Accelerated Metabolite Levels of Aerobic Glycolysis and the Pentose Phosphate Pathway Are Required for Efficient Replication of Infectious Spleen and Kidney Necrosis Virus in Chinese Perch Brain Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells and Virus
2.2. Antibodies and Pharmaceuticals
2.3. Cell Viability Assay
2.4. Quantification of ISKNV Copies
2.5. Transcriptomics and Proteomics Profile Analyses of CPB Cells Infected with ISKNV
2.6. Metabolomics Profile Analysis of CPB Cells Infected with ISKNV by Liquid Chromatography Mass Spectrometry (LC-MS)
2.7. Gene Transcription of Glucose Metabolism Pathway during ISKNV Multiplication
2.8. Determination of Glucose Consumption and Lactate Accumulation in Supernatants
2.9. CPB Cell Energy Phenotype Measurement Post ISKNV Infection
2.10. Western Blot Analysis
2.11. Statistical Analysis
3. Results
3.1. ISKNV Infection Altered Glucose Metabolism in CPB Cells
3.2. ISKNV Induced the Warburg Effect in CPB Cells at the Late Replication Stage
3.3. Aerobic Glycolysis Was Required for Efficient ISKNV Multiplication
3.4. The Pentose Phosphate Pathway Was Required for ISKNV Multiplication to Provide Nucleotide Synthesis
3.5. TCA Cycle Was Not Necessary for ISKNV Multiplication
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Sanchez, E.L.; Lagunoff, M. Viral activation of cellular metabolism. Virology 2015, 479–480, 609–618. [Google Scholar] [CrossRef] [PubMed]
- Warburg, O. On the origin of cancer cells. Science 1956, 123, 309–314. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.W.; Dang, C.V. Cancer’s molecular sweet tooth and the Warburg effect. Cancer Res. 2006, 66, 8927–8930. [Google Scholar] [CrossRef] [PubMed]
- Zwerschke, W.; Mazurek, S.; Massimi, P.; Banks, L.; Eigenbrodt, E.; Jansen-Durr, P. Modulation of type M2 pyruvate kinase activity by the human papillomavirus type 16 E7 oncoprotein. Proc. Natl. Acad. Sci. USA 1999, 96, 1291–1296. [Google Scholar] [CrossRef] [PubMed]
- Munger, J.; Bajad, S.U.; Coller, H.A.; Shenk, T.; Rabinowitz, J.D. Dynamics of the cellular metabolome during human cytomegalovirus infection. PLoS Pathog. 2006, 2, e132. [Google Scholar] [CrossRef] [PubMed]
- Munger, J.; Bennett, B.D.; Parikh, A.; Feng, X.J.; McArdle, J.; Rabitz, H.A.; Shenk, T.; Rabinowitz, J.D. Systems-level metabolic flux profiling identifies fatty acid synthesis as a target for antiviral therapy. Nat. Biotechnol. 2008, 26, 1179–1186. [Google Scholar] [CrossRef] [Green Version]
- Su, M.A.; Huang, Y.T.; Chen, I.T.; Lee, D.Y.; Hsieh, Y.C.; Li, C.Y.; Ng, T.H.; Liang, S.Y.; Lin, S.Y.; Huang, S.W.; et al. An invertebrate Warburg effect: A shrimp virus achieves successful replication by altering the host metabolome via the PI3K-Akt-mTOR pathway. PLoS Pathog. 2014, 10, e1004196. [Google Scholar] [CrossRef]
- Chen, I.T.; Aoki, T.; Huang, Y.T.; Hirono, I.; Chen, T.C.; Huang, J.Y.; Chang, G.D.; Lo, C.F.; Wang, H.C. White spot syndrome virus induces metabolic changes resembling the warburg effect in shrimp hemocytes in the early stage of infection. J. Virol. 2011, 85, 12919–12928. [Google Scholar] [CrossRef]
