1. Introduction
Dermatan sulfate (DS) is an unbranched copolymeric glycosaminoglycan (GAG) that is composed of two types of disaccharide units. Each of these units contains N-acetylgalactosamine (GalNAc) residue but differs in regard to hexuronate residue, which can be glucuronate (GlcA) or its 5C epimer iduronate (IdoA) [
1]. The majority of GalNAc residues as well as some hexuronate ones are modified by sulfation, which occurs on the hydroxyl group at the 4 and/or 6C or 2C position, respectively. These modifications, which are characterized by a variable pattern, promote a great reactivity of DS, facilitating its ionic interactions with many protein binding partners including growth factors, cytokines, cell surface receptors, adhesion molecules, enzymes or their effectors as well as the so-called structural proteins/glycoproteins of the extracellular matrix (ECM) [
1]. However, the binding profile of DS is variable depending on the variable sulfation and GlcA to IdoA epimerization patterns of this GAG, which causes the modulation of the biological functions of its binding partners. The above-mentioned characteristics of DS could position this GAG as a significant regulator of different biological processes. This possibility is further supported by the wide distribution of the GAG in animal tissues as a component of the ECM and cell-surface-located glycoproteins, which are called proteoglycans (PGs) [
2].
Tumorigenesis is a process that is associated with significant alterations in the DS (and DSPGs) metabolism [
3]. However, both the importance of the structural remodeling of DS and the consequences of increased DSPG degradation in the tumor niche that leads to an increased influx of DS to the cancer cell surface are poorly known. Our previous study showed [
4] that the structural variants of DS that originate from both non-neoplastic human tissues (normal fascia lata and fibrosis-affected palmar fascia) and porcine intestinal mucosa were able to rapidly induce moderate necroptosis in cultured luminal breast cancer cells when used at a high concentration, although the mechanisms that are responsible for this effect are unknown. Interestingly, the above-mentioned human variants of DS share some structural features with the GAG from the tumor microenvironment, such as a high content of unsulfated disaccharides and disaccharides with 6-O-sulfated GalNAc residue as well as a high proportion of glucuronate-containing disaccharides in the glycan chain composition [
3,
4].
Necroptosis is a lytic form of regulated cell death, which releases lysosomal components via the activation of lysosomal exocytosis, thereby generating a damage-associated molecular pattern and triggering the inflammatory process [
5]. Despite the fact that necroptosis is not necessary for normal embryogenesis, development and homeostasis, this death is an important mechanism in various processes, including pathological events, such as viral infections; chronic inflammation and fibrosis; acute injuries of the heart, kidney, lung and liver; neurodegenerative diseases, metabolic diseases as well as chemotherapy [
6]. Several extra- or intracellular stimuli can induce necroptosis including (1) the activation of various receptors such as death receptors, e.g., tumor necrosis factor (TNF) receptor 1, as well as some Toll-like receptors (TLRs) or interferon receptors [
6]; (2) the ligation of some adhesion molecules, e.g., CD11b and CD18 belonging to the integrin family [
7] or disturbances in the integrin-linked kinase-mediated transduction of signals from the integrin receptors [
8]; (3) metabolic events such as the mitochondrial overproduction of reactive oxygen species (ROS) [
9] or the activation of the Hippo/YAP pathway [
10]. However, the intracellular signaling or events that lead to the necroptosis induction are not yet fully clarified. Interestingly, the intracellular pathways, which are triggered via the activation of the TNFR1 death receptor or TLR4, serve to induce pro-survival signals by stimulating the NFkB activation, and the start of necroptosis is a rare effect of their initiation [
5]. Nevertheless, independent of the driving mechanisms, two elements are crucial for necroptosis to occur. The first is the receptor-interacting protein kinase 3 (RIPK3), belonging to the RIP homotypic interaction motif-containing proteins, which upon activation participates in the formation of a necrosome [
5]. This latter structure provides a platform for the recruitment of the mixed lineage kinase domain-like pseudokinase (MLKL) and its activation by phosphorylation at threonine 357 and serine 358 [
5]. When activated, MLKL undergoes oligomerization and translocation to the plasma membrane, where it executes necroptosis via a membrane rupture [
5].
