Piezo1 Regulates Odontogenesis via a FAM83G-Mediated Mechanism in Dental Papilla Cells In Vitro and In Vivo
Abstract
1. Introduction
2. Materials and Methods
2.1. Immunohistochemistry (IHC)
2.2. Cell Isolation, Culture, and Differentiation
2.3. Semi-Quantitative Alizarin Red Staining (ARS)
2.4. Cell Clonogenic Assay
2.5. Flow Cytometry
2.6. Immunofluorescence (IF)
2.7. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)
2.8. Western Blotting (WB)
2.9. CCK-8 Assay
2.10. ALP Staining and Activity Analysis
2.11. Cell Transfection
2.12. Three-Dimensional Culture
2.13. Ectopic Subcutaneous Transplantation Model
2.14. Histological Analysis
2.15. RNA Sequencing
2.16. Statistical Analysis
3. Results
3.1. The Expression Pattern of Piezo1 in Rat Molars and DPCs
3.2. Knockdown of Piezo1 Inhibited Odontogenic Differentiation of DPCs
3.3. Yoda1 Activation of Piezo1 Promoted Odontogenic Differentiation of DPCs
3.4. Activation of Piezo1 Channels Promoted Odontogenesis of DPCs in a 3D Culture Model and In Vivo
3.5. FAM83G Negatively Regulated Piezo1-Mediated Odontogenic Differentiation of DPCs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| ACTB | β-Actin |
| ALP | Alkaline phosphatase |
| ARS | Alizarin red staining |
| BCA | Bicinchoninic acid |
| DEGs | Differentially expressed genes |
| DMP1 | Dentin matrix protein 1 |
| DPCs | Dental papilla cells |
| DSPP | Dentin sialophosphoprotein |
| ECL | Enhanced chemiluminescence |
| FAM83G | Family with sequence similarity 83, member G |
| FBS | Fetal bovine serum |
| H and E | Hematoxylin and eosin |
| IF | Immunofluorescence |
| IHC | Immunohistochemistry |
| mOB | Mature odontoblasts |
| MSCs | Mesenchymal stem cells |
| NC | Negative control |
| OD | Optical density |
| OS | Osteo/Odontogenic induction |
| OTM | Orthodontic tooth movement |
| PMSF | Phenylmethylsulfonyl fluoride |
| pOB | Preodontoblasts |
| PVDF | Polyvinylidene fluoride |
| RIPA | Radioimmunoprecipitation assay |
| RNA-seq | RNA sequencing |
| RT-qPCR | Real-time quantitative polymerase chain reaction |
| SD | Sprague-Dawley |
| WB | Western blotting |
References
- Kong, X.; Cao, M.; Ye, R.; Ding, Y. Orthodontic force accelerates dentine mineralization during tooth development in juvenile rats. Tohoku J. Exp. Med. 2010, 221, 265–270. [Google Scholar] [CrossRef][Green Version]
- Mammoto, T.; Mammoto, A.; Torisawa, Y.S.; Tat, T.; Gibbs, A.; Derda, R.; Mannix, R.; de Bruijn, M.; Yung, C.W.; Huh, D.; et al. Mechanochemical control of mesenchymal condensation and embryonic tooth organ formation. Dev. Cell 2011, 21, 758–769. [Google Scholar] [CrossRef] [PubMed]
- Dalaie, K.; Badiee, M.; Behnaz, M.; Kavousinejad, S. Effect of orthodontic forces on root length of immature mandibular second premolars: A split-mouth randomized clinical trial. Dental Press. J. Orthod. 2021, 26, e2119355. [Google Scholar] [CrossRef] [PubMed]
