Identification of Stripe Rust Resistance Genes in Common Wheat Cultivars and Breeding Lines from Kazakhstan
Abstract
:1. Introduction
2. Results
2.1. Field Evaluation of Adult Plant Resistance
2.2. Identification of Yr Genes with Molecular Markers and Stripe Rust Resistance in the Sources of Resistance
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.2. Experimental Site
4.3. Field Evaluation of Adult Plant Resistance
4.4. DNA Extraction and Identification of Yr Genes with Molecular Markers
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wellings, C.R. Global status of stripe rust: A review of historical and current threats. Euphytica 2011, 179, 129–141. [Google Scholar] [CrossRef]
- Koyshibaev, M.K. Diseases of Wheat; FAO: Ankara, Turkey, 2018; p. 365. [Google Scholar]
- Kokhmetova, A.M.; Sapakhova, Z.B.; Madenova, A.K.; Esenbekova, G.T. Identification of carriers of genes for resistance to yellow Yr5, Yr10, Yr15 and brown rust Lr26, Lr34 based on molecular screening of wheat samples. Biotech. Theory Pract. 2014, 1, 71–78. [Google Scholar]
- Kokhmetova, A.; Rsaliyev, S.; Atishova, M.; Kumarbayeva, M.; Malysheva, A.; Keishilov, Z.; Zhanuzak, D.; Bolatbekova, A. Evaluation of Wheat Germplasm for Resistance to Leaf Rust (Puccinia triticina) and Identification of the Sources of Lr Resistance Genes Using Molecular Markers. Plants 2021, 10, 1484. [Google Scholar] [CrossRef] [PubMed]
- Kokhmetova, A.A.; Morgounov, S.; Rsaliev, A.; Rsaliev, G.; Yessenbekova, M.; Typina, L. Wheat germplasm screening for stem rust resistance using conventional and Rust resistance in wheat molecular techniques. Czech J. Genet. Plant Breed. 2011, 47, 146–154. [Google Scholar] [CrossRef] [Green Version]
- Kokhmetova, A.; Sharma, R.; Rsaliyev, S.; Galymbek, K.; Baymagambetova, K.; Ziyaev, Z.; Morgounov, A. Evaluation of Central Asian wheat germplasm for stripe rust resistance. Plant Genet. Resour. 2018, 16, 178–184. [Google Scholar] [CrossRef]
- Kokhmetova, A.; Madenova, M.; Purnhauser, L.; Kampitova, G.; Urazaliev, R.; Yessimbekova, M. Identification of leaf rust resistance genes in wheat cultivars produced in Kazakhstan. Cereal Res. Commun. 2016, 44, 240–250. [Google Scholar] [CrossRef] [Green Version]
- Rsaliyev, A.S.; Rsaliyev, S.S. Principal approaches and achievements in studying race composition of wheat stem rust. Vavilov J. Genet. Breed. 2018, 22, 967–977. [Google Scholar] [CrossRef]
- Kokhmetova, A.M.; Ali, S.; Sapakhova, Z.; Atishova, M.N. Identification of genotypes-carriers of resistance to tan spot Ptr ToxA and Ptr ToxB of Pyrenophora tritici-repentis in common wheat collection. Vavilov J. Genet. Breed. 2018, 22, 978–986. [Google Scholar] [CrossRef]
- Kokhmetova, A.; Kremneva, O.; Volkova, G.; Atishova, M.; Sapakhova, Z. Evaluation of wheat cultivars growing in Kazakhstan and Russia for resistance to tan spot. J. Plant Pathol. 2017, 99, 161–167. [Google Scholar] [CrossRef]
- Kokhmetova, A.M.; Atishova, M.N.; Madenova, A.K.; Kumarbayeva, M.T. Genotyping of wheat germplasm for resistance to toxins of tan spot Pyrenophora tritici-repentis. J. Biotechnol. 2019, 305, S53. [Google Scholar] [CrossRef]
- Kokhmetova, A.M.; Kovalenko, N.M.; Kumarbaeva, M.T. Pyrenophora tritici-repentis population structure in the Republic of Kazakhstan and identification of wheat germplasm resistant to tan spot. Vavilov J. Genet. Breed. 2020, 24, 722–729. [Google Scholar] [CrossRef] [PubMed]
