Expression Profile of Sorghum Genes and Cis-Regulatory Elements under Salt-Stress Conditions
Abstract
:1. Introduction
2. Results
2.1. Effects of Physiological Factors under Salt Stress
2.2. QuantSeq Data Generation and Assembly
2.3. Identification of DEGs in Response to Salt Stress
2.4. Functional Classification and KEGG Enrichment Analysis of Salt-Responsive DEGs
2.5. Identification of Potential CRE Functions Associated with Abiotic Stress and Exploration of Related Sorghum Genes
2.6. Validation of DEG Profiles by qRT-PCR
3. Discussion
4. Materials and Methods
4.1. Plant Growth Conditions
4.2. Physiological Analysis
Measurement of the Chlorophyll Contents
- Measurement of the K+ and Na+ in the leaves
- 2.
- Measurement of the proline contents in the leaves
- 3.
- Measurement of the reducing sugar contents in the leaves
- 4.
- Measurement of the anthocyanin level in the leaves
4.3. Statistical Analysis
4.4. RNA Extraction and Library Construction for QuantSeq
4.5. QuantSeq Data Analysis (Quality Control and Assembly)
4.6. Functional Annotation and Pathway Analysis of DEGs
4.7. Cis-Regulatory Elements (CRE) Analysis
4.8. Validation of DEGs by qRT-PCR
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Shahbaz, M.; Ashraf, M. Improving salinity tolerance in cereals. Crit. Rev. Plant Sci. 2013, 32, 237–249. [Google Scholar] [CrossRef]
- Song, J.; Wang, B. Using euhalophytes to understand salt tolerance and to develop saline agriculture: Suaeda salsa as a promising model. Ann. Bot. 2015, 115, 541–553. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jamil, A.; Riaz, S.; Ashraf, M.; Foolad, M.R. Gene expression profiling of plants under salt stress. Crit. Rev. Plant Sci. 2011, 30, 435–458. [Google Scholar] [CrossRef]
- Hasegawa, P.M.; Bressan, R.A.; Zhu, J.-K.; Bohnert, H.J. Plant cellular and molecular responses to high salinity. Annu. Rev. Plant Biol. 2000, 51, 463–499. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Egamberdieva, D.; Wirth, S.; Bellingrath-Kimura, S.D.; Mishra, J.; Arora, N.K. Salt-tolerant plant growth promoting rhizobacteria for enhancing crop productivity of saline soils. Front. Microbiol. 2019, 10, 2791. [Google Scholar] [CrossRef] [Green Version]
- Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909–930. [Google Scholar] [CrossRef]
- Monreal, J.A.; Arias-Baldrich, C.; Pérez-Montaño, F.; Gandullo, J.; Echevarría, C.; García-Mauriño, S. Factors involved in the rise of phosphoenolpyruvate carboxylase-kinase activity caused by salinity in sorghum leaves. Planta 2013, 237, 1401–1413. [Google Scholar] [CrossRef]
- Singh, M.; Singh, A.; Prasad, S.M.; Singh, R.K. Regulation of plants metabolism in response to salt stress: An omics approach. Acta Physiol. Plant. 2017, 39, 48. [Google Scholar] [CrossRef]
- Hasanuzzaman, M.; Nahar, K.; Rahman, A.; Al Mahmud, J.; Hossain, S.; Alam, K.; Oku, H.; Fujita, M. Actions of biological trace elements in plant abiotic stress tolerance. In Essential Plant Nutrients; Springer: Berlin/Heidelberg, Germany, 2017; pp. 213–274. [Google Scholar]
- Naeem, M.; Ansari, A.A.; Gill, S.S.; Aftab, T.; Idrees, M.; Ali, A.; Khan, M.M.A. Regulatory role of mineral nutrients in nurturing of medicinal legumes under salt stress. In Essential Plant Nutrients; Springer: Berlin/Heidelberg, Germany, 2017; pp. 309–334. [Google Scholar]
- Sharma, D.K.; Singh, A. Current trends and emerging challenges in sustainable management of salt-affected soils: A critical appraisal. In Bioremediation of Salt Affected Soils: An Indian Perspective; Springer: Berlin/Heidelberg, Germany, 2017; pp. 1–40. [Google Scholar]
- Cui, J.; Ren, G.; Qiao, H.; Xiang, X.; Huang, L.; Chang, J. Comparative transcriptome analysis of seedling stage of two sorghum cultivars under salt stress. J. Plant Growth Regul. 2018, 37, 986–998. [Google Scholar] [CrossRef]
- Chaires, M.; Gupta, D.; Joshee, N.; Cooper, K.K.; Basu, C. RNA-seq analysis of the salt stress-induced transcripts in fast-growing bioenergy tree, Paulownia elongata. J. Plant Interact. 2017, 12, 128–136. [Google Scholar] [CrossRef]