DS is able to affect several of the above-mentioned factors, which can regulate the induction of necroptosis. In contrast to chondroitin sulfate (CS), which is structurally related to DS, this latter GAG has been shown to stimulate the activation of the NFκB pathway in some cells [
11]. Moreover, DS can trigger oxidative stress in exposed luminal breast cancer cells [
4]. This redox imbalance is also observed in vitro and in vivo in cells, which accumulate DS due to the genetically conditioned defects in the lysosomal degradation of this GAG [
12,
13]. Furthermore, two DS-containing proteoglycans, decorin and biglycan, can cause the rearrangement of the actin cytoskeleton in fibroblasts as well as transiently stimulating the activity of RhoA and Rac1 in them [
14], which are small GTP-ases that are major regulators of cytoskeleton changes [
15]. Thus, these results suggest that both PGs could affect the activity of integrins, which directly control the actin cytoskeleton architecture. All of these reports prompted us to explore whether the DS variants of a known structure that had previously been shown to quickly induce necroptosis and/or significantly reduce the viability of luminal breast cancer cells could influence the activity of NFκB, cause a rapid redox imbalance as well change the actin cytoskeleton arrangement in those cells. Furthermore, we wanted to elucidate whether such DS-induced events could underlie the DS-dependent activation of the necroptotic effector MLKL. In addition, we also aimed to investigate whether the tested DS variants could affect the RIPK3 gene expression.
2. Materials and Methods
2.1. The Structural Variants of DS
DS variants from the porcine intestinal mucosa (PM; Cat# C4384, Sigma-Aldrich, St. Louis, MO, USA), human fibrosis-affected palmar fascia (DF) and normal human fascia lata (NF) were used in the present study. The study protocol was approved by the local Bioethics Committee of the Medical University of Silesia in Katowice (permission no. PCN/CBN/0052/KB1/52/22). The procedures for isolating and purifying the human variants as well as their structural analysis were described previously [
4].
2.2. Cell Lines
The luminal breast cancer cell lines BT-474 (HTB-20) and T47D (HTB-133) were obtained from the American Type Culture Collection. The cells were cultured, respectively, in DMEM/F12 (Cat# D8437, Sigma-Aldrich, St. Louis, MO, USA) or an RPMI-1640 (Cat# R8758, Sigma-Aldrich, St. Louis, MO, USA) medium that had been supplemented with 10% fetal bovine serum (FBS; Cat# S181H, Biowest, Riverside, MO, USA), MycoZap Plus-CL (Cat# VZA-2012, Lonza, Rockville, MD, USA) and insulin (5 μg/mL for BT-474 and 10 μg/mL for T47D) (Cat# BE02-033E20, Lonza, Rockville, MD, USA). The cells were grown at 37 °C in a 95% humidified atmosphere with 5% CO2 until they reached at least 80% confluency. They were then used.
