Identification of Quantitative Trait Loci and Analysis of Novel Candidate Genes for Resistance to False Smut of Rice Based on SSR Molecular Markers
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials and Pathogen Culture
2.2. Evaluation of Field Resistance to U. virens
2.3. DNA Extraction and SSR Analysis
2.4. Linkage Map Construction and QTL Analysis
2.5. Candidate Gene Identification
2.6. Expression Analysis of Predicted Candidate Genes
3. Results
3.1. Phenotypic Analysis of QTL Populations Resistant to Rice False Smut
3.2. Screening of Polymorphic SSR Molecular Markers
3.3. Population Genotype Analysis and Genetic Linkage Map Construction
3.4. Screening of SSR Markers for RFS Resistance
3.5. QTL Mapping of Rice False Smut Resistance Genes in Rice
3.6. Analysis of Candidate Genes for Resistance to Rice False Smut
3.7. Expression Analysis of Candidate Resistance Genes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ashizawa, T.; Takahashi, M.; Arai, M.; Arie, T. Rice false smut pathogen, Ustilaginoidea virens, invades through small gap at the apex of a rice spikelet before heading. J. Gen. Plant Pathol. 2012, 78, 255–259. [Google Scholar] [CrossRef]
- Sun, W.; Fan, J.; Fang, A.; Li, Y.; Tariqjaveed, M.; Li, D.; Hu, D.; Wang, W.M. Ustilaginoidea virens: Insights into an emerging rice pathogen. Annu. Rev. Phytopathol. 2020, 58, 363–385. [Google Scholar] [CrossRef] [PubMed]
- Hu, Z.; Zheng, L.; Huang, J.; Zhou, L.; Liu, C.; Liu, H. Ustiloxin A is produced early in experimental Ustilaginoidea virens infection and affects transcription in rice. Curr. Microbiol. 2020, 77, 2766–2774. [Google Scholar] [CrossRef]
- Shan, T.J.; Sun, W.B.; Wang, X.H.; Fu, X.X.; Sun, W.X.; Zhou, L.G. Purification of ustiloxins A and B from rice false smut balls by macroporous resins. Molecules 2013, 18, 8181–8199. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Qiu, J.H.; Xiong, M.; Shu, Y.Z.; Huang, S.W.; Kou, Y.J. Research progress of rice false smut. Chin. Rice 2019, 25, 30–36. (In Chinese) [Google Scholar]
- Zhang, Y.; Zhang, K.; Fang, A.; Han, Y.; Yang, J.; Xue, M.; Bao, J.; Hu, D.; Zhou, B.; Sun, X.; et al. Specific adaptation of Ustilaginoidea virens in occupying host florets revealed by comparative and functional genomics. Nat. Commun. 2014, 5, 3849. [Google Scholar] [CrossRef]
- Zhou, Y.; Yu, J.; Pan, X.; Yu, M.; Du, Y.; Qi, Z.; Zhang, R.; Song, T.; Yin, X.; Liu, Y. Characterization of propiconazole field-resistant isolates of Ustilaginoidea virens. Pestic. Biochem. Physiol. 2019, 153, 144–151. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.L.; Xue, Q.Z.; Luo, L.J.; Li, Z.K. Preliminary report on quantitative trait loci mapping of false smut resistance using near-isogenic introgression lines in rice. Acta Agric. Zhejiangensis 2002, 14, 14–19. (In Chinese) [Google Scholar]
- Andargie, M.; Li, L.; Feng, A.; Zhu, X.; Li, J. Mapping of the quantitative trait locus (QTL) conferring resistance to rice false smut disease. Curr. Plant Biol. 2018, 15, 38–43. [Google Scholar] [CrossRef]