- Diray-Arce, J.; Clement, M.; Gul, B.; Khan, M.A.; Nielsen, B.L. Transcriptome assembly, profiling and differential gene expression analysis of the halophyte Suaeda fruticosa provides insights into salt tolerance. BMC Genom. 2015, 16, 353. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yousefirad, S.; Soltanloo, H.; Ramezanpour, S.S.; Zaynali Nezhad, K.; Shariati, V. The RNA-seq transcriptomic analysis reveals genes mediating salt tolerance through rapid triggering of ion transporters in a mutant barley. PLoS ONE 2020, 15, e0229513. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zeng, A.; Chen, P.; Korth, K.L.; Ping, J.; Thomas, J.; Wu, C.; Srivastava, S.; Pereira, A.; Hancock, F.; Brye, K. RNA sequencing analysis of salt tolerance in soybean (Glycine max). Genomics 2019, 111, 629–635. [Google Scholar] [CrossRef] [PubMed]
- Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. Gene ontology analysis for RNA-seq: Accounting for selection bias. Genome Biol. 2010, 11, R14. [Google Scholar] [CrossRef] [Green Version]
- Moll, P.; Ante, M.; Seitz, A.; Reda, T. QuantSeq 3′ mRNA sequencing for RNA quantification. Nat. Methods 2014, 11, i–iii. [Google Scholar] [CrossRef]
- Ma, F.; Fuqua, B.K.; Hasin, Y.; Yukhtman, C.; Vulpe, C.D.; Lusis, A.J.; Pellegrini, M. A comparison between whole transcript and 3’RNA sequencing methods using Kapa and Lexogen library preparation methods. BMC Genom. 2019, 20, 9. [Google Scholar] [CrossRef]
- Corley, S.M.; Troy, N.M.; Bosco, A.; Wilkins, M.R. QuantSeq. 3′ Sequencing combined with Salmon provides a fast, reliable approach for high throughput RNA expression analysis. Sci. Rep. 2019, 9, 18895. [Google Scholar] [CrossRef] [Green Version]
- Sharma, N.; Russell, S.D.; Bhalla, P.L.; Singh, M.B. Putative cis-regulatory elements in genes highly expressed in rice sperm cells. BMC Res. Notes 2011, 4, 319. [Google Scholar] [CrossRef] [Green Version]
- Ho, C.-L.; Geisler, M. Genome-wide computational identification of biologically significant cis-regulatory elements and associated transcription factors from rice. Plants 2019, 8, 441. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Chen, C.-y.; Kaye, A.M.; Wasserman, W.W. The identification of cis-regulatory elements: A review from a machine learning perspective. Biosystems 2015, 138, 6–17. [Google Scholar] [CrossRef]
- Priya, P.; Jain, M. RiceSRTFDB: A database of rice transcription factors containing comprehensive expression, cis-regulatory element and mutant information to facilitate gene function analysis. Database 2013, 2013, bat027. [Google Scholar] [CrossRef] [PubMed]
- Bates, L.S.; Waldren, R.P.; Teare, I.D. Rapid determination of free proline for water-stress studies. Plant Soil 1973, 39, 205–207. [Google Scholar] [CrossRef]
- Antonopoulou, G.; Gavala, H.N.; Skiadas, I.V.; Angelopoulos, K.; Lyberatos, G. Biofuels generation from sweet sorghum: Fermentative hydrogen production and anaerobic digestion of the remaining biomass. Bioresour. Technol. 2008, 99, 110–119. [Google Scholar] [CrossRef]
- Tari, I.; Laskay, G.; Takács, Z.; Poór, P. Response of sorghum to abiotic stresses: A review. J. Agron. Crop Sci. 2013, 199, 264–274. [Google Scholar] [CrossRef] [Green Version]
- Zhang, H.-h.; Xu, N.; Wu, X.; Wang, J.; Ma, S.; Li, X.; Sun, G. Effects of four types of sodium salt stress on plant growth and photosynthetic apparatus in sorghum leaves. J. Plant Interact. 2018, 13, 506–513. [Google Scholar] [CrossRef] [Green Version]
- Boursier, P.; Läuchli, A. Growth responses and mineral nutrient relations of salt-stressed sorghum. Crop Sci. 1990, 30, 1226–1233. [Google Scholar] [CrossRef]
- Sun, J.; He, L.; Li, T. Response of seedling growth and physiology of Sorghum bicolor (L.) Moench to saline-alkali stress. PLoS ONE 2019, 14, e0220340. [Google Scholar] [CrossRef] [Green Version]
- Weimberg, R.; Lerner, H.; Poljakoff-Mayber, A. A relationship between potassium and proline accumulation in salt-stressed Sorghum bicolor. Physiol. Plant. 1982, 55, 5–10. [Google Scholar] [CrossRef]
- Kang, C.; Lee, I.; Kwon, S. Screening for Fittest Miscellaneous Cereals for Reclaimed Land and Functionality Improvement of Sorghum bicolor Cultivated in Reclaimed Land. Korean Soc. Crop Sci. 2019, 64, 109–126. [Google Scholar]
- Afzal, Z.; Howton, T.; Sun, Y.; Mukhtar, M.S. The roles of aquaporins in plant stress responses. J. Dev. Biol. 2016, 4, 9. [Google Scholar] [CrossRef] [Green Version]