2.3. Analysis of the DS-Mediated Activation of MLKL by Immunofluorescence
The BT-474 and T47D cells were seeded at a density of 6500 cells per well into eight-well glass chamber slides (Cat# 154534, Thermo Fischer Scientific, Rockville, MD, USA). After 24 h of incubation in the complete medium, the cells were transferred to a medium that had been supplemented with 0.5% FBS and allowed to grow for another 24 h. The cells were then exposed to a growth medium containing the tested DS variants at a concentration of 25 µg/mL for specified time periods as indicated in
Section 3. Subsequently, the cells were washed three times with PBS, fixed with 3.7% formaldehyde for ten min, permeabilized in 0.3% Triton X-100 for 15 min and blocked in PBS containing 3% bovine serum albumin (BSA) and 0.3% Triton X-100 (PBS-Trit buffer) for one hour at 21 °C. Then, the cells were incubated with the rabbit monoclonal anti-phospho-MLKL (S358) antibody (Cat# ab187091, Abcam, Cambridge, UK) in PBS-Trit overnight at 4 °C. The next step was an incubation with Alexa Fluor Plus 555-conjugated goat polyclonal anti-rabbit IgG (Cat# A32732, Thermo Fisher Scientific, Rockville, MD, USA) for one hour at room temperature. Finally, the cells were stained for 7 min with 1 µg/mL solution of Hoechst 33342 (Cat# H3570, Thermo Fisher Scientific, Rockville, MD, USA) and captured using a Leica DMI 6000B microscope (Leica Microsystems GmbH, Wetzlar, Germany). The images were quantified using Leica AS hardware version 3.2.1.9702 (Wetzlar, Germany). In some of the experiments, before the DS was applied, the cells were preincubated for three hours with 20 µM cardamonin (Cat# 2509, Tocris, Bristol, UK), 6 or 12 µM EHop 016 (Cat# 6248, Tocris, Bristol, UK), 30 µM rhosin hydrochloride (Cat# 5003, Tocris, Bristol, UK) or 1 mM N-acetylcysteine amide (NACA; Cat# 5619, Tocris, Bristol, UK). Then, the cells were treated for 3.5 h with a combination of each of these inhibitors and the individual DS variant (at a concentration of 25 µM/mL). Subsequently, the phosphorylation of MLKL was assessed as described above.
2.4. Analysis of the DS-Mediated Activation of MLKL by Western Blotting
The BT-474 cells were seeded into a six-well plate (Corning Incorporated, New York, NY, USA) and exposed to PM or NF at a concentration of 25 µg/mL for 3.5 h. After exhaustive rinsing, the cells were lysed in RIPA buffer (40 mM TrisHCl, pH 7.5, 0.15 M NaCl, 0.002 M EDTA, 0.5% Igepal CA630, 0.5% sodium, 0.1% sodium dodecyl sulfate (SDS) (all from Sigma-Aldrich, St. Louis, MO, USA) as well as protease (Mix M, Serva GmbH, Heidelberg, Germany) and phosphatase (Set III, Merck, Rahway, NJ, USA) inhibitor cocktails. The lysates were incubated for 30 min at 4 °C under agitation, and then centrifuged (15,000× g, 20 min, 4 °C). The protein concentration was measured in the supernatants obtained using a Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, Rockville, MD, USA). The aliquots containing 15 µg of protein were resolved using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) 4–20% MiniProtean TGX gel (Bio-rad, Hercules, CA, USA). Then, the resolved proteins were transferred onto Immobilon P membranes (Sigma-Aldrich, St. Louis, MO, USA) and probed overnight with the monoclonal rabbit anti-phospho-MLKL (S358) antibody (# ab187091, Abcam, Cambridge, UK) that was applied diluted at 1:1000 in TBST buffer (0.05 M TrisHCl buffer, pH 7.4, 0.15 M NaCl and 0.1% Tween 20) also containing 5% (w/v) Blot Quick Blocker (Millipore Corp., Billerica, MA, USA). Subsequently, after an intense washing, the membranes were treated for 1 h at room temperature with peroxidase-conjugated goat anti-rabbit immunoglobulin G antibodies (# A9169, Merck, Rahway, NJ, USA), diluted at 1:12,000 in a TBST buffer that was supplemented with 5% (w/v) Blot Quick Blocker. The immunoreactive phospho-MLKL protein was visualized using a 3,3′,5,5′-tetramethylbenzidine substrate (Merck, Rahway, NJ, USA). Before probing with the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibodies, the blots were stripped in a solution containing 1.5% glycine, 0.1% SDS, 1% Tween 20 and pH 2.2 for 10 min at room temperature and then re-blocked. Next, the blots were probed with rabbit polyclonal anti-GAPDH antibodies (# 2275, Trevigen, Gaithersburg, MD, USA) that had been diluted at 1:2500 followed by a secondary antibody as was described above.
