Assessing the Impact of Bedaquiline, Clofazimine, and Linezolid on Mycobacterial Genome Integrity
Abstract
1. Introduction
2. Methods and Materials
2.1. Bacterial Strains, Media, Growth Conditions, and Viability Measurement
2.2. Microscopy Analysis
2.3. Mutation Accumulation (MA) Experiments
2.4. Assessment of Drug Tolerance Following MA Experiments
2.5. DNA Extraction
2.6. DNA Library Preparation and Whole Genome Sequencing
2.7. WGS Analysis and Mutation Identification
2.8. RNA Isolation, cDNA Synthesis and qPCR Experiments
2.9. dNTP Extraction and Determination of the Cellular dNTP Concentrations
2.10. Statistics
3. Results
3.1. Adapting Stress Conditions and Assessing Their Impact on Cell Viability
3.2. Genomic Stability of M. smegmatis Under Antibiotic Pressure
3.3. Distinct Activation Patterns in the DNA Repair System
3.4. dNTP Pool Reduction Is Induced by BDQ and CFZ
4. Discussion
4.1. Second Line Antituberculotics Do Not Increase Mutation Rates in M. smegmatis
4.2. Mutations in Transporter Proteins and Transcription Regulators Are Overweighted in BDQ Treatment Without Known Adaptive Changes Detected
4.3. Drugs Induce Specific Patterns in the DNA Repair Pathways
4.4. BDQ and CFZ Decrease the Available Cellular dNTP
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Doucet-Populaire, F.; Buriankova, K.; Weiser, J.; Pernodet, J.-L. Natural and acquired macrolide resistance in mycobacteria. Curr. Drug Targets Infect. Disord. 2002, 2, 355–370. [Google Scholar] [PubMed]
- Gygli, S.M.; Borrell, S.; Trauner, A.; Gagneux, S. Antimicrobial resistance in Mycobacterium tuberculosis: Mechanistic and evolutionary perspectives. FEMS Microbiol. Rev. 2017, 41, 354–373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dookie, N.; Rambaran, S.; Padayatchi, N.; Mahomed, S.; Naidoo, K. Evolution of drug resistance in Mycobacterium tuberculosis: A review on the hmolecular determinants of resistance and implications for personalized care. J. Antimicrob. Chemother. 2018, 73, 1138–1151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Z.-Y.; Sun, Z.-Q.; Wang, Z.-L.; Hu, H.-R.; Wen, Z.-L.; Song, Y.-Z.; Zhao, J.-W.; Wang, H.-H.; Guo, X.-K.; Zhang, S.-L. Identification and pathogenicity analysis of a novel non-tuberculous mycobacterium clinical isolate with nine-antibiotic resistance. Clin. Microbiol. Infect. 2013, 19, 91–96. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Verbenko, D.A.; Solomka, V.S.; Kozlova, I.V.; Kubanov, A.A. The genetic determinants of Mycobacterium leprae resistance to antimicrobial drugs. Vestn. Dermatol. I Venerol. 2021, 97, 54–62. [Google Scholar] [CrossRef] [Scilit]
- Global Tuberculosis Report 2023. Available online: https://www.who.int/teams/global-tuberculosis-programme/tb-reports/global-tuberculosis-report-2023 (accessed on 23 January 2024).
- Matteelli, A.; Carvalho, A.C.; E Dooley, K.; Kritski, A. TMC207: The first compound of a new class of potent anti-tuberculosis drugs. Futur. Microbiol. 2010, 5, 849–858. [Google Scholar] [CrossRef] [Scilit]
- Mahajan, R. Bedaquiline: First FDA-approved tuberculosis drug in 40 years. Int. J. Appl. Basic Med. Res. 2013, 3, 1–2. [Google Scholar] [CrossRef] [Scilit]
- Padmapriyadarsini, C.; Vohra, V.; Bhatnagar, A.; Solanki, R.; Sridhar, R.; Anande, L.; Muthuvijaylakshmi, M.; Rana, M.B.; Jeyadeepa, B.; Taneja, G.; et al. Bedaquiline, Delamanid, Linezolid and Clofazimine for Treatment of Pre-extensively Drug-Resistant Tuberculosis. Clin. Infect. Dis. 2022, 76, e938–e946. [Google Scholar] [CrossRef] [Scilit]
- Gopal, M.; Padayatchi, N.; Metcalfe, J.Z.; O’Donnell, M.R. Systematic review of clofazimine for the treatment of drug-resistant tuberculosis. Int. J. Tuberc. Lung Dis. 2013, 17, 1001–1007. [Google Scholar] [CrossRef] [Scilit]
- Sarathy, J.P.; Gruber, G.; Dick, T. Re-Understanding the Mechanisms of Action of the Anti-Mycobacterial Drug Bedaquiline. Antibiotics 2019, 8, 261. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Soni, V.; Marriner, G.; Kaneko, T.; Boshoff, H.I.M.; Barry, C.E.; Rhee, K.Y. Mode-of-action profiling reveals glutamine synthetase as a collateral metabolic vulnerability of M. tuberculosis to bedaquiline. Proc. Natl. Acad. Sci. USA 2019, 116, 19646–19651. [Google Scholar] [CrossRef] [Scilit]