- Zhang, F.; Zhu, G.; Du, L.; Shang, X.; Cheng, C.; Yang, B.; Hu, Y.; Cai, C.; Guo, W. Genetic regulation of salt stress tolerance revealed by RNA-Seq in cotton diploid wild species, Gossypium davidsonii. Sci. Rep. 2016, 6, 20582. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, F.; Fang, P.; Zeng, W.; Ding, Y.; Zhuang, Z.; Peng, Y. Comparing transcriptome expression profiles to reveal the mechanisms of salt tolerance and exogenous glycine betaine mitigation in maize seedlings. PLoS ONE 2020, 15, e0233616. [Google Scholar] [CrossRef]
- Ueda, A.; Yahagi, H.; Fujikawa, Y.; Nagaoka, T.; Esaka, M.; Calcaño, M.; González, M.M.; Hernández Martich, J.D.; Saneoka, H. Comparative physiological analysis of salinity tolerance in rice. Soil Sci. Plant Nutr. 2013, 59, 896–903. [Google Scholar] [CrossRef]
- Huang, Y.; Zhang, G.; Wu, F.; Chen, J.; Zhou, M. Differences in Physiological Traits Among Salt-Stressed Barley Genotypes. Commun. Soil Sci. Plant Anal. 2006, 37, 557–570. [Google Scholar] [CrossRef]
- Gupta, B.; Huang, B. Mechanism of salinity tolerance in plants: Physiological, biochemical, and molecular characterization. Int. J. Genom. 2014, 2014, 701596. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Yang, A.; Zhang, W.-H. Comparative studies on tolerance of rice genotypes differing in their tolerance to moderate salt stress. BMC Plant Biol. 2017, 17, 141. [Google Scholar] [CrossRef] [Green Version]
- Hauser, F.; Horie, T. A conserved primary salt tolerance mechanism mediated by HKT transporters: A mechanism for sodium exclusion and maintenance of high K+/Na+ ratio in leaves during salinity stress. Plant Cell Environ. 2010, 33, 552–565. [Google Scholar] [CrossRef]
- Yang, Z.; Li, J.-L.; Liu, L.-N.; Xie, Q.; Sui, N. Photosynthetic regulation under salt stress and salt-tolerance mechanism of sweet sorghum. Front. Plant Sci. 2020, 10, 1722. [Google Scholar] [CrossRef]
- Assaha, D.V.; Ueda, A.; Saneoka, H.; Al-Yahyai, R.; Yaish, M.W. The role of Na+ and K+ transporters in salt stress adaptation in glycophytes. Front. Physiol. 2017, 8, 509. [Google Scholar] [CrossRef]
- Stepien, P.; Johnson, G.N. Contrasting responses of photosynthesis to salt stress in the glycophyte Arabidopsis and the halophyte Thellungiella: Role of the plastid terminal oxidase as an alternative electron sink. Plant Physiol. 2009, 149, 1154–1165. [Google Scholar] [CrossRef] [Green Version]
- Kerstiens, G.; Tych, W.; Robinson, M.F.; Mansfield, T.A. Sodium-related partial stomatal closure and salt tolerance of Aster tripolium. New Phytol. 2002, 153, 509–515. [Google Scholar] [CrossRef] [PubMed]
- Taïbi, K.; Taïbi, F.; Abderrahim, L.A.; Ennajah, A.; Belkhodja, M.; Mulet, J.M. Effect of salt stress on growth, chlorophyll content, lipid peroxidation and antioxidant defence systems in Phaseolus vulgaris L. S. Afr. J. Bot. 2016, 105, 306–312. [Google Scholar] [CrossRef]
- Amirjani, M.R. Effect of salinity stress on growth, sugar content, pigments and enzyme activity of rice. Int. J. Bot. 2011, 7, 73–81. [Google Scholar] [CrossRef] [Green Version]
- Estan, M.; Caro, M.; Bolarin, M. Response of tomato cultivars to salinity. Plant Soil 1993, 150, 203–211. [Google Scholar]
- Kumar, S.G.; Madhusudhan, K.; Sreenivasulu, N.; Sudhakar, C. Stress responses in two genotypes of mulberry (Morus alba L.) under NaCl salinity. Indian J. Exp. Biol. 2000, 38, 192–195. [Google Scholar]
- De Lacerda, C.F.; Cambraia, J.; Oliva, M.A.; Ruiz, H.A.; Prisco, J.T.n. Solute accumulation and distribution during shoot and leaf development in two sorghum genotypes under salt stress. Environ. Exp. Bot. 2003, 49, 107–120. [Google Scholar] [CrossRef] [Green Version]
- Lacerda, C.F.D.; Cambraia, J.; Cano, M.A.O.; Ruiz, H.A. Plant growth and solute accumulation and distribution in two sorghum genotypes, under NaCl stress. Rev. Bras. Fisiol. Veg. 2001, 13, 270–284. [Google Scholar] [CrossRef]
- Binzel, M.L.; Hasegawa, P.M.; Rhodes, D.; Handa, S.; Handa, A.K.; Bressan, R.A. Solute accumulation in tobacco cells adapted to NaCl. Plant Physiol. 1987, 84, 1408–1415. [Google Scholar] [CrossRef]
- Yin, Y.-G.; Kobayashi, Y.; Sanuki, A.; Kondo, S.; Fukuda, N.; Ezura, H.; Sugaya, S.; Matsukura, C. Salinity induces carbohydrate accumulation and sugar-regulated starch biosynthetic genes in tomato (Solanum lycopersicum L. cv.‘Micro-Tom’) fruits in an ABA-and osmotic stress-independent manner. J. Exp. Bot. 2010, 61, 563–574. [Google Scholar] [CrossRef]
- Kerepesi, I.; Galiba, G. Osmotic and salt stress-induced alteration in soluble carbohydrate content in wheat seedlings. Crop Sci. 2000, 40, 482–487. [Google Scholar] [CrossRef]