- Yang, D.W.; He, N.Q.; Huang, F.H.; Jin, Y.D.; Li, S.P. The genetic mechanism of the immune response to the rice false smut (RFS) Fungus Ustilaginoidea virens. Plants 2023, 12, 741. [Google Scholar] [CrossRef]
- Li, Y.S.; Huang, S.D.; Yang, J.; Wang, C.L. Analysis of Quantitative Trait Loci for Resistance to Rice False Smut. Acta Agron. Sin. 2011, 37, 778–783. [Google Scholar] [CrossRef]
- Han, Y.; Li, D.; Yang, J.; Huang, F.; Sheng, H.; Sun, W. Mapping quantitative trait loci for disease resistance to false smut of rice. Phytopathol. Res. 2020, 2, 20. [Google Scholar] [CrossRef]
- Hiremath, S.S.; Bhatia, D.; Jain, J.; Hunjan, M.S.; Kaur, R.K.; Zaidi, N.W.; Singh, U.S.; Zhou, B.; Lore, J.S. Identification of potential donors and QTLs for resistance to false smut in a subset of rice diversity panel. Eur. J. Plant Pathol. 2021, 159, 461–470. [Google Scholar] [CrossRef]
- Qiu, J.; Lu, F.; Wang, H.; Xie, J.; Wang, C.; Liu, Z.; Meng, S.; Shi, H.; Shen, X.; Kou, Y.J. A candidate gene for the determination of rice resistant to rice false smut. Mol. Breed. 2020, 40, 105. [Google Scholar] [CrossRef]
- Neelam, K.; Kumar, K.; Kaur, A.; Kishore, A.; Kaur, P.; Babbar, A.; Kaur, G.; Kamboj, I.; Lore, J.S.; Vikal, Y.; et al. High-resolution mapping of the quantitative trait locus (QTLs) conferring resistance to false smut disease in rice. J. Appl. Genet. 2022, 63, 35–45. [Google Scholar] [CrossRef] [PubMed]
- Govindaiah, M.D.; Selvaraj, R.; Kadirimangalam, S.R.; Sundararajan, A.; Nachimuthu, V.V.; Swaminathan, M.; Ayyasamy, R.; Natarajan, D.; Ramasamy, S.; Dharmaraj, D.; et al. Genetic dissection of false smut resistance in rice through genome wide association mapping. J. Phytopathol. 2022, 170, 282–299. [Google Scholar] [CrossRef]
- Huang, Y.F.; Cai, K.X.; Zhang, Z.; Chai, R.Y.; Xie, H.G.; Shou, J.Y.; Fu, J.R.; Li, G.L.; Liu, J.Y.; Wu, S.Q.; et al. Identification and fine-mapping of quantitative trait loci (QTL) conferring rice false smut resistance in rice. J. Genet. Genom. 2023, 50, 276–279. [Google Scholar] [CrossRef] [PubMed]
- Fu, R.T.; Zhao, L.Y.; Chen, C.; Wang, J.; Lu, D.H. Conjunctive analysis of BSA-Seq and SSR markers unveil the candidate genes for resistance to rice false smut. Biomolecules 2024, 14, 79. [Google Scholar] [CrossRef] [PubMed]
- Röder, M.S.; Korzun, V.; Wendehake, K.; Plaschke, J.; Tixier, M.H.; Leroy, P.; Ganal, M.W. A microsatellite map of wheat. Genetics 1998, 149, 2007–2023. [Google Scholar] [CrossRef] [PubMed]
- Ashkani, S.; Rafi, M.Y.; Rahim, H.A.; Latif, M.A. Mapping of the quantitative trait locus (QTL) conferring partial resistance to rice leaf blast disease. Biotechnol. Lett. 2013, 35, 799–810. [Google Scholar] [CrossRef]
- Wu, S.J.; Zhong, H.; Zhou, Y.; Zuo, H.; Zhou, L.H.; Zhu, J.Y.; Ji, C.-Q.; Gu, S.-L.; Gu, M.-H. Identification of QTLs for the resistance to rice stripe virus in the indica rice variety Dular. Euphytica 2009, 165, 557–565. [Google Scholar] [CrossRef]