- Shuman, I.; Cardo, V.A., Jr. Tooth Development Following Mandibular Distraction Osteogenesis in Neonates With Pierre Robin Sequence. J. Craniofac Surg. 2021, 32, 675–677. [Google Scholar] [CrossRef]
- Kollar, E.J.; Baird, G.R. The influence of the dental papilla on the development of tooth shape in embryonic mouse tooth germs. J. Embryol. Exp. Morphol. 1969, 21, 131–148. [Google Scholar] [CrossRef] [PubMed]
- Tucker, A.S.; Sharpe, P.T. Molecular genetics of tooth morphogenesis and patterning: The right shape in the right place. J. Dent. Res. 1999, 78, 826–834. [Google Scholar] [CrossRef] [PubMed]
- Coste, B.; Mathur, J.; Schmidt, M.; Earley, T.J.; Ranade, S.; Petrus, M.J.; Dubin, A.E.; Patapoutian, A. Piezo1 and Piezo2 are essential components of distinct mechanically activated cation channels. Science 2010, 330, 55–60. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Q.; Zhou, H.; Li, X.; Xiao, B. The mechanosensitive Piezo1 channel: A three-bladed propeller-like structure and a lever-like mechanogating mechanism. FEBS J. 2019, 286, 2461–2470. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y.; Yang, X.; Jiang, J.; Xiao, B. Structural Designs and Mechanogating Mechanisms of the Mechanosensitive Piezo Channels. Trends Biochem. Sci. 2021, 46, 472–488. [Google Scholar] [CrossRef] [PubMed]
- Woo, S.-H.; Ranade, S.; Weyer, A.D.; Dubin, A.E.; Baba, Y.; Qiu, Z.; Petrus, M.; Miyamoto, T.; Reddy, K.; Lumpkin, E.A.; et al. Piezo2 is required for Merkel-cell mechanotransduction. Nature 2014, 509, 622–626. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Lewis, A.H.; Grandl, J. Touch, Tension, and Transduction—The Function and Regulation of Piezo Ion Channels. Trends Biochem. Sci. 2017, 42, 57–71. [Google Scholar] [CrossRef] [PubMed]
- Lewis, A.H.; Grandl, J. Mechanical sensitivity of Piezo1 ion channels can be tuned by cellular membrane tension. eLife 2015, 4, e12088. [Google Scholar] [CrossRef]
- Yang, X.; Lin, C.; Chen, X.; Li, S.; Li, X.; Xiao, B. Structure deformation and curvature sensing of PIEZO1 in lipid membranes. Nature 2022, 604, 377–383. [Google Scholar] [CrossRef] [PubMed]
- Sugimoto, A.; Miyazaki, A.; Kawarabayashi, K.; Shono, M.; Akazawa, Y.; Hasegawa, T.; Ueda-Yamaguchi, K.; Kitamura, T.; Yoshizaki, K.; Fukumoto, S.; et al. Piezo type mechanosensitive ion channel component 1 functions as a regulator of the cell fate determination of mesenchymal stem cells. Sci. Rep. 2017, 7, 17696. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Hou, B.; Tumova, S.; Muraki, K.; Bruns, A.; Ludlow, M.J.; Sedo, A.; Hyman, A.J.; McKeown, L.; Young, R.S.; et al. Piezo1 integration of vascular architecture with physiological force. Nature 2014, 515, 279–282. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Wanggou, S.; Bodalia, A.; Zhu, M.; Dong, W.; Fan, J.J.; Yin, W.C.; Min, H.K.; Hu, M.; Draghici, D.; et al. A Feedforward Mechanism Mediated by Mechanosensitive Ion Channel PIEZO1 and Tissue Mechanics Promotes Glioma Aggression. Neuron 2018, 100, 799–815.e797. [Google Scholar] [CrossRef] [PubMed]