2.5. Analysis of the DS Variant-Promoted Effects on the Nuclear Translocation of NFκB by Immunofluorescence
The cancer cells were cultured under the conditions described above. After the exposure to an individual DS variant for a specified period of time as indicated in
Section 3, the cells were fixed and permeabilized as described above. The cellular localization of NFκB was examined using 1.5 µg/mL of rabbit polyclonal anti-NFκB p65 antibodies (# ab16502, Abcam, Cambridge, UK) according to the procedure that was described above for the detection of phospho-MLKL by immunofluorescence.
2.6. Analysis of the DS Variant-Mediated Nuclear Translocation of NFκB by Western Blotting
The cells were seeded into a six-well plate (Corning Incorporated, New York, NY, USA) at a density of 89,000 cells per well. After exposure to the examined DS variants at a concentration of 25 µg/mL for 45 min (BT-474 line) or 30 min (T-47D line), the cells were intensively rinsed and treated with 0.05% trypsin for 3 min at 37 °C. The detached cells were scraped and transferred to tubes containing PBS with 10% FBS to neutralize trypsin. Subsequently, the cells were centrifuged (450× g, 5 min, room temperature), rinsed with PBS and again centrifuged under the same conditions. Cellular pellets were suspended in 10 mM HEPES buffer, pH 7.9, containing 10 mM KCl, 1 mM EDTA and protease (Mix M, Serva GmbH, Heidelberg, Germany) and phosphatase (Set III, Merck, Rahway, NJ, USA) inhibitor cocktails and allowed to swell on ice for 25 min. Then, the cells were homogenized using a syringe with a narrow-gauge (no. 27) hypodermic needle. The disrupted cells were centrifuged (12,000× g, 10 min, 4 °C), and the supernatants were discarded. The obtained pellets that contained a nuclear fraction were then lysed in RIPA buffer, containing 20 mM TrisHCl pH 7.5, 150 mM NaCl, 0.1% SDS, 0.5% Igepal CA630, 0.5% sodium deoxycholate (all from Sigma-Aldrich, St. Louis, MO, USA) and protease inhibitor cocktail (Mix M, Serva GmbH, Heidelberg, Germany) for 30 min, at 4 °C, under agitation. Nuclear proteins were separated by centrifugation (21,000× g, 10 min, 4 °C), and, after the measuring of their content by a Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, Rockville, MD, USA), they were resolved by SDS-PAGE as described above. Then, after transfer onto Immobilon P membranes (Sigma-Aldrich, St. Louis, MO, USA), the proteins were probed overnight with the polyclonal rabbit anti-NFκB p65 antibodies (# ab16502, Abcam, Cambridge, UK) at a concentration of 0.5 µg/mL and submitted to a further procedure as described above. Subsequently, the blots were striped and probed with a mouse monoclonal anti-histone 3 antibody (# 309551, Abcam, Cambridge, UK) that had been diluted at 1:1000, followed by a secondary antibody (goat anti-mouse antibodies conjugated with horseradish peroxidase (# A2304, Merck, Rahway, NJ, USA)) at a dilution of 1:80,000.
2.7. Estimation of the DS Effect on the Organization of Actin Cytoskeleton
The breast cancer cells were seeded on eight-well glass chamber slides (Cat# 154534, Thermo Fischer Scientific, Rockville, MD, USA) and exposed to the DS variants for the appropriate period of time. Then, after washing three times with PBS, the cells were fixed with 3.7% formaldehyde for 10 min, permeabilized in 0.3% Triton X-100 for 5 min and preincubated with PBS containing 1% BSA for 30 min. The actin cytoskeleton of the cells was stained with an Alexa Fluor 488 phalloidin (Cat# A12379, Thermo Fisher Scientific, Rockville, MD, USA) solution (1.5 units of phalloidin per well) in PBS containing 1% BSA for 20 min at room temperature. Finally, after the nuclei were stained with Hoechst 33342, images of the cells were taken using a Leica DMI 6000B microscope (Leica Microsystems GmbH, Wetzlar, Germany).