- Delgado, T.; Carroll, P.A.; Punjabi, A.S.; Margineantu, D.; Hockenbery, D.M.; Lagunoff, M. Induction of the Warburg effect by Kaposi’s sarcoma herpesvirus is required for the maintenance of latently infected endothelial cells. Proc. Natl. Acad. Sci. USA 2010, 107, 10696–10701. [Google Scholar] [CrossRef]
- Diamond, D.L.; Syder, A.J.; Jacobs, J.M.; Sorensen, C.M.; Walters, K.A.; Proll, S.C.; McDermott, J.E.; Gritsenko, M.A.; Zhang, Q.; Zhao, R.; et al. Temporal proteome and lipidome profiles reveal hepatitis C virus-associated reprogramming of hepatocellular metabolism and bioenergetics. PLoS Pathog. 2010, 6, e1000719. [Google Scholar] [CrossRef]
- Vander Heiden, M.G.; Cantley, L.C.; Thompson, C.B. Understanding the Warburg effect: The metabolic requirements of cell proliferation. Science 2009, 324, 1029–1033. [Google Scholar] [CrossRef]
- Wu, S.; Yu, L.; Fu, X.; Yan, X.; Lin, Q.; Liu, L.; Liang, H.; Li, N. iTRAQ-based proteomic profile analysis of ISKNV-infected CPB cells with emphasizing on glucose metabolism, apoptosis and autophagy pathways. Fish Shellfish Immunol. 2018, 79, 102–111. [Google Scholar] [CrossRef] [PubMed]
- He, J.G.; Deng, M.; Weng, S.P.; Li, Z.; Zhou, S.Y.; Long, Q.X.; Wang, X.Z.; Chan, S.M. Complete genome analysis of the mandarin fish infectious spleen and kidney necrosis iridovirus. Virology 2001, 291, 126–139. [Google Scholar] [CrossRef] [PubMed]
- Fu, X.; Li, N.; Liu, L.; Lin, Q.; Wang, F.; Lai, Y.; Jiang, H.; Pan, H.; Shi, C.; Wu, S. Genotype and host range analysis of infectious spleen and kidney necrosis virus (ISKNV). Virus Genes 2011, 42, 97–109. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.Q.; Lu, L.; Weng, S.P.; Huang, J.N.; Chan, S.M.; He, J.G. Molecular epidemiology and phylogenetic analysis of a marine fish infectious spleen and kidney necrosis virus-like (ISKNV-like) virus. Arch. Virol. 2007, 152, 763–773. [Google Scholar] [CrossRef] [PubMed]
- Fu, X.; Li, N.; Lai, Y.; Luo, X.; Wang, Y.; Shi, C.; Huang, Z.; Wu, S.; Su, J. A novel fish cell line derived from the brain of Chinese perch Siniperca chuatsi: Development and characterization. J. Fish Biol. 2015, 86, 32–45. [Google Scholar] [CrossRef] [PubMed]
- Fu, X.; Hu, X.; Li, N.; Zheng, F.; Dong, X.; Duan, J.; Lin, Q.; Tu, J.; Zhao, L.; Huang, Z.; et al. Glutamine and glutaminolysis are required for efficient replication of infectious spleen and kidney necrosis virus in Chinese perch brain cells. Oncotarget 2017, 8, 2400–2412. [Google Scholar] [CrossRef]
- Hu, X.; Fu, X.; Li, N.; Dong, X.; Zhao, L.; Lan, J.; Ji, W.; Zhou, W.; Ai, T.; Wu, S.; et al. Transcriptomic analysis of Mandarin fish brain cells infected with infectious spleen and kidney necrosis virus with an emphasis on retinoic acid-inducible gene 1-like receptors and apoptosis pathways. Fish Shellfish Immunol. 2015, 45, 619–629. [Google Scholar] [CrossRef]
- Lin, Q.; Fu, X.; Liu, L.; Liang, H.; Guo, H.; Yin, S.; Kumaresan, V.; Huang, Z.; Li, N. Application and development of a TaqMan real-time PCR for detecting infectious spleen and kidney necrosis virus in Siniperca chuatsi. Microb. Pathog. 2017, 107, 98–105. [Google Scholar] [CrossRef]