- Blumenthal, N.R.; Hermanson, O.; Heimrich, B.; Shastri, V.P. Stochastic nanoroughness modulates neuron-astrocyte interactions and function via mechanosensing cation channels. Proc. Natl. Acad. Sci. USA 2014, 111, 16124–16129. [Google Scholar] [CrossRef] [PubMed]
- Yoneda, M.; Suzuki, H.; Hatano, N.; Nakano, S.; Muraki, Y.; Miyazawa, K.; Goto, S.; Muraki, K. PIEZO1 and TRPV4, which Are Distinct Mechano-Sensors in the Osteoblastic MC3T3-E1 Cells, Modify Cell-Proliferation. Int. J. Mol. Sci. 2019, 20, 4960. [Google Scholar] [CrossRef]
- Jiang, Y.; Guan, Y.; Lan, Y.; Chen, S.; Li, T.; Zou, S.; Hu, Z.; Ye, Q. Mechanosensitive Piezo1 in Periodontal Ligament Cells Promotes Alveolar Bone Remodeling During Orthodontic Tooth Movement. Front. Physiol. 2021, 12, 767136. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Guo, Y.; Liu, P.; Zhang, H.; Wang, Y.; Li, Z.; Mei, Y.; Niu, L.; Liu, R. Piezo Mediates the Mechanosensation and Injury-Repair of Pulpo-Dentinal Complex. Int. Dent. J. 2024, 74, 71–80. [Google Scholar] [CrossRef]
- Huang, P.; Jiang, R.X.; Wang, F.; Qiao, W.W.; Ji, Y.T.; Meng, L.Y.; Bian, Z. PIEZO1 Promotes Odontoblast-Mediated Reactionary Dentinogenesis via SEMA3A. J. Dent. Res. 2024, 103, 889–898. [Google Scholar] [CrossRef] [PubMed]
- Matsunaga, M.; Kimura, M.; Ouchi, T.; Nakamura, T.; Ohyama, S.; Ando, M.; Nomura, S.; Azuma, T.; Ichinohe, T.; Shibukawa, Y. Mechanical Stimulation-Induced Calcium Signaling by Piezo1 Channel Activation in Human Odontoblast Reduces Dentin Mineralization. Front. Physiol. 2021, 12, 704518. [Google Scholar] [CrossRef] [PubMed]
- Miyazaki, A.; Sugimoto, A.; Yoshizaki, K.; Kawarabayashi, K.; Iwata, K.; Kurogoushi, R.; Kitamura, T.; Otsuka, K.; Hasegawa, T.; Akazawal, Y.; et al. Coordination of WNT signaling and ciliogenesis during odontogenesis by piezo type mechanosensitive ion channel component 1. Sci. Rep. 2019, 9, 14762. [Google Scholar] [CrossRef] [PubMed]
- Zhang, F.; Yang, S.; Jiang, L.; Liu, J.; He, Y.; Sheng, X.; Chen, H.; Kang, J.; Jia, S.; Fan, W.; et al. Melatonin-mediated malic enzyme 2 orchestrates mitochondrial fusion and respiratory functions to promote odontoblastic differentiation during tooth development. J. Pineal Res. 2023, 74, e12865. [Google Scholar] [CrossRef] [PubMed]
- Ma, H.; Sheng, X.; Chen, W.; He, H.; Liu, J.; He, Y.; Huang, F. PER2 regulates odontoblastic differentiation of dental papilla cells in vitro via intracellular ATP content and reactive oxygen species levels. PeerJ 2023, 11, e16489. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Ding, R.; Han, Z.; Ma, Z.; Wang, Y. Targeting of cell cycle and let-7a/STAT3 pathway by niclosamide inhibits proliferation, migration and invasion in oral squamous cell carcinoma cells. Biomed. Pharmacother. 2017, 96, 434–442. [Google Scholar] [CrossRef]