- Sehyun Choi, Y.K.; Lee, S.; Jeon, D.-H.; Seo, S.; Lee, T.-H.; Kim, C. Physio-chemical and co-expression network analysis associated withsalt stress in sorghum. Front. Biosci. 2022, 27, 55. [Google Scholar] [CrossRef] [PubMed]
- Chunthaburee, S.; Sakuanrungsirikul, S.; Wongwarat, T.; Sanitchon, J.; Pattanagul, W.; Theerakulpisut, P. Changes in anthocyanin content and expression of anthocyanin synthesis genes in seedlings of black glutinous rice in response to salt stress. Asian J. Plant Sci. 2016, 15, 56–65. [Google Scholar] [CrossRef]
- Juszczuk, I.M.; Wiktorowska, A.; Malusá, E.; Rychter, A.M. Changes in the concentration of phenolic compounds and exudation induced by phosphate deficiency in bean plants (Phaseolus vulgaris L.). Plant Soil 2004, 267, 41–49. [Google Scholar] [CrossRef]
- Wahid, A.; Ghazanfar, A. Possible involvement of some secondary metabolites in salt tolerance of sugarcane. J. Plant Physiol. 2006, 163, 723–730. [Google Scholar] [CrossRef]
- Li, Z.; Tian, Y.; Xu, J.; Fu, X.; Gao, J.; Wang, B.; Han, H.; Wang, L.; Peng, R.; Yao, Q. A tomato ERF transcription factor, SlERF84, confers enhanced tolerance to drought and salt stress but negatively regulates immunity against Pseudomonas syringae pv. tomato DC3000. Plant Physiol. Biochem. 2018, 132, 683–695. [Google Scholar] [CrossRef]
- Müller, M.; Munné-Bosch, S. Ethylene response factors: A key regulatory hub in hormone and stress signaling. Plant Physiol. 2015, 169, 32–41. [Google Scholar] [CrossRef] [Green Version]
- Hao, D.; Ohme-Takagi, M.; Sarai, A. Unique mode of GCC box recognition by the DNA-binding domain of ethylene-responsive element-binding factor (ERF domain) in plant. J. Biol. Chem. 1998, 273, 26857–26861. [Google Scholar] [CrossRef] [Green Version]
- Huang, P.-Y.; Catinot, J.; Zimmerli, L. Ethylene response factors in Arabidopsis immunity. J. Exp. Bot. 2016, 67, 1231–1241. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Hou, C.; Zheng, K.; Li, Q.; Chen, S.; Wang, S. Overexpression of ERF96, a small ethylene response factor gene, enhances salt tolerance in Arabidopsis. Biol. Plant. 2017, 61, 693–701. [Google Scholar] [CrossRef]
- Gao, S.; Zhang, H.; Tian, Y.; Li, F.; Zhang, Z.; Lu, X.; Chen, X.; Huang, R. Expression of TERF1 in rice regulates expression of stress-responsive genes and enhances tolerance to drought and high-salinity. Plant Cell Rep. 2008, 27, 1787–1795. [Google Scholar] [CrossRef]
- Agarwal, P.K.; Agarwal, P.; Reddy, M.; Sopory, S.K. Role of DREB transcription factors in abiotic and biotic stress tolerance in plants. Plant Cell Rep. 2006, 25, 1263–1274. [Google Scholar] [CrossRef] [PubMed]
- Lata, C.; Prasad, M. Role of DREBs in regulation of abiotic stress responses in plants. J. Exp. Bot. 2011, 62, 4731–4748. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nguyen, Q.H.; Vu, L.T.K.; Nguyen, L.T.N.; Pham, N.T.T.; Nguyen, Y.T.H.; Van Le, S.; Chu, M.H. Overexpression of the GmDREB6 gene enhances proline accumulation and salt tolerance in genetically modified soybean plants. Sci. Rep. 2019, 9, 19663–19668. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.-X.; Tang, Y.-J.; Ma, Q.-B.; Yang, C.-Y.; Mu, Y.-H.; Suo, H.-C.; Luo, L.-H.; Nian, H. OsDREB2A, a rice transcription factor, significantly affects salt tolerance in transgenic soybean. PLoS ONE 2013, 8, e83011. [Google Scholar] [CrossRef]
- Moschou, P.N.; Paschalidis, K.A.; Delis, I.D.; Andriopoulou, A.H.; Lagiotis, G.D.; Yakoumakis, D.I.; Roubelakis-Angelakis, K.A. Spermidine exodus and oxidation in the apoplast induced by abiotic stress is responsible for H2O2 signatures that direct tolerance responses in tobacco. Plant Cell 2008, 20, 1708–1724. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, W.; Liu, J.-H. CsPAO4 of Citrus sinensis functions in polyamine terminal catabolism and inhibits plant growth under salt stress. Sci. Rep. 2016, 6, 31384. [Google Scholar] [CrossRef] [Green Version]
- Jiang, S.-C.; Mei, C.; Liang, S.; Yu, Y.-T.; Lu, K.; Wu, Z.; Wang, X.-F.; Zhang, D.-P. Crucial roles of the pentatricopeptide repeat protein SOAR1 in Arabidopsis response to drought, salt and cold stresses. Plant Mol. Biol. 2015, 88, 369–385. [Google Scholar] [CrossRef] [Green Version]
