Integrated Approaches to Reveal Genes Crucial for Tannin Degradation in Aureobasidium melanogenum T9
Abstract
:1. Introduction
2. Materials and Methods
2.1. Regents and Instruments
2.2. Strains, Plasmids, and Media
2.3. Isolation, Phylogenetic Analyses of Tannin-Degrading Yeast Strain
2.4. Tannic Acid Tolerance Analyses by A. melanogenum T9
2.5. Gene Expression Level Analyses with qRT-PCR Assay
2.6. Proteins Expression Level Analyses with Label-Free Technology Mass Spectrometry-Based Label-Free Quantitative Proteomics
2.7. Genes Function Analyses by Construction of Mutant Strains
2.8. GAD and Different Tananses Proteins Analyses with Bioinformatics Method
2.9. Statistical Analyses
3. Result
3.1. A. melanogenum T9 Having the Ability of Tannic Acid Degradation
3.2. Analyses of Tannin Tolerance by A. melanogenum T9
3.3. A. melanogenum T9 Growth Process Analyses with Tannic Acid as the Sole Carbon Course
3.4. Bioinformatics Analyses of Tannases and GAD
3.5. Tannic Acid Induced Related Genes Expression Up-Regulation
3.6. tanA and tanB Having Sililar Function on the Tannic Acid Metabolizing
3.7. Gad Was Crucial for on the Tannic Acid Metabolizing and Growth
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Chi, Z.; Wang, F.; Chi, Z.; Yue, L.; Liu, G.; Zhang, T. Bioproducts from Aureobasidium pullulans, a biotechnologically important yeast. Appl. Microbiol. Biotechnol. 2009, 82, 793–804. [Google Scholar] [CrossRef] [PubMed]
- Bozoudi, D.; Tsaltas, D. The Multiple and Versatile Roles of Aureobasidium pullulans in the Vitivinicultural Sector. Fermentation 2018, 4, 85. [Google Scholar] [CrossRef]
- Prasongsuk, S.; Lotrakul, P.; Ali, I.; Bankeeree, W.; Punnapayak, H. The current status of Aureobasidium pullulans in biotechnology. Folia Microbiol. 2018, 63, 129–140. [Google Scholar] [CrossRef] [PubMed]
- Zou, X.; Zhou, Y.; Yang, S.T. Production of polymalic acid and malic acid by Aureobasidium pullulans fermentation and acid hydrolysis. Biotechnol. Bioeng. 2013, 110, 2105–2113. [Google Scholar] [CrossRef] [PubMed]
- An, C.; Ma, S.J.; Chang, F.; Xue, W.J. Efficient production of pullulan by Aureobasidium pullulans grown on mixtures of potato starch hydrolysate and sucrose. Braz. J. Microbiol. 2017, 48, 180–185. [Google Scholar] [CrossRef] [PubMed]
- Mulay, Y.R.; Deopurkar, R.L. Purification, characterization of amylase from indigenously isolated aureobasidium pullulans Cau 19 and its bioconjugates with gold nanoparticles. Appl. Biochem. Biotechnol. 2018, 184, 644–658. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.Y.; Chi, Z.; Wang, Z.P.; Liu, G.L.; Chi, Z.M. Heavy oils, principally long-chain n-alkanes secreted by Aureobasidium pullulans var. melanogenum strain P5 isolated from mangrove system. J. Ind. Microbiol. Biotechnol. 2014, 41, 1329–1337. [Google Scholar] [PubMed]
- Singh, R.S.; Kaur, N. Understanding response surface optimization of medium composition for pullulan production from de-oiled rice bran by Aureobasidium pullulans. In Food Science Biotechnology; Springer: Singapore, 2019; pp. 1–14. [Google Scholar]
- Chávez-González, M.; Rodríguez-Durán, L.V.; Balagurusamy, N.; Prado-Barragán, A.; Rodríguez, R.; Contreras, J.C.; Aguilar, C.N. Biotechnological advances and challenges of tannase: An overview. Food Bioprocess Technol. 2012, 5, 445–459. [Google Scholar] [CrossRef]