- Wang, H.; Liu, Z.; Wang, S.; Cui, D.; Zhang, X.; Liu, Y.; Zhang, Y. UHPLC-Q-TOF/MS based plasma metabolomics reveals the metabolic perturbations by manganese exposure in rat models. Metallomics 2017, 9, 192–203. [Google Scholar] [CrossRef]
- Guo, H.; Fu, X.; Li, N.; Lin, Q.; Liu, L.; Wu, S. Molecular characterization and expression pattern of tumor suppressor protein p53 in mandarin fish, Siniperca chuatsi following virus challenge. Fish Shellfish Immunol. 2016, 51, 392–400. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Barrero, C.A.; Datta, P.K.; Sen, S.; Deshmane, S.; Amini, S.; Khalili, K.; Merali, S. HIV-1 Vpr modulates macrophage metabolic pathways: A SILAC-based quantitative analysis. PLoS ONE 2013, 8, e68376. [Google Scholar] [CrossRef] [PubMed]
- Eagle, H.; Habel, K. The nutritional requirements for the propagation of poliomyelitis virus by the HeLa cell. J. Exp. Med. 1956, 104, 271–287. [Google Scholar] [CrossRef] [PubMed]
- Klemperer, H. Glucose breakdown in chick embryo cells infected with influenza virus. Virology 1961, 13, 68–77. [Google Scholar] [CrossRef]
- Manel, N.; Kim, F.J.; Kinet, S.; Taylor, N.; Sitbon, M.; Battini, J.L. The ubiquitous glucose transporter GLUT-1 is a receptor for HTLV. Cell 2003, 115, 449–459. [Google Scholar] [CrossRef]
- Lewis, V.J., Jr.; Scott, L.V. Nutritional requirements for the production of herpes simplex virus. I. Influence of glucose and glutamine of herpes simplex virus production by HeLa cells. J. Bacteriol. 1962, 83, 475–482. [Google Scholar] [PubMed]
- Courtney, R.J.; Steiner, S.M.; Benyesh-Melnick, M. Effects of 2-deoxy-D-glucose on herpes simplex virus replication. Virology 1973, 52, 447–455. [Google Scholar] [CrossRef]
- Tritel, M.; Resh, M.D. The late stage of human immunodeficiency virus type 1 assembly is an energy-dependent process. J. Virol. 2001, 75, 5473–5481. [Google Scholar] [CrossRef]
- El-Bacha, T.; Menezes, M.M.; Azevedo e Silva, M.C.; Sola-Penna, M.; Da Poian, A.T. Mayaro virus infection alters glucose metabolism in cultured cells through activation of the enzyme 6-phosphofructo 1-kinase. Mol. Cell Biochem. 2004, 266, 191–198. [Google Scholar] [CrossRef]
- Landini, M.P. Early enhanced glucose uptake in human cytomegalovirus-infected cells. J. Gen. Virol. 1984, 65 Pt 7, 1229–1232. [Google Scholar] [CrossRef]
- Johnson, R.A.; Wang, X.; Ma, X.L.; Huong, S.M.; Huang, E.S. Human cytomegalovirus up-regulates the phosphatidylinositol 3-kinase (PI3-K) pathway: Inhibition of PI3-K activity inhibits viral replication and virus-induced signaling. J. Virol. 2001, 75, 6022–6032. [Google Scholar] [CrossRef]
- Mathupala, S.P.; Ko, Y.H.; Pedersen, P.L. Hexokinase-2 bound to mitochondria: cancer’s stygian link to the “Warburg Effect” and a pivotal target for effective therapy. Semin. Cancer Biol. 2009, 19, 17–24. [Google Scholar] [CrossRef] [PubMed]