- Jia, F.; Wang, C.; Huang, J.; Yang, G.; Wu, C.; Zheng, C. SCF E3 ligase PP2-B11 plays a positive role in response to salt stress inArabidopsis. J. Exp. Bot. 2015, 66, 4683–4697. [Google Scholar] [CrossRef] [Green Version]
- Zou, C.; Sun, K.; Mackaluso, J.D.; Seddon, A.E.; Jin, R.; Thomashow, M.F.; Shiu, S.-H. Cis-regulatory code of stress-responsive transcription in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA 2011, 108, 14992–14997. [Google Scholar] [CrossRef] [Green Version]
- Hernandez-Garcia, C.M.; Finer, J.J. Identification and validation of promoters and cis-acting regulatory elements. Plant Sci. 2014, 217, 109–119. [Google Scholar] [CrossRef] [Green Version]
- Lee, T.I.; Young, R.A. Transcription of eukaryotic protein-coding genes. Annu. Rev. Genet. 2000, 34, 77–137. [Google Scholar] [CrossRef] [PubMed]
- Lenka, S.; Bansal, K.C. Abiotic stress responsive cis-regulatory elements (CREs) in rice (Oryza sativa L.) and other plants. OSF Prepr. 2019. [Google Scholar] [CrossRef]
- Sheshadri, S.; Nishanth, M.; Simon, B. Stress-mediated cis-element transcription factor interactions interconnecting primary and specialized metabolism in planta. Front. Plant Sci. 2016, 7, 1725. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wittkopp, P. Evolution of cis-regulatory sequence and function in Diptera. Heredity 2006, 97, 139–147. [Google Scholar] [CrossRef] [Green Version]
- Finkelstein, R. Abscisic acid synthesis and response. Arab. Book/Am. Soc. Plant Biol. 2013, 11, e0166. [Google Scholar] [CrossRef] [Green Version]
- Finkelstein, R.R.; Gampala, S.S.; Rock, C.D. Abscisic acid signaling in seeds and seedlings. Plant Cell 2002, 14, S15–S45. [Google Scholar] [CrossRef] [Green Version]
- Sripinyowanich, S.; Klomsakul, P.; Boonburapong, B.; Bangyeekhun, T.; Asami, T.; Gu, H.; Buaboocha, T.; Chadchawan, S. Exogenous ABA induces salt tolerance in indica rice (Oryza sativa L.): The role of OsP5CS1 and OsP5CR gene expression during salt stress. Environ. Exp. Bot. 2013, 86, 94–105. [Google Scholar] [CrossRef]
- Marcińska, I.; Czyczyło-Mysza, I.; Skrzypek, E.; Grzesiak, M.T.; Janowiak, F.; Filek, M.; Dziurka, M.; Dziurka, K.; Waligórski, P.; Juzoń, K. Alleviation of osmotic stress effects by exogenous application of salicylic or abscisic acid on wheat seedlings. Int. J. Mol. Sci. 2013, 14, 13171–13193. [Google Scholar] [CrossRef] [Green Version]
- Estrada-Melo, A.C.; Reid, M.S.; Jiang, C.-Z. Overexpression of an ABA biosynthesis gene using a stress-inducible promoter enhances drought resistance in petunia. Hortic. Res. 2015, 2, 15013. [Google Scholar] [CrossRef] [Green Version]
- Iuchi, S.; Kobayashi, M.; Taji, T.; Naramoto, M.; Seki, M.; Kato, T.; Tabata, S.; Kakubari, Y.; Yamaguchi-Shinozaki, K.; Shinozaki, K. Regulation of drought tolerance by gene manipulation of 9-cis-epoxycarotenoid dioxygenase, a key enzyme in abscisic acid biosynthesis in Arabidopsis. Plant J. 2001, 27, 325–333. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Yang, J.; Lu, S.; Cai, J.; Guo, Z. Overexpressing SgNCED1 in tobacco increases ABA level, antioxidant enzyme activities, and stress tolerance. J. Plant Growth Regul. 2008, 27, 151–158. [Google Scholar] [CrossRef]
- Huang, Y.; Guo, Y.; Liu, Y.; Zhang, F.; Wang, Z.; Wang, H.; Wang, F.; Li, D.; Mao, D.; Luan, S. 9-cis-Epoxycarotenoid dioxygenase 3 regulates plant growth and enhances multi-abiotic stress tolerance in rice. Front. Plant Sci. 2018, 9, 162. [Google Scholar] [CrossRef] [PubMed]
- Arnon, D.I. Copper Enzymes in Isolated Chloroplasts. Polyphenoloxidase in Beta Vulgaris. Plant Physiol. 1949, 24, 1–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miller, G.L. Use of Dinitrosalicylic Acid Reagent for Determination of Reducing Sugar. Anal. Chem. 1959, 31, 426–428. [Google Scholar] [CrossRef]
- Nakata, M.; Mitsuda, N.; Herde, M.; Koo, A.J.K.; Moreno, J.E.; Suzuki, K.; Howe, G.A.; Ohme-Takagi, M. A bHLH-Type Transcription Factor, ABA-INDUCIBLE BHLH-TYPE TRANSCRIPTION FACTOR/JA-ASSOCIATED MYC2-LIKE1, Acts as a Repressor to Negatively Regulate Jasmonate Signaling in Arabidopsis. Plant Cell 2013, 25, 1641–1656. [Google Scholar] [CrossRef] [Green Version]
Gene | Function |
---|---|
LOC8084733 | RING-H2 finger protein ATL3 |
LOC110430284 | RING-H2 finger protein ATL72-like |
LOC8065367 | chaperone protein dnaJ 20, chloroplastic |
LOC8069346 | chaperone protein dnaJ 8, chloroplastic |