- Kokhmetova, A.; Sehgal, D.; Ali, S.; Atishova, M.; Kumarbayeva, M.; Leonova, I.; Dreisigacker, S. Genome-Wide Association Study of Tan Spot Resistance in a Hexaploid Wheat Collection from Kazakhstan. Front. Genet. 2021, 11, 581214. [Google Scholar] [CrossRef]
- Kokhmetova, A.; Kumarbayeva, M.; Atishova, M.; Nehe, A.; Riley, I.T.; Morgounov, A. Identification of high-yielding wheat genotypes resistant to Pyrenophora tritici-repentis (tan spot). Euphytica 2021, 217, 97. [Google Scholar] [CrossRef]
- Kokhmetova, A.A.; Chen, X.M.; Rsaliyev, S.S. Identification of Puccinia striiformis f.sp. tritici, characterization of wheat cultivars for resistance, and inheritance of resistance to stripe rust in Kazakhstan wheat cultivars. Asian Australas. J. Plant Sci. Biotechnol. 2010, 4, 64–70. [Google Scholar]
- Chen, X.M. Epidemiology and control of stripe rust (Puccinia striiformis f. sp. tritici) on wheat. Can. J. Plant Pathol. 2005, 27, 314–337. [Google Scholar] [CrossRef]
- Hu, X.; Cao, S.; Xu, X. Predicting overwintering of wheat stripe rust in central and north-western China. Plant Dis. 2020, 104, 44–51. [Google Scholar] [CrossRef] [PubMed]
- Yahaoui, A. Management of yellow rust in Central, Western Asia and Caucasus countries. Newsl. CIMMYT 2003, 2, 113–116. [Google Scholar]
- Absattarova, A.; Baboev, S.; Bulatova, K.; Karabayev, M.; Koishibayev, M.; Kokhmetova, A.; Kuklacheva, V.; Morgounov, A.; Rsaliev, S.; Sarbayev, A.; et al. Improvement of wheat yellow rust resistance in Kazakhstan and Uzbekistan through sub-regional co-operation. In Meeting the Challenge of Yellow Rust in Cereal Crops; Johnson, R., Yahyaoui, A., Wellings, C., Saidi, A., Ketata, H., Eds.; ICARDA: Aleppo, Syria, 2002; pp. 34–41. [Google Scholar]
- Sharma, R.; Rajaram, S.; Alikulov, S.; Ziyaev, Z.; Hazratkulova, S.; Khodarahami, M.; Nazeri, M.; Belen, S.; Khalikulov, Z.; Mosaad, M.; et al. Improved winter wheat germplasm for Central and West Asia. Euphytica 2013, 190, 19–31. [Google Scholar] [CrossRef]
- Morgounov, A.; Tufan, H.A.; Sharma, R.; Akin, B.; Bagci, A.; Braun, H.J.; Kaya, Y.; Keser, M.; Payne, T.S.; Sonder, K.; et al. Global incidence of wheat rusts and powdery mildew during 1969–2010 and durability of resistance of winter wheat variety Bezostaya 1. Eur. J. Plant Pathol. 2013, 132, 323–340. [Google Scholar] [CrossRef]
- Ziyaev, Z.M.; Sharma, R.C.; Nazari, K.; Morgounov, A.I.; Amanov, A.A.; Ziyadullaev, Z.F.; Khalikulov, Z.I.; Alikulov, S.M. Improving wheat stripe rust resistance in Central Asia and the Caucasus. Euphytica 2011, 179, 197–207. [Google Scholar] [CrossRef]
- Sharma, R.C.; Morgounov, A.; Akin, B.; Bespalova, L.; Lang, L.; Litvinenko, M.; Mustatea, P.; Ozturk, I.; Postolatiy, A.; Rajaram, S.; et al. Winter wheat East European Regional Yield Trial: Identification of superior genotypes and characterization of environments. Crop Sci. 2014, 54, 2469–2480. [Google Scholar] [CrossRef]
- Sharma, R.C.; Nazari, K.; Amanov, A.; Ziyaev, Z.; Jalilov, A. Reduction of winter wheat yield losses caused by stripe rust through fungicide management. J. Phytopathol. 2016, 164, 671–677. [Google Scholar] [CrossRef] [Green Version]
- McIntosh, R.A.; Yamazaki, Y.; Dubcovsky, J.; Rogers, W.J.; Morris, C.; Appel, R.; Xia, X.C. Catalogue of Gene Symbols for Wheat, Supplement. 2017. Available online: https://shigen.nig.ac.jp/wheat/komugi/genes/macgene/supplement2017.pdf (accessed on 16 June 2020).