- Syeda, R.; Xu, J.; Dubin, A.E.; Coste, B.; Mathur, J.; Huynh, T.; Matzen, J.; Lao, J.; Tully, D.C.; Engels, I.H.; et al. Chemical activation of the mechanotransduction channel Piezo1. elife 2015, 4, e07369. [Google Scholar] [CrossRef] [PubMed]
- Botello-Smith, W.M.; Jiang, W.; Zhang, H.; Ozkan, A.D.; Lin, Y.C.; Pham, C.N.; Lacroix, J.J.; Luo, Y. A mechanism for the activation of the mechanosensitive Piezo1 channel by the small molecule Yoda1. Nat. Commun. 2019, 10, 4503. [Google Scholar] [CrossRef] [PubMed]
- Mousawi, F.; Peng, H.; Li, J.; Sreenivasan, P.; Roger, S.; Zhao, H.; Yang, X.; Jiang, L.-H. Chemical activation of the Piezo1 channel drives mesenchymal stem cell migration via inducing ATP release and activation of P2 receptor purinergic signaling. Stem Cells 2020, 38, 410–421. [Google Scholar] [CrossRef]
- Xing, Y.; Yang, B.; He, Y.; Xie, B.; Zhao, T.; Chen, J. Effects of mechanosensitive ion channel Piezo1 on proliferation and osteogenic differentiation of human dental follicle cells. Ann. Anat. 2022, 239, 151847. [Google Scholar] [CrossRef] [PubMed]
- Sasaki, F.; Hayashi, M.; Mouri, Y.; Nakamura, S.; Adachi, T.; Nakashima, T. Mechanotransduction via the Piezo1-Akt pathway underlies Sost suppression in osteocytes. Biochem. Biophys. Res. Commun. 2020, 521, 806–813. [Google Scholar] [CrossRef]
- Tziafas, D.; Kodonas, K. Differentiation potential of dental papilla, dental pulp, and apical papilla progenitor cells. J. Endod. 2010, 36, 781–789. [Google Scholar] [CrossRef] [PubMed]
- Lyu, Y.; Jia, S.; Wang, S.; Wang, T.; Tian, W.; Chen, G. Gestational diabetes mellitus affects odontoblastic differentiation of dental papilla cells via Toll-like receptor 4 signaling in offspring. J. Cell Physiol. 2020, 235, 3519–3528. [Google Scholar] [CrossRef]
- Kikuchi, H.; Suzuki, K.; Sakai, N.; Yamada, S. Odontoblasts induced from mesenchymal cells of murine dental papillae in three-dimensional cell culture. Cell Tissue Res. 2004, 317, 173–185. [Google Scholar] [CrossRef] [PubMed]
- Chen, T.; Liu, Z.; Sun, W.; Li, J.; Liang, Y.; Yang, X.; Xu, Y.; Yu, M.; Tian, W.; Chen, G.; et al. Inhibition of Ape1 Redox Activity Promotes Odonto/osteogenic Differentiation of Dental Papilla Cells. Sci. Rep. 2015, 5, 17483. [Google Scholar] [CrossRef]
- Fu, J.; Zhang, X.; Zheng, H.; Yang, G.; Chen, Z.; Yuan, G. A WWP2-PTEN-KLF5 signaling axis regulates odontoblast differentiation and dentinogenesis in mice. J. Biol. Chem. 2022, 298, 102220. [Google Scholar] [CrossRef]
- Fu, J.; Zheng, H.; Xue, Y.; Jin, R.; Yang, G.; Chen, Z.; Yuan, G. WWP2 Promotes Odontoblastic Differentiation by Monoubiquitinating KLF5. J. Dent. Res. 2021, 100, 432–439. [Google Scholar] [CrossRef] [PubMed]