- Makkar, H.P.S.; Singh, B.; Kamra, D.N. Biodegradation of tannins in oak (Quercus incana) leaves by Sporotrichum pulverulentum. Lett. Appl. Microbiol. 1994, 18, 39–41. [Google Scholar] [CrossRef]
- Kumar, R.A.; Gunasekaran, P.; Lakshmanan, M. Biodegradation of tannic acid by Citrobacter freundii isolated from a tannery effluent. J. Basic Microbiol. Int. J. Biochem. Physiol. Genet. Morphol. Ecol. Microorg. 1999, 39, 161–168. [Google Scholar]
- Belmares, R.; Contreras-Esquivel, J.C.; Rodríguez-Herrera, R.; Coronel, A.R.; Aguilar, C.N. Microbial production of tannase: An enzyme with potential use in food industry. LWT Food Sci. Technol. 2004, 37, 857–864. [Google Scholar] [CrossRef]
- Mingshu, L.; Kai, Y.; Qiang, H.; Dongying, J. Biodegradation of gallotannins and ellagitannins. J. Basic Microbiol. 2006, 46, 68–84. [Google Scholar] [CrossRef] [PubMed]
- Meier, A.K.; Worch, S.; Böer, E.; Hartmann, A.; Mascher, M.; Marzec, M.; Bode, R. Agdc1p–a Gallic Acid Decarboxylase Involved in the Degradation of Tannic Acid in the Yeast Blastobotrys (Arxula) adeninivorans. Front. Microbiol. 2017, 8, 1777. [Google Scholar] [CrossRef] [PubMed]
- Shi, B.; He, Q.; Yao, K.; Huang, W.; Li, Q. Production of ellagic acid from degradation of valonea tannins by Aspergillus niger and Candida utilis. J. Chem. Technol. Biotechnol. Int. Res. Process Environ. Clean Technol. 2005, 80, 1154–1159. [Google Scholar]
- De las Rivas, B.; Rodríguez, H.; Anguita, J.; Muñoz, R. Bacterial tannases: Classification and biochemical properties. Appl. Microbiol. Biotechnol. 2019, 103, 603–623. [Google Scholar] [CrossRef] [PubMed]
- Aguilar, C.N.; Rodríguez, R.; Gutiérrez-Sánchez, G.; Augur, C.; Favela-Torres, E.; Prado-Barragan, L.A.; Contreras-Esquivel, J.C. Microbial tannases: Advances and perspectives. Appl. Microbiol. Biotechnol. 2007, 76, 47–59. [Google Scholar] [CrossRef]
- Gostinčar, C.; Ohm, R.A.; Kogej, T.; Sonjak, S.; Turk, M.; Zajc, J.; Sharma, A. Genome sequencing of four Aureobasidium pullulans varieties: Biotechnological potential, stress tolerance and description of new species. BMC Genom. 2014, 15, 549. [Google Scholar] [CrossRef]
- Zeida, M.; Wieser, M.; Yoshida, T.; Sugio, T.; Nagasawa, T. Purification and characterization of gallic acid decarboxylase from Pantoea agglomerans T71. Appl. Environ. Microbiol. 1998, 64, 4743–4747. [Google Scholar]
- Jana, A.; Halder, S.K.; Banerjee, A.; Paul, T.; Pati, B.R.; Mondal, K.C.; Mohapatra, P.K.D. Biosynthesis, structural architecture and biotechnological potential of bacterial tannase: A molecular advancement. Bioresour. Technol. 2014, 157, 327–340. [Google Scholar] [CrossRef]
- Ma, Z.C.; Fu, W.J.; Liu, G.L.; Wang, Z.P.; Chi, Z.M. High-level pullulan production by Aureobasidium pullulans var. melanogenium P16 isolated from mangrove system. Appl. Microbiol. Biotechnol. 2014, 98, 4865–4873. [Google Scholar] [CrossRef]
- Kumar, M.; Rana, S.; Beniwal, V.; Salar, R.K. Optimization of tannase production by a novel Klebsiella pneumoniae KP715242 using central composite design. Biotechnol. Rep. 2015, 7, 128–134. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analyses version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [PubMed]
- Aguilar, C.N.; Augur, C.; Favela-Torres, E.; Viniegra-González, G. Induction and repression patterns of fungal tannase in solid-state and submerged cultures. Process Biochem. 2001, 36, 565–570. [Google Scholar] [CrossRef]