2.8. Fluorescence Analysis of the Oxidative Stress
The breast cancer cells were seeded on eight-well glass chamber slides (Cat# 154534, Thermo Fischer Scientific, Rockville, MD, USA) and exposed to the DS variants at a concentration of 25 µg/mL for an appropriate period of time as indicated in
Section 3. Then, after intense washing three times with PBS, the cells were incubated with a growth medium containing 5 μM of CellROX Orange Reagent (Cat# C10443, Thermo Fischer Scientific, Rockville, MD, USA) for 30 min at 37 °C, followed by Hoechst 33342 staining. Images of the stained cells were captured using a Leica DMI 6000B microscope (Leica Microsystems GmbH, Wetzlar, Germany). In some experiments, before the DS was applied, the cells were first preincubated for 3 h with 6 or 12 µM EHop 016 (Tocris, Bristol, UK) and then exposed to the combined action of EHop 016 and an individual DS variant. The ROS production in these cells was assessed as described above.
2.9. Quantitative Analysis of the RIPK3 Expression
The breast cancer cells were seeded into a 24-well plate at a density of 18,000 cells per well and allowed to grow for 48 h as described above. Then, the cells were exposed to an individual DS variant and/or the appropriate inhibitor (cardamonin, EHop 016 or rhosin (Tocris, Bristol, UK)). After this time, the total RNA was isolated using the NucleoZOL reagent (Macherey-Nagel, Allentown, PA, USA) according to the manufacturer’s protocol. The obtained RNA extracts were subjected to DNA-se I in order to remove any contamination with genomic DNA. The integrity of the total RNA was assessed electrophoretically. The mRNA copy number for RIPK3 was determined using RT-qPCR based on the specific primers (KiCqStart® SYBR® Green Primers, Merck, Rahway, NJ, USA) with the following sequences: 5′AACTTTCAGAAACCAGATGC3′ (forward primer (sense)) and 5′GTTGTATATGTTAACGAGCGG3′ (reverse primer (antisense)) according to the manufacturer’s protocol. The gene expression was analyzed using a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA) sequence detector. Negative controls without RNA were included in each run of the RT-qPCR. A melting-curve analysis was performed to confirm the RT-qPCR specificity. The results were analyzed using a Bio-Rad CFX Manager v.3.1 (Hercules, CA, USA). The relative gene expression was obtained after normalization with the endogenous control, a gene for human Tata Binding Protein (TBP), and the difference in the threshold cycle (CT) between the treated and untreated cells was determined using the 2−∆∆CT method. Each of the data points for the mRNA copy numbers is the average of the duplicates on the same analyzed plate.
2.10. Statistical Analysis
The data were analyzed using the Statistica 13.3 application (TIBCO Software Inc., Cracow, Poland). The normality of the distribution was verified using the Shapiro–Wilk test, whereas the variance homogeneity was analyzed using the Levene’s test. The data were summarized as (1) the mean ± standard error of the mean (SEM) in cell culture experiments or (2) the mean ± standard deviation (SD) in RIPK3 expression experiments and in Western blot analysis. The between-group comparisons were assessed based on a one-way ANOVA and the post-hoc Tuckey’s test with p ≤ 0.05 as being significant. The between-group differences for the non-parametric data were estimated using the Kruskal–Wallis test by ranks with p ≤ 0.05 as being significant.
