high-quality japonica rice varieties for cultivation in South China. Plant Biotechnol. J. 2020, 18, 119–128. [Google Scholar] [CrossRef] [Green Version]
- Wu, C.-C.; Wei, F.-J.; Chiou, W.-Y.; Tsai, Y.-C.; Wu, H.-P.; Gotarkar, D.; Wei, Z.-H.; Lai, M.-H.; Hsing, Y.-I.C. Studies of rice Hd1 haplotypes worldwide reveal adaptation of flowering time to different environments. PLoS ONE 2020, 15, e0239028. [Google Scholar] [CrossRef]
- Mo, Y.; Jeong, J.-M.; Kim, B.-K.; Kwon, S.-W.; Jeung, J.-U. Utilization of elite Korean japonica rice varieties for association mapping of heading time, culm length, and amylose and protein content. Korean J. Crop Sci. 2020, 65, 1–21. [Google Scholar] [CrossRef]
- Lee, C.-M.; Kwon, Y.-H.; Park, H.-M.; Jeung, J.-U.; Park, H.-S.; Baek, M.-K.; Ha, S.-K.; Mo, Y. Days to heading and culm length variation of Korean rice varieties in different environments. Korean J. Breed. Sci. 2020, 52, 389–397. [Google Scholar] [CrossRef]
- Mo, Y.; Jeong, J.-M.; Ha, S.-K.; Kim, J.; Lee, C.; Lee, G.P.; Jeung, J.-U. Characterization of QTLs and candidate genes for days to heading in rice recombinant inbred lines. Genes 2020, 11, 957. [Google Scholar] [CrossRef] [PubMed]
- Doi, K.; Izawa, T.; Fuse, T.; Yamanouchi, U.; Kubo, T.; Shimatani, Z.; Yano, M.; Yoshimura, A. Ehd1, a B-type response regulator in rice, confers short-day promotion of flowering and controls FT-like gene expression independently of Hd1. Genes Dev. 2004, 18, 926–936. [Google Scholar] [CrossRef] [Green Version]
- Luan, W.; Chen, H.; Fu, Y.; Si, H.; Peng, W.; Song, S.; Liu, W.; Hu, G.; Sun, Z.; Xie, D.; et al. The effect of the crosstalk between photoperiod and temperature on the heading-date in rice. PLoS ONE 2009, 4, e5891. [Google Scholar] [CrossRef]
- Tian, Z.; Qian, Q.; Liu, Q.; Yan, M.; Liu, X.; Yan, C.; Liu, G.; Gao, Z.; Tang, S.; Zeng, D.; et al. Allelic diversities in rice starch biosynthesis lead to a diverse array of rice eating and cooking qualities. Proc. Natl. Acad. Sci. USA 2009, 106, 21760–21765. [Google Scholar] [CrossRef] [Green Version]
- Lee, D.B.; Jung, S.C.; So, K.H.; Jeong, J.W.; Jung, H.C.; Kim, G.Y.; Shim, G.M. Evaluation of mitigation technologies and footprint of carbon in unhulled rice production. J. Clim. Chang. Res. 2012, 3, 129–142. [Google Scholar]
- Park, H.; Jeung, J.; Cho, Y.; Kim, B. Development of early maturing rice lines with genes conferring resistance to bacterial blight and rice stripe virus for enhancing the adaptability in plain area. Korean J. Breed. Sci. 2015, 47, 118–127. [Google Scholar] [CrossRef]
- Ordonez, S.A.; Silva, J.; Oard, J.H. Association mapping of grain quality and flowering time in elite japonica rice germplasm. J. Cereal Sci. 2010, 51, 337–343. [Google Scholar] [CrossRef]