- Channamallikarjuna, V.; Sonah, H.; Prasad, M.; Rao, G.J.N.; Chand, S.; Upreti, H.C.; Singh, N.K.; Sharma, T.R. Identification of major quantitative trait loci qSBR11-1 for sheath blight resistance in rice. Mol. Breed. 2010, 25, 155–166. [Google Scholar] [CrossRef]
- Murray, M.G.; Thompson, W.F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980, 8, 4321–4325. [Google Scholar] [CrossRef]
- Lim, S.E.; Sa, J.K.; Lee, J.K. Bulk segregant analysis identifies SSR markers associated with leaf-and seed-related traits in Perilla crop (Perilla frutescens L.). Genes Genom. 2021, 43, 323–332. [Google Scholar] [CrossRef] [PubMed]
- Meng, L.; Li, H.H.; Zhang, L.Y.; Wang, J.K. QTL IciMapping: Integrated software for genetic linkage map construction and quantitative trait locus mapping in biparental populations. Crop J. 2015, 3, 269–283. [Google Scholar] [CrossRef]
- McCough, S.R.; Doerge, R.W. QTL mapping in rice. Trends Genet. 1995, 11, 482–487. [Google Scholar] [CrossRef]
- Fu, R.T.; Chen, C.; Wang, J.; Zhao, L.Y.; Chen, X.J.; Lu, D.H. Evaluation and screening of rice germplasm resources resistant to rice false smut. J. South. Agric. 2022, 53, 78–87. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real time quantitative PCR and the 2−∆∆CT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Rahman, M.A.; Thomson, M.J.; De Ocampo, M.; Egdane, J.A.; Salam, M.A.; Shah-E-Alam, M.; Ismail, A.M. Assessing trait contribution and mapping novel QTL for salinity tolerance using the Bangladeshi rice landrace capsule. Rice 2019, 12, 63. [Google Scholar] [CrossRef] [PubMed]
- Chen, Q.Q.; Zhang, Y.S. Distorted segregation and construction of molecular linkage map of SSR markers in Indica rice. Mol. Plant Breed. 2009, 7, 685–689. (In Chinese) [Google Scholar]
- Jia, Q.; Xiao, Z.X.; Wong, F.L.; Sun, S.; Liang, K.J.; Lam, H.M. Genome-wide analyses of the soybean F-box gene family in response to salt stress. Int. J. Mol. Sci. 2017, 18, 818. [Google Scholar] [CrossRef] [PubMed]
- Stone, S.L. The role of ubiquitin and the 26S proteasome in plant abiotic stress signaling. Front. Plant Sci. 2014, 16, 135. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.; Yang, Y.; Zhang, H.; Li, D.Y.; Zheng, Z.; Song, F.M. Overexpression of a rice defense related F-box protein gene OsDRF1 in tobacco improves disease resistance through potentiation of defense gene expression. Physiol. Plant. 2008, 134, 440–452. [Google Scholar] [CrossRef]
- Ambawat, S.; Sharma, P.; Yadav, N.R. MYB transcription factor genes as regulators for plant responses: An overview. Physiol. Mol. Biol. Plants 2013, 19, 307–321. [Google Scholar] [CrossRef] [PubMed]
- Raffaele, S.; Rivas, S.; Roby, D. An essential role for salicylic acid in AtMYB30-mediated control of the hypersensitive cell death program in Arabidopsis. FEBS Lett. 2006, 580, 3498–3504. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.M.; Zhang, S.Q. Mitogen-activated protein kinase cascades in plant signaling. J. Integr. Plant Biol. 2022, 64, 301–341. [Google Scholar] [CrossRef]