4. Discussion
DS is an important component not only of the extracellular matrix in normal tissues, but it also accumulates in the tumor microenvironment. Our present examinations together with our previous results [
4] indicated that at least certain structural variants of DS can significantly stimulate the activation of the necroptotic effector MLKL in various luminal breast cancer cell lines, including both the primary tumor and metastatic cells. Moreover, the mode of the manifestation of this DS-dependent activation is also similar in different luminal breast cancer cells, which is reflected in the co-occurrence of two types of structures containing MLKL phosphorylated at S358: the more common fine-grained structures and the rarer large aggregates. Only the level of this latter form of activated MLKL correlated with the number of dying, annexin-positive cancer cells in the previous study [
4], which suggests that such structures represent the phospho-MLKL oligomers that are responsible for the execution of necroptosis. In turn, the role of the fine-grained phospho-MLKL in luminal breast cancer cells remains unclear. However, it is known that the activated MLKL can also perform other non-necroptotic functions such as participating in endosomal trafficking and receptor recycling or the ESCRT (Endosomal Sorting Complexes Required for Transport)-dependent repair of the plasma membrane and release of extracellular vesicles as well as inhibiting autophagic flux or affecting gene induction (for review: [
23]).
In the present study, we used previously tested structural variants of DS to investigate the mechanism(s) that are implicated in this glycan-promoted phosphorylation of MLKL. The variants tested clearly differed in their epimerization and sulfation patterns [
4]. In contrast to PM, which had the highest content of both disaccharides with iduronate residue and 4-O-sulfated disaccharides and was almost devoid of unsulfated disaccharides, NF and especially DF were characterized not only by higher levels of unsulfated disaccharides but also by a markedly higher proportion of hybrid structure, i.e., CS/DS in their chains [
4]. The current investigation using these variants clearly indicates that the two intracellular events that are triggered by them in luminal breast cancer cells are principally responsible for the ability of these molecules to induce MLKL phosphorylation. The first of these processes, i.e., the activation of NFκB exerts a suppressive effect, whereas oxidative stress has a stimulatory impact as evidenced by the influence of the pharmacological inhibition of these processes on the MLKL phosphorylation that was promoted by the DS variants. Moreover, at least in the metastatic T-47D cancer line, the DS variants also increased the expression of
RIPK3 via the pathways that require the activity of the small Rho GTP-ases and that are also regulated by NFκB.
Many breast cancer cells exhibit a constitutively increased activation of NFκB [
16]. This transcription factor plays a key role at every stage of tumorigenesis by stimulating the proliferation and survival of cells in the cancer microenvironment via the induction of inflammation and the promotion of angiogenesis as well as facilitating metastasis and triggering a resistance to treatment [
24,
25]. To the best of our knowledge, the impact of DS on the activity of NFκB in cancer cells has not previously been examined. Our study shows that the dynamics of this process clearly depends on the structure of DS and the type of cancer cells. NF and DF induced the activation of NFκB in the form of one or two short-lived waves of the nuclear relocation of this factor, respectively, during the observation period. Interestingly, the activating effect that was exerted by these variants, sharing the above-mentioned features of their sulfation and glucuronosyl epimerization patterns with DS from the tumor niche, was most potent in the more aggressive breast cancer cells, i.e., T-47D. In contrast, PM, which was characterized by a structure typical of DS from normal tissues, caused a rather slowly increasing stimulation of NFκB activation that was more pronounced in the less aggressive breast cancer cells, i.e., BT-474, compared to NF- or DF-promoted effect. This relationship between the DS structure and its effect on the NFκB activation was further reflected in the observed pronounced impact of the pharmacological inhibition of this process on the PM- and DF-induced activations of MLKL in BT-474 and T-47D, respectively. In addition, different patterns of the nuclear translocation of NFκB, which were triggered by PM and DF in the T-47D cells, might contribute to the observed distinct effects of these variants on the NFκB-dependent expression of
RIPK3. On the other hand, the relationship between the structure of DS and its impact on NFκB activation, which we found in breast cancer cells differing in their aggressiveness, points to the importance of the structural remodeling of this glycan, which is observed in the cancer microenvironment, to generate stimuli that support the survival of cancer cells at different stages of tumor development. Interestingly, a similar relationship between the structure of the DS variant and its biological effect in the breast cancer lines with various degrees of aggressiveness, as observed in the case of NFκB activation, was also noted regarding the influence of the tested glycans on the actin cytoskeleton rearrangement and oxidative stress induction. However, it is unclear whether all of these effects are triggered via interactions of the tested DS variants with a single type of cell surface receptor or by completely separate mechanisms. In addition to the different responsiveness of BT-474 and T-47D to the structurally different DS variants, we also observed marked differences in both the dynamics and intensity of the effects that were induced by PM in both cell lines. These differences might result from several possible reasons including the following: (1) the distinct types of cell surface receptors that were involved in the interactions with this DS and (2) variations in the cellular metabolism, signaling pathways or cell cycle kinetics between the BT-474 and T-47D cells.