- Sharma-Poudyal, D.; Chen, X.M.; Wan, A.M.; Zhan, G.M.; Kang, Z.S.; Cao, S.Q.; Jin, S.L.; Morgounov, A.; Akin, B.; Mert, Z.; et al. Virulence Characterization of International Collections of the Wheat Stripe Rust Pathogen, Puccinia striiformis f. sp. tritici. Plant Dis. 2013, 97, 379–386. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Krattinger, S.G.; Sucher, J.; Selter, L.L.; Chauhan, H.; Zhou, B.; Tang, M.Z.; Upadhyaya, N.M.; Mieulet, D.; Guiderdoni, E.; Weidenbach, D. The wheat durable, multipathogen resistance gene Lr34 confers partial blast resistance in rice. Plant Biotechnol. J. 2016, 14, 1261–1268. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Macer, R.C.F. The Formal and Monosomic Genetic Analysis of Stripe Rust (Puccinia striiformis) Resistance in Wheat. In Proceedings of the Second International Wheat Genetics Symposium; MacKey, J., Ed.; Sweeden: Lund, Sweden, 1966; pp. 127–142. [Google Scholar]
- Law, C.N. Genetic control of yellow rust resistance in Triticum spelta album, Plant Breeding Institute, Cambridge. Annu. Rep. 1975, 1976, 108–109. [Google Scholar]
- Wellings, C.R.; McIntosh, R.A. Puccinia striiformis f.sp. tritici in Australasia: Pathogenic change during the first 10 years. Plant Pathol. 1990, 39, 316–325. [Google Scholar] [CrossRef]
- Nagarajan, S.; Nayar, S.K.; Bahadur, P. Race 13 (67S8) virulent on Triticum spelta var. album in India. Plant Dis. 1986, 70, 173. [Google Scholar] [CrossRef]
- Wang, L.F.; Ma, J.X.; Zhou, R.H.; Wang, X.M.; Jia, J.Z. Molecular tagging of the yellow rust resistance gene Yr10 in common wheat, P.I.178383 (Triticm aestivum L.). Euphytica 2002, 124, 71–73. [Google Scholar] [CrossRef]
- Metzger, R.J.; Silbaugh, B.A. Inheritance of resistance to stripe rust and its association with glume colour in Triticum aestivum L. Crop Sci. 1970, 10, 567–568. [Google Scholar] [CrossRef]
- Payne, P.; Holt, L.; Johnson, R.; Snape, J. Linkage mapping of four gene loci, Glu-B1, Gli-B1, Rg1 and Yr10 on chromosome 1B of bread wheat. Genet. Agraria. 1986, 40, 231–242. [Google Scholar]
- Bariana, S.; Brown, G.N.; Ahmed, N.U.; Khatkar, S.; Conner, R.L.; Wellings, C.R. Characterization of Triticum vavilovii derived stripe rust resistance using genetic, cytogenetic and molecular analyses and its marker-assisted selection. Theor. Appl. Genet. 2002, 104, 315–320. [Google Scholar] [CrossRef]
- Mukhtar, S.; Khan, M.A.; Paddar, B.A.; Anjum, A.; Zaffar, G.; Mir, S.A.; Naseer, S.; Bhat, M.A.; Kamaluddin, M. Molecular characterization of wheat germplasm for stripe rust resistance genes (Yr5, Yr10, Yr15 & Yr18) and identification of candidate lines for stripe rust breeding in Kashmir. Indian J. Biotechnol. 2015, 14, 241–248. [Google Scholar]
- Ullah, N.; Ali, N.; Iqbal, M.; Aziz-ud-Din, K.; Hussain, S.; Inayat, U.R.; Ahmad, H. Markers assisted selection for multiple stripe rust resistance genes in spring bread wheat lines. Int. J. Biol. 2016, 8, 63–74. [Google Scholar]
- Safavi, S.; Afshari, F.; Yazdansepas, A. Effective and ineffective resistance genes to wheat yellow rust during six years monitoring in Ardabil. Arch. Phytopathol. Plant Prot. 2013, 46, 774–780. [Google Scholar] [CrossRef]
- Chatrath, R.; Mishra, B.; Ortiz-Ferrara, G.; Singh, S.K.; Joshi, A.K. Challenges to wheat production in South Asia. Euphytica 2007, 157, 447–456. [Google Scholar] [CrossRef]
- Gerechter-Amitai, Z.K.; Van Silfhout, C.H.; Grama, A.; Kleitman, F. Yr15: A new gene for resistance to Puccinia striiformis in Triticum dicoccoides sel. G-25. Euphytica 1989, 43, 187–190. [Google Scholar] [CrossRef]
- Sun, F.L.; Dean, W.L.; Kelsey, G.; Allen, N.D.; Reik, W. Transactivation of Igf2 in a mouse model of Beckwith-Wiedemann syndrome. Nature 1997, 389, 809–815. [Google Scholar] [CrossRef]
- Chen, X.M. Challenges and solutions for stripe rust control in the United States. Aust. J. Agric. 2007, 58, 648–655. [Google Scholar] [CrossRef]
- Chen, X.; Kang, Z. Stripe Rust; Springer Science+Business Media, B.V.: Berlin, Germany, 2017. [Google Scholar]
- McIntosh, R.A.; Wellings, C.R.; Park, R.F. Wheat Rusts: An Atlas of Resistance Genes; CSIRO: Canberra, Australia, 1995; pp. 234–237.