| Genes | Primers (5′–3′) | Log2FC (RNA-Seq) | Log2FC (RT-qPCR) | ||
|---|---|---|---|---|---|
| IR77298-14-1-2::IRGC117374-1 | 9311 | IR77298-14-1-2::IRGC117374-1 | 9311 | ||
| LOC_Os03g25240 | F-GACGACCTGGTCGAGGAGATC | 2.7293 | 0.2318 | 2.8109 | 0.5013 |
| R-GCCAAACAGAATGTGCGCTGCGC | |||||
| LOC_Os03g25304 | F-CCGTCTTCCGCGGAGGCGGCGG | 3.9273 | 0.3813 | 3.3146 | 0.2286 |
| R-TGCTGATGTCCTTCCACGACC | |||||
| LOC_Os03g25400 | F-GAGAGGAACCTGCTGCGGTCGGC | 2.3231 | 0.8712 | 1.8046 | 0.612 |
| R-AGCATGTTGAGCCACCAGCAT | |||||
| Primer | Chromosome | Forward Primer | Reverse Primer |
|---|---|---|---|
| RM5310 | 1 | GGGACCAAGACCTTTCCAATGC | GCGGAAGCAGGAGAATCGTAGC |
| RM3825 | 1 | CCACTAGCAGATGATCACAGACG | GAGCACCTCATAAGGGTTTCAGC |
| RM15066 | 3 | GCCGCAGTTGAGAGAACTCTTCC | GAGACGCGGATGACGAGACG |
| RM6959 | 3 | GATTCCTATGGAGGATTGTTGC | AACTCCACCGGTGTTAAGAAGG |
| RM5311 | 5 | CGTCTTGTCTAATCAGCTTAGGG | CACATCAAAGATATCGGGTTGG |
| RM5968 | 5 | GGGTTACTGCACTACGGCATCG | GGTGGTGAATGGAAGGATCATGG |
| RM29185 | 12 | CCTAGTTCAGCTCCTGCTTACC | CTCAGATGTAGGGAATGTTTGC |
| RM5341 | 12 | CATCCGGAGGAAGTTTGAAAGAAGG | CAAGGGCAACCTCTTCCACTACGC |
| Traits | QTL | Chr. | Linkage Marker Flanking | LOD Value | Phenotypic Variance (%) | Additive Effect | Dom |
|---|---|---|---|---|---|---|---|
| F2 | qRFS1.01 | 1 | RM5310–RM3825 | 8.78 | 6.63 | 6.04 | 10.59 |
| qRFS3.01 | 3 | RM15066–RM6959 | 10.67 | 37.73 | 21.72 | 10.91 | |
| qRFS5.01 | 5 | RM5311–RM5968 | 5.81 | 9.74 | 10.82 | −1.79 | |
| qRFS12.01-1 | 12 | RM5341–RM28195 | 8.26 | 29.74 | 9.56 | 10.775 | |
| F4 | qRFS3.01 | 3 | RM15066–RM6959 | 12.64 | 45.73 | 23.52 | 10.91 |
| qRFS12.01-1 | 12 | RM5341–RM28195 | 2.76 | 19.74 | 9.56 | 9.77 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fu, R.; Zhao, L.; Chen, C.; Wang, J.; Chen, Y.; Lu, D. Identification of Quantitative Trait Loci and Analysis of Novel Candidate Genes for Resistance to False Smut of Rice Based on SSR Molecular Markers. Biomolecules 2025, 15, 186. https://doi.org/10.3390/biom15020186
Fu R, Zhao L, Chen C, Wang J, Chen Y, Lu D. Identification of Quantitative Trait Loci and Analysis of Novel Candidate Genes for Resistance to False Smut of Rice Based on SSR Molecular Markers. Biomolecules. 2025; 15(2):186. https://doi.org/10.3390/biom15020186
Chicago/Turabian StyleFu, Rongtao, Liyu Zhao, Cheng Chen, Jian Wang, Yu Chen, and Daihua Lu. 2025. "Identification of Quantitative Trait Loci and Analysis of Novel Candidate Genes for Resistance to False Smut of Rice Based on SSR Molecular Markers" Biomolecules 15, no. 2: 186. https://doi.org/10.3390/biom15020186
APA StyleFu, R., Zhao, L., Chen, C., Wang, J., Chen, Y., & Lu, D. (2025). Identification of Quantitative Trait Loci and Analysis of Novel Candidate Genes for Resistance to False Smut of Rice Based on SSR Molecular Markers. Biomolecules, 15(2), 186. https://doi.org/10.3390/biom15020186