- Hernandez-Palomares, M.L.E.; Godoy-Lugo, J.A.; Gomez-Jimenez, S.; Gamez-Alejo, L.A.; Ortiz, R.M.; Munoz-Valle, J.F.; Peregrino-Uriarte, A.B.; Yepiz-Plascencia, G.; Rosas-Rodriguez, J.A.; Sonanez-Organis, J.G. Regulation of lactate dehydrogenase in response to WSSV infection in the shrimp Litopenaeus vannamei. Fish Shellfish Immunol. 2018, 74, 401–409. [Google Scholar] [CrossRef] [PubMed]
- Liang, Y.; Xu, M.L.; Wang, X.W.; Gao, X.X.; Cheng, J.J.; Li, C.; Huang, J. ATP synthesis is active on the cell surface of the shrimp Litopenaeus vannamei and is suppressed by WSSV infection. Virol. J. 2015, 12, 49. [Google Scholar] [CrossRef] [PubMed]
- Chambers, J.W.; Maguire, T.G.; Alwine, J.C. Glutamine metabolism is essential for human cytomegalovirus infection. J. Virol. 2010, 84, 1867–1873. [Google Scholar] [CrossRef] [PubMed]
- Boros, L.G.; Lee, P.W.N.; Brandes, J.L.; Cascante, M.; Muscarella, P.; Schirmer, W.J.; Melvin, W.S.; Ellison, E.C. Nonoxidative pentose phosphate pathways and their direct role in ribose synthesis in tumors_ is cancer a disease of cellular glucose metabolism. Med. Hypotheses 1998, 50, 55–59. [Google Scholar] [CrossRef]
- Ramos-Montoya, A.; Lee, W.N.; Bassilian, S.; Lim, S.; Trebukhina, R.V.; Kazhyna, M.V.; Ciudad, C.J.; Noe, V.; Centelles, J.J.; Cascante, M. Pentose phosphate cycle oxidative and nonoxidative balance: A new vulnerable target for overcoming drug resistance in cancer. Int. J. Cancer 2006, 119, 2733–2741. [Google Scholar] [CrossRef]
- Vastag, L.; Koyuncu, E.; Grady, S.L.; Shenk, T.E.; Rabinowitz, J.D. Divergent effects of human cytomegalovirus and herpes simplex virus-1 on cellular metabolism. PLoS Pathog. 2011, 7, e1002124. [Google Scholar] [CrossRef]
- Nutter, L.; Grill, S.P.; Cheng, Y.C. The sources of thymidine nucleotides for virus DNA synthesis in herpes simplex virus type 2-infected cells. J. Biol. Chem. 1985, 260, 13272–13275. [Google Scholar]
- Daikoku, T.; Yamamoto, N.; Maeno, K.; Nishiyama, Y. Role of viral ribonucleotide reductase in the increase of dTTP pool size in herpes simplex virus-infected Vero cells. J. Gen. Virol. 1991, 72, 1441–1444. [Google Scholar] [CrossRef] [PubMed]
- Ritter, J.B.; Wahl, A.S.; Freund, S.; Genzel, Y.; Reichl, U. Metabolic effects of influenza virus infection in cultured animal cells: Intra- and extracellular metabolite profiling. BMC Syst. Biol. 2010, 4, 61. [Google Scholar] [CrossRef] [PubMed]
- Delgado, T.; Sanchez, E.L.; Camarda, R.; Lagunoff, M. Global metabolic profiling of infection by an oncogenic virus: KSHV induces and requires lipogenesis for survival of latent infection. PLoS Pathog. 2012, 8, e1002866. [Google Scholar] [CrossRef] [PubMed]
- Gammon, D.B.; Gowrishankar, B.; Duraffour, S.; Andrei, G.; Upton, C.; Evans, D.H. Vaccinia virus-encoded ribonucleotide reductase subunits are differentially required for replication and pathogenesis. PLoS Pathog. 2010, 6, e1000984. [Google Scholar] [CrossRef]
- Schroeder, M.A.; Cochlin, L.E.; Heather, L.C.; Clarke, K.; Radda, G.K.; Tyler, D.J. In vivo assessment of pyruvate dehydrogenase flux in the heart using hyperpolarized carbon-13 magnetic resonance. Proc. Natl. Acad. Sci. USA 2008, 105, 12051–12056. [Google Scholar] [CrossRef] [PubMed]