- Milus, E.A.; Lee, K.D.; Brown-Guedira, G. Characterization of Stripe Rust Resistance in Wheat Lines with Resistance Gene Yr17 and Implications for Evaluating Resistance and Virulence. Phytopathology 2015, 105, 1123–1130. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bariana, H.S.; McIntosh, R. ACytogenetic studies in wheat. XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A. Genome 1993, 36, 476–482. [Google Scholar] [CrossRef] [PubMed]
- Helguera, M.; Khan, I.A.; Kolmer, J.; Lijavetzky, D.; Zhong-qi, L.; Dubcovsky, J. PCR assays for the Lr37-Yr17-Sr38 cluster of rust resistance genes and their use to develop isogenic hard red spring wheat lines. Crop Sci. 2003, 43, 1839–1847. [Google Scholar] [CrossRef]
- Krattinger, S.G.; Lagudah, E.S.; Spielmeyer, W.; Singh, R.P.; Huerta-Espino, J.; McFadden, H.; Bossolini, E.; Selter, L.L.; Keller, B. A putative ABC transporter confers durable resistance to multiple fungal pathogens in wheat. Science 2009, 323, 1360–1363. [Google Scholar] [CrossRef] [Green Version]
- Kolmer, J.A.; Singh, R.P.; Garvin, D.F.; Viccars, L.; William, H.M.; Huerta-Espino, J.; Ogbonnaya, F.C.; Raman, H.; Orford, S.; Bariana, E.S.; et al. Analysis of the Lr34/Yr18 rust resistance region in wheat germplasm. Crop Sci. 2008, 48, 1841–1852. [Google Scholar] [CrossRef] [Green Version]
- Smith, P.H.; Hadifield, J.; Hart, N.J.; Koebner, R.M.D.; Boyd, L.A. STS markers for the wheat yellow rust resistance gene Yr5 suggest a NBS-LRR-type resistance gene cluster. Genome 2007, 50, 259–265. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Soria, M.A.; Yan, G.; Sun, J.; Dubcovsky, J. Development of sequence tagged site and cleaved amplified polymorphic sequence markers for wheat stripe rust resistance gene Yr5. Crop Sci. 2003, 43, 2058–2064. [Google Scholar] [CrossRef]
- Elkot, M.; Mohammed, H. Abd El-Aziz. Molecular Identification of Some Stem Rust and Yellow Rust Resistance Genes in Egyptian Wheat and Some Exotic Genotypes. Ass. J. Agric. Sci. 2016, 47, 124–135. [Google Scholar]
- Shao, Y.T.; Niu, Y.C.; Zhu, L.H.; Zhai, W.X.; Xu, S.C.; Wu, L.R. Identification of an AFLP marker linked to the stripe rust resistance gene Yr10 in wheat. Chin. Bull. 2001, 46, 1466–1469. [Google Scholar] [CrossRef]
- Sun, G.L.; Fahima, T.; Korol, A.B.; Turpeinen, T.; Grama, A. Identification of molecular markers linked to the Yr15 stripe rust resistance gene of wheat originated in wild emmer wheat, Triticum dicoccoides. Theor. Appl. Genet. 1997, 95, 622–628. [Google Scholar] [CrossRef]
- Peng, J.H.; Fahima, T.; Roeder, M.S.; Huang, Q.Y.; Dahan, A.; Li, Y.C.; Grama, A.; Nevo, E. Highdensity molecular map of chromosome region harboring stripe-rust resistance genes YrH52 and Yr15 derived from wild emmer wheat, Triticum dicoccoides. Genetica 2000, 109, 199–210. [Google Scholar] [CrossRef] [PubMed]
- Murphy, L.R.; Santra, D.; Kidwell, K.; Yan, G.P.; Chen, X.M.; Garland Campbell, K. A Linkage maps of wheat stripe rust resistance genes Yr5 and Yr15 for use in marker-assisted selection. Crop Sci. 2009, 49, 1786–1790. [Google Scholar] [CrossRef] [Green Version]
- Lagudah, E.S.; McFadden, H.; Singh, R.P.; Huerta-Espino, J.; Bariana, H.S.; Spielmeyer, W. Molecular genetic characterization of the Lr34/Yr18 slow rusting resistance gene region in wheat. Theor. Appl. Genet. 2006, 114, 21–30. [Google Scholar] [CrossRef]
- Morgounov, A.; Akin, B.; Demir, L.; Keser, M.; Kokhmetova, A.; Martynov, S.; Orhan, Ş.; Özdemir, F.; Özseven, İ.; Sapakhova, Z.; et al. Yield gain due to fungicide application in varieties of winter wheat (Triticum aestivum) resistant and susceptible to leaf rust. Crop Pasture Sci. 2015, 66, 649–659. [Google Scholar] [CrossRef] [Green Version]
- Singh, R.P.; Huerta-Espino, J.; Rajaram, S. Achieving near-immunity to leaf and stripe rusts in wheat by combining slow rusting resistance genes. Acta Phytopathol. Entomol. Hung. 2000, 35, 133–139. [Google Scholar]
- Olson, E.L.; Brown-Guedira, G.; Marshall, D.S.; Jin, Y.; Mergoum, M.; Lowe, I.; Dubcovsky, J. Genotyping of US wheat germplasm for presence of stem rust resistance genes Sr24, Sr36 and Sr1RSAmigo. Crop Sci. 2010, 50, 668–675. [Google Scholar] [CrossRef] [Green Version]