- Yan, W.H.; Wang, P.; Chen, H.X.; Zhou, H.J.; Li, Q.P.; Wang, C.R.; Ding, Z.H.; Zhang, Y.S.; Yu, S.B.; Xing, Y.Z.; et al. A major QTL, Ghd8, plays pleiotropic roles in regulating grain productivity, plant height, and heading date in rice. Mol. Plant 2011, 4, 319–330. [Google Scholar] [CrossRef]
- Zhang, Z.-H.; Zhu, Y.-J.; Wang, S.-L.; Fan, Y.-Y.; Zhuang, J.-Y. Importance of the interaction between heading date genes Hd1 and Ghd7 for controlling yield traits in rice. Int. J. Mol. Sci. 2019, 20, 516. [Google Scholar] [CrossRef] [Green Version]
- Xie, L.-H.; Zhu, Y.-J.; Tang, S.-Q.; Wei, X.-J.; Sheng, Z.-H.; Jiao, G.-A.; Hu, P.-S.; Zhuang, J.-Y. Pleiotropic effects of rice florigen gene RFT1 on the amino acid content of unmilled rice. Front. Genet. 2020, 11, 13. [Google Scholar] [CrossRef] [PubMed]
- RDA. Manual for Standard Evaluation Method in Agricultural Experiment and Research; Rural Development Administration (RDA): Suwon, Korea, 2003. [Google Scholar]
- Kwak, J.; Yoon, M.; Lee, J.; Lee, J.; Ko, S.; Tai, T.; Won, Y. Morphological and starch characteristics of the japonica rice mutant variety Seolgaeng for dry-milled flour. Food Sci. Biotechnol. 2017, 26, 43–48. [Google Scholar] [CrossRef] [PubMed]
- Juliano, B.O. Polysaccharide, proteins, and lipids of rice. In Rice Chemistry and Technology; American Association of Cereal Chemists: St. Paul, MN, USA, 1985. [Google Scholar]
- AOAC. Official Methods of Analysis; Association of Official Agricultural Chemists: Washington, DC, USA, 1995. [Google Scholar]
- Murray, M.G.; Thompson, W.F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980, 8, 4321–4326. [Google Scholar] [CrossRef] [PubMed] [Green Version]



| Type z | Cultivars y |
|---|---|
| GBZ (Hd1) | Anbaek, Anmi, Baegjinju, Baegjinju1ho, Boramchan, Borami, Cheongan, Cheongdam, Cheonghaejinmi, Cheongun, Chindeul, Chinnong, Dacheong, Daejinbyeo, Daesanbyeo, Dami, Deuraechan, Donghaejinmi, Dongjin2, Dongjinbyeo, Gancheokbyeo, Gangbaek, Gangchan, Geonyang2, Geuman, Geunnun, Gihobyeo, Goami3, Goami4, Haepum, Hanam, Hanmauem, Heugkwang, Heugseol, Hopum, Huimangchan, Hwaan, Hwanggeumnodeul, Hwangkeumnuri, Hwarang, Hwaseongbyeo, Hyeonpum, Ilmibyeo, Ilpumbyeo, Jannganbyeo, Jinbaek, Jinpum, Jinsumi, Jonong, Joryeongbyeo, Junam, Keumobyeo1, Keunpum, Kuemobyeo, Mananbyeo, Manbaek, Migwang, Miho, Misiru, MY298BB, MY299BK, Nunbora, Onnuri, Saeilmi, Saeilpum, Saenuri, Saesin, Sampyeong, Seoan1ho, Seoanbyeo, Seolgaeng, Seomyeong, Shinbaeg, Sindongjin, Sinjinbaek, Sodami, Suan, Sukwang, Yangjobyeo, Yechan, Yeongan, Younghojinmi, and Youngjin |
| Type 1 (Hd1) | Mimyeon |