LOC8083217 | ethylene-responsive transcription factor ERF109 |
LOC8086051 | ethylene-responsive transcription factor 8 |
LOC8085844 | ethylene-responsive transcription factor 11 |
LOC8063947 | ethylene-responsive transcription factor 4 |
LOC8086050 | ethylene-responsive transcription factor 4 |
LOC8072153 | ethylene-responsive transcription factor 4 |
LOC8080057 | ethylene-responsive transcription factor RAP2-13 |
LOC8055639 | ethylene-responsive transcription factor ERF104 |
LOC8081902 | ethylene-responsive transcription factor RAP2-13 |
LOC8073540 | ethylene-responsive transcription factor ERF060 |
LOC8082391 | ethylene-responsive transcription factor 4 |
LOC110436144 | ethylene-responsive transcription factor 3-like |
LOC8054868 | dehydration-responsive element-binding protein 1H |
LOC8060409 | dehydration-responsive element-binding protein 1E |
LOC8054869 | dehydration-responsive element-binding protein 1A |
LOC8054870 | dehydration-responsive element-binding protein 1A |
LOC8077913 | dehydrin DHN1 |
LOC110431599 | protein early responsive to dehydration 15-like |
LOC8069003 | mitogen-activated protein kinase kinase kinase 2 |
LOC8069002 | mitogen-activated protein kinase kinase kinase 3 |
LOC8056863 | mitogen-activated protein kinase kinase 9 |
LOC8054176 | probable galacturonosyltransferase-like 1 |
LOC8075735 | probable galacturonosyltransferase-like 9 |
LOC8057368 | zinc finger protein ZAT12 |
LOC8057369 | zinc finger protein ZAT5 |
LOC8086194 | zinc finger protein 1 |
LOC8071266 | zinc finger CCCH domain-containing protein 33 |
LOC8059898 | bZIP transcription factor 60 |
LOC8079022 | MADS-box transcription factor 18 |
LOC8061953 | heat stress transcription factor C-2b |
LOC8062208 | 9-cis-epoxycarotenoid dioxygenase 1, chloroplastic |
LOC8057616 | 1-aminocyclopropane-1-carboxylate synthase |
LOC8059158 | transcription factor bHLH13 |
LOC8080622 | receptor-like protein kinase |
LOC8078033 | cyclin-dependent protein kinase inhibitor EL2 |
LOC8086215 | probable WRKY transcription factor 48 |
LOC8061067 | probable WRKY transcription factor 50 |
LOC8077628 | WRKY transcription factor WRKY71 |
LOC8077654 | transcription factor MYB44 |
LOC8057074 | NAC domain-containing protein 67 |
LOC8067112 | NDR1/HIN1-like protein 6 |
LOC8071480 | K(+) efflux antiporter 3, chloroplastic |
LOC8078795 | UDP-glycosyltransferase 73C5 |
LOC8084424 | putative cyclic nucleotide-gated ion channel 7 |
LOC8057765 | ankyrin repeat-containing protein NPR4 |
LOC8086217 | UDP-glycosyltransferase 83A1 |
LOC8078619 | IQ domain-containing protein IQM1 |
Gene | Function |
---|---|
LOC8060217 | calmodulin-binding receptor-like cytoplasmic kinase 3 |
LOC8077055 | probable calcium-binding protein CML20 |
LOC8081289 | aquaporin NIP2-2 |
LOC8076978 | gibberellin 20 oxidase 2 |
LOC8076337 | wall-associated receptor kinase 2 |
LOC8073331 | AP2/ERF and B3 domain-containing protein Os01g0141000 |
LOC8061361 | zinc finger protein GIS3 |
LOC8082590 | probable polyamine oxidase 4 |
CRE | Sequence | Gene | Function |
---|---|---|---|
GAREHVAMY1 | GGCCGATAACAAACTCCGGCC | barley alpha-amylase gene (Amy 1/6-4) | GARE (gibberellic acid responsive element) |
GARE4HVEPB1 | GTAACAGAATGCTGG | barley (H.v.) EPB-1 (cysteine proteinase) gene promoter | “GARE-4”; Putative binding site of transcription factor, GAMyB Putative binding site of transcription factor, GAMyB |
GREGIONNTPRB1B | TGGCGGCTCTTATCTCACGTGATG | tobacco (N.t.) PRB-1b gene promoter | promoter Binding site of nuclear protein; Contains a G box motif; Contains TAAGAGCCGCC, which is highly conserved in the promoter of ethylene-induced PR genes |
HY5AT | TGACACGTGGCA | Arabidopsis bZIP protein HY5 | “G box”; HY5 regulates stimulus-induced development of root and hypocotyl |
AUXRETGA2GMGH3 | TGACGTGGC | putative AUXRE E1 of soybean GH3 promoter | “TGA-box #2”; Strong binding site for proteins in plant nuclear extracts; Called G-box by Liu et al. (1997) |
ACIIPVPAL2 | CCACCAACCCCC | bean (P.v.) PAL2 promoter | ACII element; Three AC-elements, which are possible Myb protein binding sites, together with a G-box, interact to direct the complex patterns of tissue-specific expression of pAL2 gene |
TDBA12NTCHN50 | TGACTTTCTGAC | tobacco (N.t.) basic class I chitinase gene (CHN50) | TDBA12 binding site; TDBA12 belongs to WRKY proteins that appear to be unique to plants |