- Huang, L.; Xiao, X.Z.; Liu, B.; Gao, L.; Gong, G.S.; Chen, W.Q.; Zhang, M.; Liu, T.G. Identification of Stripe Rust Resistance Genes in Common Wheat Cultivars from the Huang-Huai-Hai Region of China. Plant Dis. 2020, 104, 1763–1770. [Google Scholar] [CrossRef]
- Tabassum, S.; Ashraf, M.; Chen, X.M. Evaluation of Pakistan wheat germplasms for stripe rust resistance using molecular markers. Sci. China Life Sci. 2010, 53, 1123–1134. [Google Scholar] [CrossRef]
- Zheng, S.; Li, Y.; Lu, L. Evaluating the contribution of Yr genes to stripe rust resistance breeding through marker-assisted detection in wheat. Euphytica 2017, 213, 50. [Google Scholar] [CrossRef]
- Haque, A.; Shaheen, T.; Gulzar, T.; Rahman, M.U.; Jalal, F.; Sattar, S.; Ehsan, B.; Iqbal, Z.; Younas, M. Study of rust resistance genes in wheat germplasm with DNA markers. Bioinformation 2014, 10, 371–377. [Google Scholar] [CrossRef]
- Wan, A.M.; Zhao, Z.H.; Chen, X.M.; He, Z.H.; Jin, S.L.; Jia, Q.Z.; Yao, G.; Yang, J.X.; Wang, B.T.; Li, G.B.; et al. Wheat stripe rust epidemic and virulence of Puccinia striiformis f. sp. tritici in China in 2002. Plant Dis. 2004, 88, 896–904. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bux, H.; Ashraf, M.; Hussain, F.; Rattu, A.U.R.; Fayyaz, M. Characterization of wheat germplasm for stripe rust (Puccinia striiformis f. sp. tritici) resistance. Aust. J. Crop Sci. 2012, 6, 116–120. [Google Scholar]
- Afshari, F. Prevalent pathotypes of Puccinia striiformis f. sp. Tritici in Iran. J. Agric. Sci. Technol. 2008, 10, 67–78. [Google Scholar]
- Zeybek, A.; Yigit, F. Determination of virulence genes frequencies in wheat stripe rust (Puccinia striiformis f. sp. tritici) populations during natural epidemics in the regions of Southern Aegean and Western Mediterranean in Turkey. Pak. J. Biol. Sci. 2004, 7, 1967–1971. [Google Scholar]
- Yan, G.P.; Chen, X.M.; Line, R.F.; Wellings, C.R. Resistance gene-analog polymorphism markers co-segregating with the Yr5 gene for resistance to wheat stripe rust. Theor. Appl. Genet. 2003, 106, 636–643. [Google Scholar] [CrossRef] [PubMed]
- Yessenbekova, G.T.; Kokhmetova, A.M.; Kampitova, G.A.; Radivoje, J. Sources and Donors for Soft Wheat Selection by Resistance to Yellow Rust. Biosci. Biotechnol. Res. Asia 2016, 13, 693–700. [Google Scholar] [CrossRef]
- Koishybaev, M.K.; Zhanarbekova, A.B.; Kokhmetova, A.M.; Rsaliev, S.S. Genetic study of wheat resistance to leaf rust. Bull. Natl. Acad. Sci. Kazakhstan 2010, 6, 10–15. [Google Scholar]
- Gultyaeva, E.I. Methods for the Identification of Genes for Resistance of Wheat to Leaf Rust Using DNA Markers and Characteristics of Effective Lr Genes; VIZR: Saint-Petersburg, Russia, 2012; p. 71. [Google Scholar]
- Madenova, A.; Kokhmetova, A.; Kampitova, G.; Atishova, M.; Purnhauser, L. Identification of the Carriers of Genes for Resistance to Wheat Leaf Rust Using Molecular Markers. Biosci. Biotechnol. Res. Asia 2015, 1683–1690. [Google Scholar] [CrossRef]
- Singh, P.K.; Singh, S.; Deng, Z.; He, X.; Kehel, Z.; Singh, R.P. Characterization of QTLs for seedling resistance to tan spot and septoria nodorum blotch in the PBW343/kenya nyangumi wheat recombinant inbred lines population. Int. J. Mol. Sci. 2019, 20, 5432. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Genievskaya, Y.; Turuspekov, Y.; Rsaliyev, A.; Abugalieva, S. Genome-wide association mapping for resistance to leaf, stem, and yellow rusts of common wheat under field conditions of South Kazakhstan. PeerJ 2020, 8, e9820. [Google Scholar] [CrossRef]
- Dospekhov, B.A. Methods of Field Experience (With the Basics of Statistical Processing of Research Results), 5th ed.; Kolos: Kovalivka, Ukraine, 1985. [Google Scholar]
- Roelfs, A.P.; Singh, R.P.; Saari, E.E. Rust Diseases of Wheat: Concept and Methods of Disease Management; CIMMYT: Mexico, DF, USA, 1992. [Google Scholar]
- Peterson, R.F.; Champbell, A.B.; Hannah, A.E. A diagramatic scale for estimating rust intensity of leaves and stem of cereals. Can. J. Res. 1948, 26, 496–500. [Google Scholar] [CrossRef]
- Stubbs, R.W.; Prescott, J.M.; Saari, E.E.; Dubin, H.J. Cereal Disease Methodology Manual; CIMMYT: Mexico, DF, USA, 1986; p. 46. [Google Scholar]
- R Core Team. R: A Language and Environment for Statistical Computing; The R Foundation for Statistical Computing: Vienna, Austria, 2018; Available online: http://www.R-project.org/ (accessed on 20 October 2021).