| Type 6 (Hd1) | Aranghyangchalbyeo, Aromi, Baegokchal, Baegseolchal, Bodrami, Boramchal, Boseogchal, Boseogheugchal, Cheonga, Cheongcheongjinmi, Cheongho, Cheonghyangheukmi, Cheongnam, Cheongpum, Chilbo, Dabo, Daeanbyeo, Daebo, Daecheongbyeo, Daepyeong, Daeripbyeo1, Danmi, Dodamssal, Donganbyeo, Dongbo, Dongjin1ho, Dongjinchalbyeo, Geonganghongmi, Geonyangmi, Goami, Gopum, Gyehwabyeo, Haechanmulgyeol, Haepyeong, Haepyeongchal, Haiami, Hangaru, Heaoreumi, Heughyang, Heugjinmi, Heugnambyeo, Heugsujeong, Hoanbyeo, Hojin, HONGJINJU, Honong, Hopyung, Hwabong, Hwajinbyeo, Hwajungbyeo, Hwanambyeo, Hwasambyeo, Hwaseonchalbyeo, Hwasinbyeo, Hwayeongbyeo, Hyangnambyeo, Jeogjinju2, Jinbo, Jinkwang, Juanbyeo, Jungmo1006, Jungmo1032, Jungmo1034, Jungsaenggold, Malgeumi, Mangeumbyeo, Manjong, Manmi, Manpung, Manwol, Mihyangbyeo, Mipum, Misomi, Nampyeongbyeo, Palgongbyeo, Pungmi, Pungmi1, Saechilbo, Saegoami, Saegyewha, Samdeog, Samkwang, Samkwang1ho, Sangbo, Seolhyangchal, Seonpum, Seopyeong, Sinbo, Sinseonchalbyeo, Sobi, Sujin, Surabyeo, Suryeojinmi, Tamjinbyeo, Yeongdeogbyeo, and Youngbo |
| Type 11 (Hd1) | Sangnambatbyeo and Nokwoo |
| se1 (hd1) | Asemi, Baegilmi, Danpyeng, Hanseol, Heukjinjubyeo, Hwangkeumbora, Hwawang, Jeogjinju, Jinbuchalbyeo, Jinmibyeo, Jinseolchal, Jogwang, Jopum, Josaengheugchal, Joun, Jungsan, Manchu, Manho, Obongbyeo, Ondami, and Mogyang |
| T65 (hd1) | Jungmo1043 and Naepungbyeo |
| Type 7 (hd1) | CW92MR, Keumo3, Nonganbyeo, Andabyeo, Areumbyeo, Cheongcheongbyeo, Cheongwoo, Dasan1ho, Dasan2, Dasanbyeo, Geumgang1, Hanareum, Hanareum2, Hanareum3ho, Hanareum4, Hanareumchal, Hangangchal1, Hangangchalbyeo, Hyangmibyeo1, Jangseongbyeo, Jungwonbyeo, Keunseom, Namcheonbyeo, Nampungbyeo, Palbangmi, Saemimyeon, Samgangbyeo, Segyejinmi, Singil, Taebaekbyeo, and Yongmunbyeo |
| Type 14 (hd1) | Asemi1ho, Boseog, Cheongbaekchal, Dunnaebyeo, Geumobyeo, Geumyoung, Goun, Gurubyeo, Haedamssal, Haedeul, Handeul, Jinbubyeo, Jinhan, Jinok, Joami, Joan, Joeunheukmi, Joil, Jopyeong, Junghwabyeo, Jungmo1024ho, Manna, Namil, Namwonbyeo, Nunkeunheugchal, Nunkeunheugchal1ho, Odae1ho, Odaebyeo, Pyeongwon, Saeodae, Saesangju, Samcheonbyeo, Sandeuljinmi, Sangjubyeo, Sangjuchalbyeo, Sanhomi, Seolbaek, Seolemi, Seongsan, Shinpyeong, Sinunbong1, Sinunbongbyeo, Sobaegbyeo, Taebong, Unbaekchal, Unbongbyeo, Undoobyeo, Unilchal, Unjangbyeo, Unkwang, Unmi, Wolbaek, Miwoo, Mogwoo, Nokyang, and Yeongwoo |
| AK | Jinbuolbyeo |
| ENV z | DTH | CL | AC | PC | ||||
|---|---|---|---|---|---|---|---|---|
| F-Value | PVE (%) | F-Value | PVE (%) | F-Value | PVE (%) | F-Value | PVE (%) | |
| WJ 2018 | 37.6 **** | 51.4 | 5.4 **** | 13.2 | 0.9 NS | - | 40.0 **** | 53.0 |
| WJ 2019 | 58.3 **** | 62.2 | 6.2 **** | 14.8 | 1.4 NS | - | 7.2 **** | 17.0 |
| SW 2018 | 67.3 **** | 65.5 | 11.4 **** | 24.2 | 2.1 * | 5.5 | 15.1 **** | 29.8 |
| SW 2019 | 68.2 **** | 65.8 | 6.9 **** | 16.2 | 1.4 NS | - | 33.9 **** | 42.2 |
| Hd1 Allele z | No. of | DTH | CL | PC |
|---|---|---|---|---|