SUREAHVISO1 | AAAACTAAGAAAGACCGATGGAAAA | barley (H. vulgare) iso1 (encoding isoamylase1) promoter | SURE-a; SUSIBA2 (WRKY transcription factor) binding site; Sugar-responsive element found in barley iso1 promoter |
3AF1BOXPSRBCS3 | AAATAGATAAATAAAAACATT | pea (P.s.) rbcS-3A gene | 3AF1 binding site; 3AF1 site includes a GATA motif |
RGATAOS | CAGAAGATA | RTBV promoter | R-GATA (GATA motif binding factor) binding site |
BOX1PVCHS15 | TAAAAGTTAAAAAC | bean (P.v.) chs15 promoter | Box 1; Resemble the binding site for the GT-1 factor in light-responsive elements |
LREBOX2PSRBCS3 | TGTGTGGTTAATATG | pea (P.s.) rbcS-3A gene | GT-1 binding; GT-motif |
RBENTGA3 | TCCAACTTGGA | tobacco (N.t.) GA3 gene promoter | Binding site of RSG (Repression of shoot growth); RSG is a bZIP transcriptional activator |
ABRE2HVA1 | CCTACGTGGCGG | barley (H.v.) HVA1 gene | ABA responsive element, ABRE2; stress response |
ABAREG2 | ATGTACGAAGC | sunflower helianthinin | Motif related to ABA regulation |
REGION1OSOSEM | CGGCGGCCTCGCCACG | rice (O.s.) Osem gene promoter | ABRE-like sequence; Important for regulation by ABA |
ABADESI2 | GGACGCGTGGC | wheat histone H3 | Synthetic element (hex-3) related to response to ABA and to desiccation |
ABRE3OSRAB16 | GTACGTGGCGC | rice (O.s.) rab16 and alpha-amylase genes | ABA-responsive element |
ABRECE3ZMRAB28 | ACGCGCCTCCTC | maize (Z.m.) rab28 gene promoter | ABA responsive element; stress response |
ABRECE3HVA1 | ACGCGTGTCCTC | barley HVA1 gene | ABRC3 (ABA response complex 3) of HVA1 consists of CE3 and A2; ABA responsive element; stress response |
ABREDISTBBNNAPA | GCCACTTGTC | napA gene of Brassica napus (B.n.) | dist B (distal portion of B-box); similarity to ABRE; Required for seed specific expression and ABA responsiveness; |
ABRETAEM | GGACACGTGGC | wheat (T.a.) Em gene | ABRE (ABA responsive element) |
ABREMOTIFIIIOSRAB16B | GCCGCGTGGC | rice (O.s.) rab16B gene | Motif III; Motif I (S000290) and motif III are both required for ABA responsiveness |
ABASEED1 | TGTTACGTGCC | carrot Dc3 | ABA regulation; seed expression |
GBOXRELOSAMY3 | CTACGTGGCCA | Amy3D (amylase) promoter of rice (O.s.) | Similar to ABRE; G box-related element |
TGA1ANTPR1A | CGTCATCGAGATGACG | tobacco (N.t.) PR1a gene | TGA1a binding site; as-1-like sequence |
SRENTTTO1 | TGGTAGGTGAGAT | tobacco (N.t.) retrotransposon Tto1 | Stress responsive element (SRE) in tobacco (N.t.) retrotransposon Tto1; Involved in responsiveness to tissue culture, wounding, methyl jasmonate |
CPRFPCCHS | CCACGTGGCC | parsley (P.c.) light responsive CHS gene promoter | Binding site of CPRF-1, 2, 3, 4(Common Plant Regulatory Factor); CPRF proteins are bZIP class transcription factors |
TCA1MOTIF | TCATCTTCTT | TCA-1 (tobacco nuclear protein 1) | TCA-1 (tobacco nuclear protein 1) binding site; Related to salicylic acid-inducible expression of many genes |
SGBFGMGMAUX28 | TCCACGTGTC | soybean (G.m.) GmAux28 gene promoter | bZIP proteins SGBF-1 and SGBF-2 binding site |
VSF1PVGRP18 | GCTCCGTTG | French bean (P.v.) grp1.8 gene promoter | VSF-1 binding site; VSF-1 is a tomato bZIP transcription factor |
MREATCHS | TCTAACCTACCA | Arabidopsis (A.t.) chalcone synthase (CHS) gene promoter | “MREAtCHS (MRE = Myb Recognition Element)” found in the LRU (light-responsive unit) |
ARELIKEGHPGDFR2 | AGTTGAATGGGGGTGCA | maize anthocyanin promoter | Sequence highly similar to ARE (anthocyanin regulatory element); Binding site of R2R3-type MYB factor |
23BPUASNSCYCB1 | TTTATTTACCAAACGGTAACATC | Nicotiana sylvestris (N.s.) CycB1 gene | 23 bp UAS (Upstream activating sequence); Contains a 5 bp element identical to the MYB binding core (ACGT) |
14BPATERD1 | CACTAAATTGTCAC | erd1 in Arabidopsis | “14 bp region” (from −599 to −566) necessary expression of erd1 (early responsive to dehydration) in dehydrated Arabidopsis |
Gene | Function | Leaf/Root |
---|---|---|
LOC8054237 | peptidyl-prolyl cis-trans isomerase CYP65 | down/up |
LOC8054689 | peptidyl-prolyl cis-trans isomerase CYP20-3, chloroplastic | up/down |
LOC8057395 | peptidyl-prolyl cis-trans isomerase CYP22 | up/up |
LOC8057814 | peptidyl-prolyl cis-trans isomerase CYP18-2 | down/up |
LOC8057995 | peptidyl-prolyl cis-trans isomerase CYP71 | down/up |
LOC8059503 | peptidyl-prolyl cis-trans isomerase CYP28, chloroplastic | up/down |
LOC8060736 | peptidyl-prolyl cis-trans isomerase CYP63 | up/up |