- Riede, C.R.; Anderson, J.A. Linkage of RFLP markers to an aluminum tolerance gene in wheat. Crop Sci. 1996, 36, 905–909. [Google Scholar] [CrossRef]
- Disease Resistance. Stripe Rust Yr15. Available online: https://maswheat.ucdavis.edu/protocols/Yr15 (accessed on 20 October 2021).
- Chen, X.; Line, R.; Leung, H. Genome scanning for resistance-gene analogs in rice, barley, and wheat by high-resolution electrophoresis. Theor. Appl. Genet. 1998, 97, 345–355. [Google Scholar] [CrossRef]
Cat # | Cultivar/Line Name | Origin a | Yellow Rust Severity %, RT b | Molecular Marker Test c | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
2019 | 2020 | S19M93 | S23M14 | STS 9/10 | Yr10 SCAR | Xpsp 3000 | Xbarc8 | Xgwm413 | csLV34 | VENTRIUP/LN2 | Yr Gene Detected Based on Linked Marker | |||
1 | Naz/GF55-1 | KZ:Almaty-KIZ | 40S | 40MS | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | - |
2 | Almaly/GF70 | KZ:Almaty-KIZ | 30MS | 20MS | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | Yr18 |
3 | 425/GF55-1 | KZ:Almaty-KIZ | 20MS | 30MS | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | Yr15, Yr18 |
4 | Kupava/YR5/6/Avocet ‘S’ | KZ:Almaty-KIZ | 30MS | 20MS | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | Yr5 |
5 | Adir/YR2 | KZ:Almaty-KIZ | 10MR | 10MR | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | Yr10 |
6 | Sanzar8/BWKLDN9 | KZ:Almaty-KIZ | 50S | 40S | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
7 | Viza/Zhenis | KZ:Almaty-KIZ | 10MR | 10MR | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | Yr10 |
8 | 1777Darya/#72Tungysh | KZ:Almaty-KIZ | 30MS | 40MS | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
9 | 114Novosibirskaya-22/Omskaya37/28 | KZ:Almaty-KIZ | 10MR | 0 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 1 | 1 | Yr5, Yr17, Yr18 |
10 | 1777Darya/Tungysh-1 | KZ:Almaty-KIZ | 30MS | 40MS | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
11 | 1777Darya/Tungysh-2 | KZ:Almaty-KIZ | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
12 | 1777Darya/Tungysh-3 | KZ:Almaty-KIZ | 30S | 40S | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
13 | 1777Darya/1724F1-1581/807F4/Naz/Umanka/ Almaly/ Zimorodok-1 | KZ:Almaty-KIZ | 15R | 20MR | 1 | 1 | 1 | 1 | 1 | 0 | 0 | 1 | 0 | Yr5, Yr10, Yr18 |
14 | 1777Darya/1724F1-1581/807F4/Naz/Umanka/ Almaly/Zimorodok-2 | KZ:Almaty-KIZ | 10MR | 0 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | Yr5 |
15 | 12/1613MP-2011/1027/AVS/ Ulugbek600 /Egemen | KZ:Almaty-KIZ | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
16 | 1017/103f3/N91/5353/Egemen-1 | KZ:Almaty-KIZ | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
17 | 1017/103f3/N91/5353/Egemen-2 | KZ:Almaty-KIZ | 50S | 40S | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
18 | 1011/94f3/N23/Knyazhna/Naz-1 | KZ:Almaty-KIZ | 30MS | 40MS | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
19 | 1011/94f3/N23/Knyazhna/Naz-2 | KZ:Almaty-KIZ | 20MS | 30MS | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
20 | 1010/93f3/N23/Kupava/Mereke70-1 | KZ:Almaty-KIZ | 10MR | 10MR | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | Yr5, Yr18 |
21 | 1010/93f3/N23/Kupava/Mereke70-2 | KZ:Almaty-KIZ | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
22 | Rils Almaly/Anza | KZ:Almaty-KIZ | 15MS | 30MS | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
23 | 5-ICARDA-IPBB-2013 | IWWIP-ICARDA-CIMMYT | 5R | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | Yr10 |
24 | 5221/Almaly | KZ:Almaty-KIZ | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
25 | Naz/GF66/Ulugbek600-1 | KZ:Almaty-KIZ | 30S | 30MS | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
26 | Naz/GF66/Ulugbek600-2 | KZ:Almaty-KIZ | 30S | 40MS | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