- Sharma, S.; Bhat, T.K.; Dawra, R.K. A spectrophotometric method for assay of tannase using rhodanine. Anal. Biochem. 2000, 279, 85–89. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Chi, Z.; Wang, X.X.; Ma, Z.C.; Buzdar, M.A.; Chi, Z.M. The unique role of siderophore in marine-derived Aureobasidium pullulans HN6. 2. Biometals 2012, 25, 219–230. [Google Scholar] [CrossRef] [PubMed]
- Banerjee, A.; Jana, A.; Pati, B.R.; Mondal, K.C.; Mohapatra, P.K.D. Characterization of tannase protein sequences of bacteria and fungi: An in silico study. Protein J. 2012, 31, 306–327. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, K.; Hori, A.; Kawamoto, K.; Thangudu, R.R.; Ishida, T.; Igarashi, K.; Koseki, T. Crystal structure of a feruloyl esterase belonging to the tannase family: A disulfide bond near a catalytic triad. Proteins Struct. Funct. Bioinform. 2014, 82, 2857–2867. [Google Scholar] [CrossRef]
- Jiménez, N.; Curiel, J.A.; Reverón, I.; de las Rivas, B.; Muñoz, R. Uncovering the Lactobacillus plantarum WCFS1 gallate decarboxylase involved in tannin degradation. Appl. Environ. Microbiol. 2013, 79, 4253–4263. [Google Scholar]
- Huang, W.; Ni, J.; Borthwick, A.G. Biosynthesis of valonia tannin hydrolase and hydrolysis of valonia tannin to ellagic acid by Aspergillus SHL 6. Process Biochem. 2005, 40, 1245–1249. [Google Scholar] [CrossRef]
- Jiménez, N.; Esteban-Torres, M.; Mancheño, J.M.; de las Rivas, B.; Muñoz, R. Tannin degradation by a novel tannase enzyme present in some Lactobacillus plantarum strains. Appl. Environ. Microbiol. 2014, 80, 2991–2997. [Google Scholar]
- Banerjee, A.; Singha, K.; Soren, J.P.; Sen, A.; Mondal, K.C.; Mohapatra, P.K.D. Evolutionary study and sequence-structure relationship of fungal tannase and its subcellular localization through bioinformatics. Life Sci. Inf. Publ. 2017, 3, 7. [Google Scholar]
- Aithal, M.; Belur, P.D. Enhancement of propyl gallate yield in nonaqueous medium using novel cell-associated tannase of Bacillus massiliensis. Prep. Biochem. Biotechnol. 2013, 43, 445–455. [Google Scholar] [CrossRef] [PubMed]
- Purohit, J.S.; Dutta, J.R.; Nanda, R.K.; Banerjee, R. Strain improvement for tannase production from co-culture of Aspergillus foetidus and Rhizopus oryzae. Bioresour. Technol. 2006, 97, 795–801. [Google Scholar] [CrossRef] [PubMed]
Primers | Sequence 5′-3′ |
---|---|
TA5 | CGATTGGAGCACCTTCAACGAGA |
TA3 | CGACCTGAAAGGGATGATGGGAT |
TB5 | TATTCGTGTTGTAGGTCGGGTCA |
TB3 | AGAACGGCACCATTACTGCTCAA′ |
TC5 | GACCTCGACGTAACCAGACCTGA |
TC3 | CAACTGACGATGTTCCTTGCTCC |
GD5 | CAACAAGTTGGAAGCAAGGCAATA |
GD3 | CACAGCACGAGTGAGGTTGGGAT |
Primers | Sequence 5′-3′ |
---|---|
A5F | CCTGGCAACTCGTCCTACAACAT |
A5R | GATCCCCCGAATTAGACCTGCATCTCCTTCAGTCCTT |
A3F | ATGAGCCAACTGTCGCCGAGCCCTACGATTGGAGCACCTT |
A3R | GGTTGAGTAGCGCCAGCGATGTA |
B5F | GTCGATGGAAGCCTTGTCGTGTA |
B5R | GATCCCCCGAATTACACTTATCCTGACCTGACCACCTT |
B3F | ATGAGCCAACTGTCGAAAGGGAGAAACCACCTGGCAATT |
B3R | TCCAACCAGCCATGAGTCACCTC |
G5F | ATGAAGGTTCGCGAGATCTGTGAGG |
G5R | GATCCCCCGAATTAATGTCGACTTGGGAGCCGATGATGC |
G3F | ATGAGCCAACTGTCGAGATGGACAATGACGCCGACTGTCG |
G3R | GATCATCCTCACCAGTCAAATCAGG |
HPT5 | TAATTCGGGGGATCTGGATTTTAGTACTGGA |
HPT3 | CGACAGTTGGCTCATCATCCGTTACATCA |
Protein | Accession Number | Strain | Residues (aa) | MW (KDa) | Signal Peptide |
---|---|---|---|---|---|
TanAp-Like Proteins | |||||