- Kang, J.; Chen, H.; Zhang, F.; Yan, T.; Fan, W.; Jiang, L.; He, H.; Huang, F. RORα Regulates Odontoblastic Differentiation and Mediates the Pro-Odontogenic Effect of Melatonin on Dental Papilla Cells. Molecules 2021, 26, 98. [Google Scholar] [CrossRef]
- Li, Y.; Lin, Y.; Guo, J.; Huang, D.; Zuo, H.; Zhang, H.; Yuan, G.; Liu, H.; Chen, Z. CREB3L1 deficiency impairs odontoblastic differentiation and molar dentin deposition partially through the TMEM30B. Int. J. Oral. Sci. 2024, 16, 59. [Google Scholar] [CrossRef] [PubMed]
- Filatova, A.; Pagella, P.; Mitsiadis, T.A. Distribution of syndecan-1 protein in developing mouse teeth. Front. Physiol. 2014, 5, 518. [Google Scholar] [CrossRef] [PubMed]
- Jin, Y.; Li, J.; Wang, Y.; Ye, R.; Feng, X.; Jing, Z.; Zhao, Z. Functional role of mechanosensitive ion channel Piezo1 in human periodontal ligament cells. Angle Orthod. 2015, 85, 87–94. [Google Scholar] [CrossRef] [PubMed]
- Shen, Y.; Pan, Y.; Guo, S.; Sun, L.; Zhang, C.; Wang, L. The roles of mechanosensitive ion channels and associated downstream MAPK signaling pathways in PDLC mechanotransduction. Mol. Med. Rep. 2020, 21, 2113–2122. [Google Scholar] [CrossRef] [PubMed]
- Geng, J.; Shi, Y.; Zhang, J.; Yang, B.; Wang, P.; Yuan, W.; Zhao, H.; Li, J.; Qin, F.; Hong, L.; et al. TLR4 signalling via Piezo1 engages and enhances the macrophage mediated host response during bacterial infection. Nat. Commun. 2021, 12, 3519. [Google Scholar] [CrossRef]
- Mukhopadhyay, A.; Tsukasaki, Y.; Chan, W.C.; Le, J.P.; Kwok, M.L.; Zhou, J.; Natarajan, V.; Mostafazadeh, N.; Maienschein-Cline, M.; Papautsky, I.; et al. trans-Endothelial neutrophil migration activates bactericidal function via Piezo1 mechanosensing. Immunity 2024, 57, 52–67.e10. [Google Scholar] [CrossRef]
- Yudaev, P.A.; Chistyakov, E.M. Progress in dental materials: Application of natural ingredients. Russ. Chem. Rev. 2024, 93, RCR5108. [Google Scholar] [CrossRef]
- Liao, J.; Lu, W.; Chen, Y.; Duan, X.; Zhang, C.; Luo, X.; Lin, Z.; Chen, J.; Liu, S.; Yan, H.; et al. Upregulation of Piezo1 (Piezo Type Mechanosensitive Ion Channel Component 1) Enhances the Intracellular Free Calcium in Pulmonary Arterial Smooth Muscle Cells From Idiopathic Pulmonary Arterial Hypertension Patients. Hypertension 2021, 77, 1974–1989. [Google Scholar] [CrossRef]
- Nottmeier, C.; Lavicky, J.; Gonzalez Lopez, M.; Knauth, S.; Kahl-Nieke, B.; Amling, M.; Schinke, T.; Helms, J.; Krivanek, J.; Koehne, T.; et al. Mechanical-induced bone remodeling does not depend on Piezo1 in dentoalveolar hard tissue. Sci. Rep. 2023, 13, 9563. [Google Scholar] [CrossRef] [PubMed]
- Velasco-Estevez, M.; Rolle, S.O.; Mampay, M.; Dev, K.K.; Sheridan, G.K. Piezo1 regulates calcium oscillations and cytokine release from astrocytes. Glia 2020, 68, 145–160. [Google Scholar] [CrossRef]
- Jetta, D.; Bahrani Fard, M.R.; Sachs, F.; Munechika, K.; Hua, S.Z. Adherent cell remodeling on micropatterns is modulated by Piezo1 channels. Sci. Rep. 2021, 11, 5088. [Google Scholar] [CrossRef]