27 | Naz/Immun78/MK3750 | KZ:Almaty-KIZ | 10R | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
28 | Almaly/YR4/Naz | KZ:Almaty-KIZ | 10MR | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | Yr10 |
29 | RILS-F9 Almaly/Avoset ‘S’ | KZ:Almaty-KIZ | 10MR | 5MR | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | Yr15 |
30 | Naz/GF55-2 | KZ:Almaty-KIZ | 5R | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 0 | 0 | Yr10, Yr15 |
31 | Bogarnaya56/5515/K-47100-Romania | KZ:Almaty-KIZ | 70S | 90S | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
32 | Taza/MK 3750-1 | KZ:Almaty-KIZ | 20MR | 10MR | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | Yr10 |
33 | Taza/MK 3750-2 | KZ:Almaty-KIZ | 5MR | 10MR | 1 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | Yr5, Yr10 |
34 | Naz/GF55-3 | KZ:Almaty-KIZ | 20MS | 10MS | 1 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | Yr5, Yr10 |
35 | Almaly/GF92 | KZ:Almaty-KIZ | 30S | 40MS | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | Yr18 |
36 | 428/MK-122A | KZ:Almaty-KIZ | 10MR | 10MS | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | Yr10 |
37 | Naz/GF55-4 | KZ:Almaty-KIZ | 20MR | 20MS | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | Yr10 |
38 | 425/Renan | KZ:Almaty-KIZ | 30MS | 50MS | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | Yr17 |
39 | 425/GF55-2 | KZ:Almaty-KIZ | 20MS | 20MR | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | Yr10 |
40 | Almaly/GF70/2 | KZ:Almaty-KIZ | 30MS | 20MS | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | Yr15 |
41 | #23/Kupava-5 | KZ:Almaty-KIZ | 10R | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | Yr15 |
42 | #23/Kupava-7 | KZ:Almaty-KIZ | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 0 | 0 | Yr10, Yr15 |
43 | #23/Kupava-10 | KZ:Almaty-KIZ | 30S | 30MS | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
44 | #23/Kupava-12 | KZ:Almaty-KIZ | 5R | 0 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | Yr5 |
45 | #23/Kupava-16 | KZ:Almaty-KIZ | 10MR | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | Yr10 |
46 | #23/Kupava-24 | KZ:Almaty-KIZ | 5R | 0 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | Yr5, Yr10 |
47 | 1010/93/#23/Kupava/ Mereke/Naz | KZ:Almaty-KIZ | 0 | 0 | 1 | 0 | 1 | 1+0 | 0 | 0 | 0 | 0 | 0 | Yr10yr10 |
48 | 807-2011/Babax1/907/Almaly 29266/Sultan2 | KZ:Almaty-KIZ | 30MS | 10MS | 0 | 0 | 0 | 1+0 | 0 | 0 | 0 | 0 | 0 | Yr10yr10 |
49 | Almaly/YR18 | KZ:Almaty-KIZ | 10R | 0 | 0 | 0 | 0 | 1+0 | 0 | 0 | 0 | 0 | 0 | Yr10yr10 |
50 | 1596-2#23/Kupava/ Ulugbek/YR4/Mereke/T.Spelta-YR5-1 | KZ:Almaty-KIZ | 5R | 10MR | 1 | 0 | 0 | 0 | 0 | 1+0 | 0 | 0 | 0 | Yr15yr15 |
51 | 1596-3#23/Kupava/ Ulugbek/YR4/Mereke /T. Spelta-YR5-1 | KZ:Almaty-KIZ | 10MR | 20MR | 1 | 0 | 0 | 1+0 | 0 | 0 | 0 | 0 | 0 | Yr10yr10 |
52 | Adir | KG | 20MR | 10MR | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | Yr10 |
53 | Keremet | KZ: KIZ | 5R | 10MR | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | Yr15 |
54 | Karasay | KZ: KIZ | 10R | 15MR | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 1 | 0 | Yr10, Yr18 |
55 | Umanka | RU | 40MS | 30MS | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
56 | Kyzylbiday | KZ: KIZ | 40MS | 30S | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
57 | Sanzar8 | UZ | 70S | 50S | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
58 | Mereke70 | KZ: KIZ | 20MR | 10MR | 1 | 1 | 1 | 1 | 1 | 0 | 0 | 1 | 0 | Yr5, Yr10, Yr18 |
59 | Yuzhnaya12 | KZ: KIZ | 50S | 40S | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | – |
60 | Matay | KZ: KIZ | 20MS | 20MR | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | Yr10 |
61 | Naz | KZ: KIZ | 10MR | 20MR | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | Yr10 |