- Xing, G.; Ren, M.; O’Neill, J.T.; Verma, A.; Watson, W.D. Controlled cortical impact injury and craniotomy result in divergent alterations of pyruvate metabolizing enzymes in rat brain. Exp. Neurol. 2012, 234, 31–38. [Google Scholar] [CrossRef] [PubMed]
- Stacpoole, P.W. Therapeutic Targeting of the Pyruvate Dehydrogenase Complex/Pyruvate Dehydrogenase Kinase (PDC/PDK) Axis in Cancer. J. Natl. Cancer Inst. 2017, 109. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Michelakis, E.D.; Gurtu, V.; Webster, L.; Barnes, G.; Watson, G.; Howard, L.; Cupitt, J.; Paterson, I.; Thompson, R.B.; Chow, K.; et al. Inhibition of pyruvate dehydrogenase kinase improves pulmonary arterial hypertension in genetically susceptible patients. Sci. Transl. Med. 2017, 9. [Google Scholar] [CrossRef] [PubMed]
Primer Names | Gens Name | Sequence (5′-3′) |
---|---|---|
q-18s-F | 18S rRNA | CATTCGTATTGTGCCGCTAGA |
q-18s-R | CAAATGCTTTCGCTTTGGTC | |
q-HK1-F | Hexokinase 1 (HK 1) | TTATCCGTCCCTCAAATAGCA |
q-HK1-R | GGCTCTATCAACCCAGGAAAG | |
q-GPI-F | Glucose-6-phosphate isomerase (GPI) | CTCTGGTCGCCATGTATGAG |
q-GPI-R | CTCCGGCTCGATCTTCTTC | |
q-G6PDH-F | Glucose-6-phosphate dehydrogenase (G6PDH) | ACCGCTCTGCTTCTGTATCC |
q-G6PDH-R | CTTTGCTCGCTCTGACTTGA | |
q-ENO-F | Enolase (ENO) | TGCACTGGACAGATCAAGACA |
q-ENO-R | AGCTCCTCTTCAATCCTGAGC | |
q-PK-F | Pyruvate kinase (PK) | GATGAAGGAGGCAAAGACCA |
q-PK-R | GCAGCAAGAAGGGAGTGAAC | |
q-LDH-F | Lactate dehydrogenase (LDH) | GGACAGTGCCTACGAGGTGA |
q-LDH-R | GGTAGAGACAGGATGGACAC | |
q-PDH-F | Pyruvate dehydrogenase (PDH) | CGTTGTGCCTGTTTCTGATG |
q-PDH-R | CAAATGGTGCAGAGCTGGTA |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guo, X.; Wu, S.; Li, N.; Lin, Q.; Liu, L.; Liang, H.; Niu, Y.; Huang, Z.; Fu, X. Accelerated Metabolite Levels of Aerobic Glycolysis and the Pentose Phosphate Pathway Are Required for Efficient Replication of Infectious Spleen and Kidney Necrosis Virus in Chinese Perch Brain Cells. Biomolecules 2019, 9, 440. https://doi.org/10.3390/biom9090440
Guo X, Wu S, Li N, Lin Q, Liu L, Liang H, Niu Y, Huang Z, Fu X. Accelerated Metabolite Levels of Aerobic Glycolysis and the Pentose Phosphate Pathway Are Required for Efficient Replication of Infectious Spleen and Kidney Necrosis Virus in Chinese Perch Brain Cells. Biomolecules. 2019; 9(9):440. https://doi.org/10.3390/biom9090440
Chicago/Turabian StyleGuo, Xixi, Shiwei Wu, Ningqiu Li, Qiang Lin, Lihui Liu, Hongru Liang, Yinjie Niu, Zhibin Huang, and Xiaozhe Fu. 2019. "Accelerated Metabolite Levels of Aerobic Glycolysis and the Pentose Phosphate Pathway Are Required for Efficient Replication of Infectious Spleen and Kidney Necrosis Virus in Chinese Perch Brain Cells" Biomolecules 9, no. 9: 440. https://doi.org/10.3390/biom9090440
APA StyleGuo, X., Wu, S., Li, N., Lin, Q., Liu, L., Liang, H., Niu, Y., Huang, Z., & Fu, X. (2019). Accelerated Metabolite Levels of Aerobic Glycolysis and the Pentose Phosphate Pathway Are Required for Efficient Replication of Infectious Spleen and Kidney Necrosis Virus in Chinese Perch Brain Cells. Biomolecules, 9(9), 440. https://doi.org/10.3390/biom9090440