Tannase | KEQ59156.1 | A. melanogenum CBS 110374 | 528 | 57.23 | Yes |
Tannase | XP_013428471.1 | Aureobasidium namibiae CBS 147.97 | 528 | 57.30 | Yes |
Tannase | KEQ86878.1 | Aureobasidium pullulans EXF-150 | 542 | 55.15 | No |
Tannase | OAK97256.1 | Stagonospora sp. SRC1lsM3a | 538 | 56.57 | No |
Tannase | EJD50919.1 | Auricularia subglabra TFB-10046 SS5 | 537 | 53.72 | No |
Tannase | PWO06677.1 | Pyrenophora triticirepentis | 540 | 55.97 | No |
TanBp-like Proteins | |||||
Tannase | KEQ62357.1 | A. melanogenum CBS 110374 | 587 | 63.39 | No |
Tannase | KEQ81812.1 | A. pullulans EXF-150 | 583 | 62.95 | No |
Tannase | EYE96818.1 | Aspergillus ruber CBS 135680 | 579 | 62.76 | No |
Tannase | KXG49722.1 | Penicillium griseofulvum | 580 | 62.85 | Yes |
Tannase | PQE10574.1 | Rutstroemia sp. NJR-2017a BVV2 | 581 | 62.62 | Yes |
Tannase | CDM29520.1 | Penicillium roqueforti FM164 | 579 | 62.57 | Yes |
Tannase | XP_023456645.1 | Cercospora beticola | 609 | 65.65 | Yes |
Tannase | XP_016598960.1 | Penicillium expansum | 580 | 62.83 | Yes |
Tannase | GAQ07635.1 | Aspergillus lentulus | 588 | 63.45 | Yes |
Tannase | CRL25663.1 | Penicillium camemberti | 580 | 62.86 | Yes |
Tannase | OKP13191.1 | Penicillium subrubescens | 589 | 64.00 | No |
Tannase | RSL58341.1 | Fusarium sp. AF-6 | 581 | 63.20 | Yes |
TanCp-like proteins | |||||
Tannase | KEQ62631.1 | A. melanogenum CBS 110374 | 508 | 54.68 | Yes |
Tannase | KEQ81081.1 | A. pullulans EXF-150 | 496 | 53.94 | No |
Tannase | XP_020125410.1 | Diplodia corticola | 542 | 58.16 | No |
Tannase | PVH72277.1 | Cadophora sp. DSE1049 | 513 | 54.75 | Yes |
Tannase | XP_018037725.1 | Paraphaeosphaeria sporulosa | 508 | 55.17 | Yes |
Tannase | KXH32567.1 | Colletotrichum nymphaeae SA-01 | 468 | 51.07 | No |
Tannase | XP_018070318.1 | Phialocephala scopiformis | 405 | 43.54 | No |
Tannase | ORY60088.1 | Pseudomassariella vexata | 451 | 49.84 | No |
Tannase | POS72090.1 | Diaporthe helianthi | 750 | 81.47 | Yes |
Tannase | KKP04619.1 | Trichoderma harzianum | 466 | 50.71 | Yes |
Tannase | KPA35627.1 | Fusarium langsethiae | 514 | 56.00 | Yes |
Gene | Protein | Gene Transcription Level Change (Fold) | Protein Translation Level Change (Fold) |
---|---|---|---|
tanA | TanAp | 32.00 ± 3.6 | 8.22 |
tanB | TanBp | 64.70 ± 5.2 | 332.00 |
tanC | TanCp | 0.74 ± 0.2 | - |
gad | GAD | 3.21 ± 0.3 | - |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, L.-L.; Li, J.; Wang, Y.-L.; Liu, S.; Wang, Z.-P.; Yu, X.-J. Integrated Approaches to Reveal Genes Crucial for Tannin Degradation in Aureobasidium melanogenum T9. Biomolecules 2019, 9, 439. https://doi.org/10.3390/biom9090439
Zhang L-L, Li J, Wang Y-L, Liu S, Wang Z-P, Yu X-J. Integrated Approaches to Reveal Genes Crucial for Tannin Degradation in Aureobasidium melanogenum T9. Biomolecules. 2019; 9(9):439. https://doi.org/10.3390/biom9090439
Chicago/Turabian StyleZhang, Lin-Lin, Jie Li, Yi-Lin Wang, Song Liu, Zhi-Peng Wang, and Xin-Jun Yu. 2019. "Integrated Approaches to Reveal Genes Crucial for Tannin Degradation in Aureobasidium melanogenum T9" Biomolecules 9, no. 9: 439. https://doi.org/10.3390/biom9090439
APA StyleZhang, L.-L., Li, J., Wang, Y.-L., Liu, S., Wang, Z.-P., & Yu, X.-J. (2019). Integrated Approaches to Reveal Genes Crucial for Tannin Degradation in Aureobasidium melanogenum T9. Biomolecules, 9(9), 439. https://doi.org/10.3390/biom9090439