62 | Nureke | KZ: KIZ | 20MR | 10MR | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | Yr18 |
63 | Dinara | KZ:Almaty-KIZ | 10MR | 20MR | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | Yr5 |
64 | Kupava | RU | 20MS | 30MS | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | Yr18 |
65 | Sultan2 | KZ: KIZ | 10MR | 5MR | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | Yr10 |
66 | Tungysh | KZ: KIZ | 5MR | 10R | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | Yr5 |
67 | Taza | KZ: KIZ | 15MR | 20MR | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | Yr5 |
68 | Intensivnaya | KZ: KIZ | 10MS | 20MR | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | Yr10 |
69 | Zimorodok | RU | 10MR | 20MS | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | Yr5 |
70 | Almaly | KZ: KIZ | 20MR | 20MS | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | Yr18 |
71 | Morocco | MAROCCO | 80S | 90S | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | - |
71 | Avocet S*6/Yr5 | AUSTRALIA | 5R | 0 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | Yr5 |
72 | Avocet S*6/Yr10 | AUSTRALIA | R | 10R | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | Yr10 |
73 | Avocet S*6/Yr15 | AUSTRALIA | 5R | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | Yr15 |
74 | YR17/LR37/NIL-LR37/TC-6/VPM-RL6081 | AUSTRALIA | 10MS | 25MS | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | Yr17 |
75 | YR18/NIL-LR34/TC-6/PI58548 | AUSTRALIA | 10MR | 10MS | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | Yr18 |
76 | Avocet S | AUSTRALIA | 90S | 90S | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | - |
Gene | Marker Type | Primer Name | Primer Sequence (5′-3′) | Annealing Temp. (°C) | Fragment Size (bp) | Reference |
---|---|---|---|---|---|---|
Yr5 | STS | S19M93 | TAATTGGGACCGAGAGACG TTCTTGCAGCTCCAAAACCT | 62 | 100 | [50] |
Yr5 | STS | S23M41 | TCAACGGAACCTCCAATTTC AGGTAGGTGTTCCAGCTTGC | 58 | 275 | [50] |
Yr5 | STS | Yr5STS-9/10 | AAA GAA TAC TTT AAT GAA3 CAA ACT TAT CAG GAT TAC3 | 60 | +289 −182 | [51] |
Yr10 | SSR | Xpsp3000 | GCAGACCTGTGTCATTGGTC GATATAGTGGCAGCAGCAGGATAC | 55 | +260 −240 | [32] |
Yr10 | SCAR | Yr10SCAR | CTG CAG AGT GAC ATC ATA CA TCG AAC TAG TAG ATG CTG GC | 55 | 200 +180 | [53] |
Yr15 | SSR | Xbarc8 | GCG GGA ATC ATG CAT AGG AAA ACA GAA GCG GGG GCG AAA CAT ACA CAT AAA AAC A | 60 | +250 −280 | [83] |
Yr15 | SSR | Xgwm413 | TGCTTGTCTAGATTGCTTGGG GATCGTCTCGTCCTTGGCA | 60 | 96 | [55] |
Yr17/Lr37/Sr38 | SCAR | VENTRIUP/LN2 | AGG GGC TAC TGA CCA AGG CT TGC AGC TAC AGC AGT ATG TAC ACA AAA | 65 | 262 | [57] |
Yr18/Lr34 | STS | csLV34 | GTT GGT TAA GAC TGG TGA TGG TGC TTG CTA TTG CTG AAT AGT | 60 | +150 −229 | [47] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kokhmetova, A.; Rsaliyev, A.; Malysheva, A.; Atishova, M.; Kumarbayeva, M.; Keishilov, Z. Identification of Stripe Rust Resistance Genes in Common Wheat Cultivars and Breeding Lines from Kazakhstan. Plants 2021, 10, 2303. https://doi.org/10.3390/plants10112303
Kokhmetova A, Rsaliyev A, Malysheva A, Atishova M, Kumarbayeva M, Keishilov Z. Identification of Stripe Rust Resistance Genes in Common Wheat Cultivars and Breeding Lines from Kazakhstan. Plants. 2021; 10(11):2303. https://doi.org/10.3390/plants10112303
Chicago/Turabian StyleKokhmetova, Alma, Aralbek Rsaliyev, Angelina Malysheva, Makpal Atishova, Madina Kumarbayeva, and Zhenis Keishilov. 2021. "Identification of Stripe Rust Resistance Genes in Common Wheat Cultivars and Breeding Lines from Kazakhstan" Plants 10, no. 11: 2303. https://doi.org/10.3390/plants10112303
APA StyleKokhmetova, A., Rsaliyev, A., Malysheva, A., Atishova, M., Kumarbayeva, M., & Keishilov, Z. (2021). Identification of Stripe Rust Resistance Genes in Common Wheat Cultivars and Breeding Lines from Kazakhstan. Plants, 10(11), 2303. https://doi.org/10.3390/plants10112303