- McHugh, B.J.; Buttery, R.; Lad, Y.; Banks, S.; Haslett, C.; Sethi, T. Integrin activation by Fam38A uses a novel mechanism of R-Ras targeting to the endoplasmic reticulum. J. Cell Sci. 2010, 123, 51–61. [Google Scholar] [CrossRef] [PubMed]
- Gudipaty, S.A.; Lindblom, J.; Loftus, P.D.; Redd, M.J.; Edes, K.; Davey, C.F.; Krishnegowda, V.; Rosenblatt, J. Mechanical stretch triggers rapid epithelial cell division through Piezo1. Nature 2017, 543, 118–121. [Google Scholar] [CrossRef] [PubMed]
- Vogt, J.; Dingwell, K.S.; Herhaus, L.; Gourlay, R.; Macartney, T.; Campbell, D.; Smith, J.C.; Sapkota, G.P. Protein associated with SMAD1 (PAWS1/FAM83G) is a substrate for type I bone morphogenetic protein receptors and modulates bone morphogenetic protein signalling. Open Biol. 2014, 4, 130210. [Google Scholar] [CrossRef]
- Wu, K.Z.L.; Jones, R.A.; Tachie-Menson, T.; Macartney, T.J.; Wood, N.T.; Varghese, J.; Gourlay, R.; Soares, R.F.; Smith, J.C.; Sapkota, G.P. Pathogenic FAM83G palmoplantar keratoderma mutations inhibit the PAWS1:CK1alpha association and attenuate Wnt signalling. Wellcome Open Res. 2019, 4, 133. [Google Scholar] [CrossRef]
- Bozatzi, P.; Dingwell, K.S.; Wu, K.Z.L.; Cooper, F.; Cummins, T.D.; Hutchinson, L.D.; Vogt, J.; Wood, N.T.; Macartney, T.J.; Varghese, J.; et al. PAWS1 controls Wnt signalling through association with casein kinase 1. Embo Reports 2018, 19, e44807. [Google Scholar] [CrossRef]
- Liu, C.; Huang, X.-Y.; Huang, Y. FAM83G promotes proliferation, invasion, and metastasis by regulating PI3K/AKT signaling in hepatocellular carcinoma cells. Biochem. Biophys. Res. Commun. 2021, 567, 63–71. [Google Scholar] [CrossRef]
- Min, D.; Byun, J.; Lee, E.-J.; Khan, A.A.; Liu, C.; Loudig, O.; Hu, W.; Zhao, Y.; Herlyn, M.; Tycko, B.; et al. Epigenetic Silencing of BMP6 by the SIN3A-HDAC1/2 Repressor Complex Drives Melanoma Metastasis via FAM83G/PAWS1. Mol. Cancer Res. 2022, 20, 217–230. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.; Lai, S.; Cai, Y.; Huang, Z.; Li, Y.; Chen, S.; Zhang, Z.; Ye, Z.; Lai, X.; Zhai, E.; et al. Comprehensive Analysis and Identification of Prognostic Biomarkers and Therapeutic Targets Among FAM83 Family Members for Gastric Cancer. Front. Cell Dev. Biol. 2021, 9, 719613. [Google Scholar] [CrossRef] [PubMed]






| Antibodies | Dilution | Purchased From |
|---|---|---|
| anti-Cytokeratin primary antibody | 1:100 for IF | Boster Bio, Wuhan, Hubei, China (PB9715) |
| anti-Vimentin primary antibody | 1:100 for IF | Boster Bio, Wuhan, Hubei, China (PB9359) |
| anti-Piezo1 primary antibody | 1:500 for WB 1:50 for IHC/IF | Proteintech, Rosemont, IL, USA (15939-1-AP) |
| anti-DSPP primary antibody * | 1:500 for WB 1:200 for IF | Santa Cruz, Santa Cruz, CA, USA (LFMb-21) |
| anti-DMP1 primary antibody ** | 1:1000 for WB 1:200 for IF | Affinity, Lexington, MA, USA (DF8825) |