Cellular ROS not only accomplish detrimental functions, but they are also an important element in intracellular signaling pathways, which are especially involved in the growth factor action or adhesion [
26]. Moreover, many of the proteins that are engaged in signaling are redox sensors [
26]. Therefore, it was not unexpected that increased ROS production was also involved in the necroptotic events. However, the location of the oxidative stress in the pathway that leads to necroptosis can be different, depending on the cell type and also perhaps on the kind of stimulus that is triggering this death. In neutrophils, in which necroptosis was induced by the ligation of adhesion molecules following GM-CSF priming, oxidative stress was downstream of the activation of p38 MAPK and PI3K, which had been preceded by phosphorylation of RIPK3 and MLKL [
7]. However, it should be emphasized that the overproduction of ROS was necessary for necroptosis to occur in this cellular model [
7]. In contrast, the overproduction of mitochondrial ROS, which is essential for TNFα-induced necroptosis in several types of cells, led to the oxidation of RIPK1 followed by its autophosphorylation at serine161, which subsequently triggered the activation of RIPK3 first and then MLKL and the induction of necroptosis [
9]. Our data clearly indicate that the DS variant-induced redox imbalance is an event upstream of the MLKL activation that was promoted by these molecules in luminal breast cancer cells, although the involvement of oxidized RIPK1 in this process remains unknown. However, the significant but incomplete sensitivity of the DS-promoted MLKL phosphorylation to the universal ROS scavenger NACA in both tested breast cancer cell lines enabled us to conclude that the oxidative stress that is induced by this glycan is only the main, but not the only, event that is involved in the induction of necroptosis in these cells. Furthermore, our results clearly show that the triggering of the redox imbalance by the DS variants occurs downstream of the modulatory effect of these glycans on the activity of Rho GTP-ases, especially Rac1. This results from the fact that the pharmacological inhibition of this enzyme is already sufficient to completely abolish the DS-dependent ROS production in the exposed cells. In addition, there is a visible correlation between the impact of the tested variants on the formation of lamellipodia-like projections, which is under the control of Rac1, and the ability of these glycans to induce oxidative stress in breast cancer cells.
Rho GTP-ases, including Rac1, have a wide range of functions beyond their influence on the organization of the actin cytoskeleton [
27]. In both phagocytic and non-phagocytic cells, it has been shown that Rac1 is required for the activity of NADPH oxidase as an activator of its NOX subunit [
28]. Thus, such a mechanism could explain the involvement of Rac1 in the DS-dependent induction of oxidative stress in luminal breast cancer cells. Interestingly, mitochondrion has been suggested as a source of ROS in the Rac-promoted stimulation of oxidative stress in rabbit fibroblasts [
29]. However, our previous report showed that the dynamics of the short-term effects of the DS variants on the mitochondrial membrane potential did not correlate with both occurrences of the redox imbalance and necroptosis induction that were triggered by these molecules in the luminal breast cancer cells [
4]. Hence, it is possible that the DS variant-triggered ROS overproduction recruits Rac1-dependent oxidase(s) with a different cellular localization, e.g., those that are present in the plasma/endosomal membrane.