LOC8061594 | peptidyl-prolyl cis-trans isomerase CYP59 | down/up |
LOC8062274 | peptidyl-prolyl cis-trans isomerase CYP19-3 | up/up |
LOC8064962 | peptidyl-prolyl cis-trans isomerase CYP19-4 | down/down |
LOC8064963 | peptidyl-prolyl cis-trans isomerase CYP19-4 | up/down |
LOC8064965 | peptidyl-prolyl cis-trans isomerase CYP20-1 | up/up |
LOC8068384 | peptidyl-prolyl cis-trans isomerase CYP18-1 | down/down |
LOC8070454 | peptidyl-prolyl cis-trans isomerase CYP26-2, chloroplastic | up/up |
LOC8070780 | peptidyl-prolyl cis-trans isomerase CYP40 | down/up |
LOC8070908 | peptidyl-prolyl cis-trans isomerase CYP21-1 | up/up |
LOC8074358 | peptidyl-prolyl cis-trans isomerase CYP23 | up/up |
LOC8078214 | peptidyl-prolyl cis-trans isomerase CYP57 | up/up |
LOC8078906 | peptidyl-prolyl cis-trans isomerase CYP40 | up/up |
LOC8081760 | peptidyl-prolyl cis-trans isomerase CYP37, chloroplastic= | up/down |
LOC8054768 | peptidyl-prolyl cis-trans isomerase FKBP15-1 | up/up |
LOC8059351 | peptidyl-prolyl cis-trans isomerase FKBP15-1 | down/up |
LOC8060566 | peptidyl-prolyl cis-trans isomerase FKBP16-3, chloroplastic | up/up |
LOC8061766 | peptidyl-prolyl cis-trans isomerase FKBP20-1 | up/up |
LOC8062926 | peptidyl-prolyl cis-trans isomerase FKBP17-2, chloroplastic | up/down |
LOC8069313 | peptidyl-prolyl cis-trans isomerase FKBP42 | up/up |
LOC8071644 | peptidyl-prolyl cis-trans isomerase FKBP16-1, chloroplastic | up/down |
LOC8075048 | peptidyl-prolyl cis-trans isomerase FKBP16-4, chloroplastic | down/down |
LOC8075186 | peptidyl-prolyl cis-trans isomerase FKBP12 | up/down |
LOC8076111 | peptidyl-prolyl cis-trans isomerase FKBP17-1, chloroplastic | up/down |
LOC8080368 | peptidyl-prolyl cis-trans isomerase FKBP53 | up/up |
LOC8080618 | peptidyl-prolyl cis-trans isomerase FKBP19, chloroplastic | down/up |
LOC8080695 | peptidyl-prolyl cis-trans isomerase FKBP20-2, chloroplastic | up/up |
LOC8085209 | peptidyl-prolyl cis-trans isomerase FKBP18, chloroplastic | up/down |
LOC8063484 | peptidyl-prolyl cis-trans isomerase FKBP53 | down/up |
LOC8055151 | abscisic acid receptor PYR1 | down/down |
LOC8061804 | abscisic acid receptor PYL4 | up/down |
LOC8065946 | abscisic acid receptor PYL8 | down/down |
LOC8073793 | abscisic acid receptor PYL2 | up/down |
LOC8076724 | abscisic acid receptor PYL2 | down/up |
LOC8078346 | abscisic acid receptor PYL8 | down/up |
LOC8081117 | abscisic acid receptor PYL4 | down/down |
LOC8085416 | abscisic acid receptor PYL5 | down/down |
LOC8064244 | abscisic stress-ripening protein 1 | up/down |
LOC8075331 | abscisic stress-ripening protein 1 | down/up |
LOC8073617 | abscisic stress-ripening protein 2 | up/down |
LOC8075332 | abscisic stress-ripening protein 2 | up/up |
LOC8073983 | abscisic stress-ripening protein 3 | down/up |
LOC8073163 | abscisic acid 8′-hydroxylase 1 | up/down |
LOC8083537 | abscisic acid 8′-hydroxylase 2 | down/up |
LOC8083090 | abscisic acid 8′-hydroxylase 3 | down/up |
LOC8066580 | abscisic acid 8′-hydroxylase 4 | down/down |
LOC8072856 | abscisic acid and environmental stress-inducible protein | down/down |
LOC8062208 | 9-cis-epoxycarotenoid dioxygenase 1, chloroplastic | up/up |
LOC8081132 | 9-cis-epoxycarotenoid dioxygenase 1, chloroplastic | down/down |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, S.; Jeon, D.; Choi, S.; Kang, Y.; Seo, S.; Kwon, S.; Lyu, J.; Ahn, J.; Seo, J.; Kim, C. Expression Profile of Sorghum Genes and Cis-Regulatory Elements under Salt-Stress Conditions. Plants 2022, 11, 869. https://doi.org/10.3390/plants11070869
Lee S, Jeon D, Choi S, Kang Y, Seo S, Kwon S, Lyu J, Ahn J, Seo J, Kim C. Expression Profile of Sorghum Genes and Cis-Regulatory Elements under Salt-Stress Conditions. Plants. 2022; 11(7):869. https://doi.org/10.3390/plants11070869
Chicago/Turabian StyleLee, Solji, Donghyun Jeon, Sehyun Choi, Yuna Kang, Sumin Seo, Soonjae Kwon, Jaeil Lyu, Joonwoo Ahn, Jisu Seo, and Changsoo Kim. 2022. "Expression Profile of Sorghum Genes and Cis-Regulatory Elements under Salt-Stress Conditions" Plants 11, no. 7: 869. https://doi.org/10.3390/plants11070869
APA StyleLee, S., Jeon, D., Choi, S., Kang, Y., Seo, S., Kwon, S., Lyu, J., Ahn, J., Seo, J., & Kim, C. (2022). Expression Profile of Sorghum Genes and Cis-Regulatory Elements under Salt-Stress Conditions. Plants, 11(7), 869. https://doi.org/10.3390/plants11070869