| anti-ACTB primary antibody | 1:1000 for WB | Affinity, Lexington, MA, USA (AF7018) |
| anti-FAM83G primary antibody | 1:500 for WB | Invitrogen, Carlsbad, CA, USA (PA5-54775) |
| Dylight 488/594 conjugated secondary antibody | 1:200 | EarthOx, Burlingame, CA, USA (E032220, E032410) |
| HRP-conjugated secondary antibodies | 1:1000 | Beyotime, Shanghai, China (A0208, A0350) |
| FITC anti-CD44-IgG2a antibody | 5 μL/test | Elabscience, Wuhan, Hubei, China (E-AB-F1225C) |
| FITC anti-CD45-IgG1 antibody | 5 μL/test | Elabscience, Wuhan, Hubei, China (E-AB-F1227C) |
| FITC anti-CD90-IgG1 antibody | 5 μL/test | Elabscience, Wuhan, Hubei, China (E-AB-F1226C) |
| PE anti-CD29-IgG antibody | 5 μL/test | Elabscience, Wuhan, Hubei, China (E-AB-F1309D) |
| PE anti-CD34-IgG2a antibody | 5 μL/test | Elabscience, Wuhan, Hubei, China (E-AB-F1284UD) |
| Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| Piezo1 | TTGCGTACGTTCACGAAGGA | TTCGCTCACGTAAAGCTGGT |
| Dspp | ACAGCGACAGCGACGATTC | CCTCCTACGGCTATCGACTC |
| Dmp1 | ACCAAAATACTGAATCTGAAAGCTC | TGCTGTCCGTGTGGTCACTA |
| Alp * | GGAAGGAGGCAGGATTGA | TCAGCAGTAACCACAGTCA |
| Fam83g | CGTACAGGTCAATCTGGGGG | GGGAGAGGGGTCTCGTTTCT |
| Actb | CGGTCAGGTCATCACTATC | CAGCACTGTGTTGGCATA |
| Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| si-NC | UUCUCCGAACGUGUCACGUTT | ACGUGACACGUUCGGAGAATT |
| si-Piezo1 1 | UGGCGCCGGCCAUCUUGUUUGUUUA | UAAACAAACAAGAUGGCCGGCGCCA |
| si-Piezo1 2 | UGGUACUUCGUGAAGUGCAUUUACU | AGUAAAUGCACUUCACGAAGUACCA |
| si-Piezo1 3 | CCGUCAUCAUCUCUAAGAAUAUGUU | AACAUAUUCUUAGAGAUGAUGACGG |
| si-FAM83G 1 | CAGGAGCUGUACCUUAUGUTT | ACAUAAGGUACAGCUCCUGTT |
| si-FAM83G 2 | GGGCCAACAUGUUUGAGUATT | UACUCAAACAUGUUGGCCCTT |
| si-FAM83G 3 | CAGGGACUCACAGGAUAUATT | UAUAUCCUGUGAGUCCCUGTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sheng, X.; Li, J.; Ma, H.; He, H.; Liu, Q.; Jia, S.; Zhang, F.; Huang, F. Piezo1 Regulates Odontogenesis via a FAM83G-Mediated Mechanism in Dental Papilla Cells In Vitro and In Vivo. Biomolecules 2025, 15, 316. https://doi.org/10.3390/biom15030316
Sheng X, Li J, Ma H, He H, Liu Q, Jia S, Zhang F, Huang F. Piezo1 Regulates Odontogenesis via a FAM83G-Mediated Mechanism in Dental Papilla Cells In Vitro and In Vivo. Biomolecules. 2025; 15(3):316. https://doi.org/10.3390/biom15030316
Chicago/Turabian StyleSheng, Xinyue, Jingzhou Li, Haozhen Ma, Hongwen He, Qin Liu, Shilin Jia, Fuping Zhang, and Fang Huang. 2025. "Piezo1 Regulates Odontogenesis via a FAM83G-Mediated Mechanism in Dental Papilla Cells In Vitro and In Vivo" Biomolecules 15, no. 3: 316. https://doi.org/10.3390/biom15030316
APA StyleSheng, X., Li, J., Ma, H., He, H., Liu, Q., Jia, S., Zhang, F., & Huang, F. (2025). Piezo1 Regulates Odontogenesis via a FAM83G-Mediated Mechanism in Dental Papilla Cells In Vitro and In Vivo. Biomolecules, 15(3), 316. https://doi.org/10.3390/biom15030316