Previous reports have shown that in contrast to Rac1, Cdc42 does not directly activate NADPH oxidase [
30]. However, only a combined overexpression of constitutively active Rac1 and Cdc42 significantly stimulates superoxide anion production in cardiomyocytes [
31]. In turn, our data suggest that the role of Rac1 and Cdc42 in controlling the redox balance in breast cancer cells might be complex. In addition to the involvement of the first enzyme in the DS-dependent induction of oxidative stress, both of these small GTP-ases rather reduce the ROS production at least in the T-47D cells. Such a conclusion can be drawn from the observed consequences of the pharmacological inhibition of these enzymes on the oxidative stress in the cancer cells. However, this finding requires further investigation. Nevertheless, Cdc42 (together with Rac1) plays a role at least in the DF variant-promoted activation of MLKL in the T-47D breast cancer cells. This is supported by our observation that only a simultaneous inhibition of both these small GTP-ases results in the complete suppression of this glycan-dependent process.
The ox-LDL-mediated overproduction of ROS in mesangial cells, which is dependent on the Rac1 activity, requires the activation of β4 integrin [
32]. Moreover, ligation, i.e., the activation after binding to the ECM ligand of the α5 integrin led to a Rac1-promoted increase in the ROS production in rabbit synovial fibroblasts [
29]. As all of the tested DS variants caused not only a Rac1-dependent induction of oxidative stress in the exposed breast cancer cells but also the rearrangement of the actin cytoskeleton, both of which are initiated by alterations in the integrin activity, we assume that these glycans could affect the function of those adhesion receptors at the surface of cancer cells. It has been shown that DS can directly influence the activity of β1 integrin most probably via a reduction of pH in the pericellular space [
33]. Furthermore, CS, which structurally is closely related to DS, especially the type that is termed oncofetal, can directly interact with integrins α4, α5β1 and β1 and affect integrin-mediated signaling [
34]. Moreover, both CS and DS can modulate the expression of some integrins on both the mRNA and protein levels in a manner that is dependent on the amount or structure of these glycans [
35,
36]. Thus, based on the observed differences between the DS variants, not only in terms of their effects on the processes requiring integrin activity but also taking into account the observed specific phase course of these glycan-induced rearrangements of actin cytoskeleton, it is tempting to speculate that the tested molecules might not only exhibit a different integrin binding profile, but they might also actively affect the expression of these adhesion receptors on the surface of luminal breast cancer cells. However, the observed DS variant-triggered alterations in the actin cytoskeleton of breast cancer cells may also result from the interaction of these glycans with CD44, which is an another adhesion molecule. DS has been reported to be a binding partner for this cell surface molecule [
37], which is not only capable of indirectly linking with actin filaments via interactions of its intracellular domain with ezrin/radixin/moesin, as well as ankyrin, but also can affect the activity of small Rho GTP-ases including Rac1 (for review [
38]). In concluding, it seems that the effect on adhesion receptors might play a fundamental role in the activation of MLKL and the induction of necroptosis that were triggered by high doses of DS in luminal breast cancer cells. Furthermore, the observed biological effect of DS on cancer cells suggests a certain application potential of this glycan in anticancer treatments because the induction of necroptosis in the tumor microenvironment may at least disturb, if not abolish, the immunological tolerance of the host towards transformed cells, which appear during the progression of the disease and constitute a significant therapeutic problem. However, further studies should be undertaken to elucidate the detailed mechanism of DS action and, especially, the relationship between the structure of this glycan and its biological properties.
In the present study, we almost exclusively used fluorescence microscopy, which is actually the technique of choice in experiments that require high concentrations of unique DS variants of a human origin. However, our investigations reveal a new, promising experimental model using BT-474 cells and commercially available PM, which enables the effect of DS on the necroptosis induction to be examined using other scientific methods.