| Cultivars | (Days) | (cm) | (%) | |
| GBZ (Hd1) | 83 | 86.9 ± 8.42 a | 75.7 ± 8.36 c | 6.0 ± 0.59 b |
| Type 1 (Hd1) | 1 | 76.9 ± 9.13 cd | 79.3 ± 7.16 bc | 6.8 ± 0.49 ab |
| Type 6 (Hd1) | 96 | 84.5 ± 8.66 b | 76.3 ± 8.82 c | 6.2 ± 0.63 ab |
| Type 11 (Hd1) | 2 | 81.2 ± 15.29 bc | 101.1 ± 21.88 a | 6.5 ± 0.67 ab |
| se1 (hd1) | 21 | 67.8 ± 9.18 d | 73.8 ± 8.39 c | 6.7 ± 1.05 ab |
| T65 (hd1) | 2 | 71.0 ± 6.72 d | 72.0 ± 8.08 cd | 6.7 ± 0.78 ab |
| Type 7 (hd1) | 31 | 80.6 ± 9.17 c | 79.3 ± 6.82 b | 6.8 ± 0.71 a |
| Type 14 (hd1) | 56 | 68.9 ± 10.01 d | 74.0 ± 8.30 c | 6.7 ± 0.95 ab |
| AK (hd1) | 1 | 51.9 ± 5.72 e | 58.6 ± 3.41 d | 7.1 ± 1.37 a |
| Hd1 | 182 | 85.5 ± 8.74 | 76.3 ± 9.19 | 6.1 ± 0.62 |
| hd1 | 111 | 71.8 ± 11.10 **** | 75.3 ± 8.39 * | 6.7 ± 0.91 **** |
| Region | Usage | Primer Name | Sequence | Reference |
|---|---|---|---|---|
| Exon1 | PCR | Hd1_exon1_F | CCAAGTGTCAATCGCTGGAT | this study |
| Hd1_exon1_R | AAGTAGTCAACTGGTCTGCC | this study | ||
| Sequencing | Hd1_P1_R | CGGTTGTCGTAGTACGAATTGTAC | [15] | |
| Hd1_exon1_R1 | ATCTTGGTTGTTTTCGATGCG | this study | ||
| Hd1_P2_F | ACGAGGAGGTGGACTCTTG | [15] | ||
| 312 bp insertion a | Hd1_P1_F | TTCCCCTCCCTAGCTCCTTCCAA | [15] | |
| Hd1_P2_R | ATCGGTTCCATTTAATCAGCCT | [15] | ||
| 1.9 kb insertion b | Hd1_exon1_F1 | ATCAGTGGGCCTTGGTTATG | this study | |
| Hd1_exon1_F2 | GAAACAGCGACAATGACGAC | this study | ||
| Hd1_exon1_R2 | GCATCTTCTTCACCGAGTCC | this study | ||
| Hd1_exon1_R3 | ATCACCCCCTAAACCTGACC | this study | ||
| Exon2 | PCR and sequencing | Hd1_P4_F | GAAAGACCTCATGAAAAGTAGG | [15] |
| Hd1_P4_R | GCTATCCGGAAATTACAAAGCA | [15] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mo, Y.; Lee, C.-M.; Park, H.-M.; Ha, S.-K.; Kim, M.-J.; Kwak, J.; Lee, H.-S.; Lee, J.-H.; Jeung, J.-U. Hd1 Allele Types and Their Associations with Major Agronomic Traits in Korean Rice Cultivars. Plants 2021, 10, 2408. https://doi.org/10.3390/plants10112408
Mo Y, Lee C-M, Park H-M, Ha S-K, Kim M-J, Kwak J, Lee H-S, Lee J-H, Jeung J-U. Hd1 Allele Types and Their Associations with Major Agronomic Traits in Korean Rice Cultivars. Plants. 2021; 10(11):2408. https://doi.org/10.3390/plants10112408
Chicago/Turabian StyleMo, Youngjun, Chang-Min Lee, Hyang-Mi Park, Su-Kyung Ha, Mi-Jung Kim, Jieun Kwak, Hyun-Sook Lee, Jeong-Heui Lee, and Ji-Ung Jeung. 2021. "Hd1 Allele Types and Their Associations with Major Agronomic Traits in Korean Rice Cultivars" Plants 10, no. 11: 2408. https://doi.org/10.3390/plants10112408
APA StyleMo, Y., Lee, C.-M., Park, H.-M., Ha, S.-K., Kim, M.-J., Kwak, J., Lee, H.-S., Lee, J.-H., & Jeung, J.-U. (2021). Hd1 Allele Types and Their Associations with Major Agronomic Traits in Korean Rice Cultivars. Plants, 10(11), 2408. https://doi.org/10.3390/plants10112408