- Hashemian, S.M.; Farhadi, T.; Ganjparvar, M. Linezolid: A review of its properties, function, and use in critical care. Drug Des. Dev. Ther. 2018, 12, 1759–1767. [Google Scholar] [CrossRef] [Scilit]
- Stadler, J.A.M.; Maartens, G.; Meintjes, G.; Wasserman, S. Clofazimine for the treatment of tuberculosis. Front. Pharmacol. 2023, 14, 1100488. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morrison, N.E.; Marley, G.M. Clofazimine binding studies with deoxyribonucleic acid. Int. J. Lepr. Other Mycobact. Dis. 1976, 44, 475–481. [Google Scholar] [PubMed]
- Yano, T.; Kassovska-Bratinova, S.; Teh, J.S.; Winkler, J.; Sullivan, K.; Isaacs, A.; Schechter, N.M.; Rubin, H. Reduction of clofazimine by mycobacterial type 2 NADH:quinone oxidoreductase: A pathway for the generation of bactericidal levels of reactive oxygen species. J. Biol. Chem. 2011, 286, 10276–10287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oliva, B.; O’neill, A.J.; Miller, K.; Stubbings, W.; Chopra, I. Anti-staphylococcal activity and mode of action of clofazimine. J. Antimicrob. Chemother. 2004, 53, 435–440. [Google Scholar] [CrossRef] [Scilit]
- Mothiba, M.T.; Anderson, R.; Fourie, B.; Germishuizen, W.A.; Cholo, M.C. Effects of clofazimine on planktonic and biofilm growth of Mycobacterium tuberculosis and Mycobacterium smegmatis. J. Glob. Antimicrob. Resist. 2015, 3, 13–18. [Google Scholar] [CrossRef] [Scilit]
- Sparks, I.L.; Derbyshire, K.M.; Jacobs, W.R.; Morita, Y.S. Mycobacterium smegmatis: The Vanguard of Mycobacterial Research. J. Bacteriol. 2023, 205, e0033722. [Google Scholar] [CrossRef] [Scilit]
- Kurthkoti, K.; Varshney, U. Distinct mechanisms of DNA repair in mycobacteria and their implications in attenuation of the pathogen growth. Mech. Ageing Dev. 2012, 133, 138–146. [Google Scholar] [CrossRef] [Scilit]
- Houghton, J.; Townsend, C.; Williams, A.R.; Rodgers, A.; Rand, L.; Walker, K.B.; Böttger, E.C.; Springer, B.; Davis, E.O. Important role for Mycobacterium tuberculosis UvrD1 in pathogenesis and persistence apart from its function in nucleotide excision repair. J. Bacteriol. 2012, 194, 2916–2923. [Google Scholar] [CrossRef] [Scilit]
- Mohan, A.; Padiadpu, J.; Baloni, P.; Chandra, N. Complete Genome Sequences of a Mycobacterium smegmatis Laboratory Strain (MC2 155) and Isoniazid-Resistant (4XR1/R2) Mutant Strains. Genome Announc. 2015, 3, e01520-14. [Google Scholar] [PubMed]
- Molnár, D.; Surányi, É.V.; Trombitás, T.; Füzesi, D.; Hirmondó, R.; Tóth, J. Genetic Stability of Mycobacterium smegmatisunder the Stress of First-Line Antitubercular Agents: Assessing Mutagenic Potential. bioRxiv 2024. [Google Scholar] [CrossRef]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [Scilit]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef] [Scilit]
- Faust, G.G.; Hall, I.M. SAMBLASTER: Fast duplicate marking and structural variant read extraction. Bioinformatics 2014, 30, 2503–2505. [Google Scholar] [CrossRef] [Scilit]
- McKenna, A.; Hanna, M.; Banks, E.; Sivachenko, A.; Cibulskis, K.; Kernytsky, A.; Garimella, K.; Altshuler, D.; Gabriel, S.; Daly, M.; et al. The Genome Analysis Toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010, 20, 1297–1303. [Google Scholar] [CrossRef] [Scilit]
- Sundaram, V.K.; Sampathkumar, N.K.; Massaad, C.; Grenier, J. Optimal use of statistical methods to validate reference gene stability in longitudinal studies. PLoS ONE 2019, 14, e0219440. [Google Scholar] [CrossRef] [Scilit]
- Szabó, J.E.; Surányi, V.; Mébold, B.S.; Trombitás, T.; Cserepes, M.; Tóth, J. A user-friendly, high-throughput tool for the precise fluorescent quantification of deoxyribonucleoside triphosphates from biological samples. Nucleic Acids Res. 2020, 48, e45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yuan, J.S.; Reed, A.; Chen, F.; Stewart, C.N. Statistical analysis of real-time PCR data. BMC Bioinform. 2006, 7, 85. [Google Scholar] [CrossRef] [Scilit]
- Crowley, D.J.; Boubriak, I.; Berquist, B.R.; Clark, M.; Richard, E.; Sullivan, L.; DasSarma, S.; McCready, S. The uvrA, uvrB and uvrC genes are required for repair of ultraviolet light induced DNA photoproducts in Halobacterium sp. NRC-1. Saline Syst. 2006, 2, 11. [Google Scholar] [CrossRef] [Scilit]
- O’Sullivan, D.M.; Hinds, J.; Butcher, P.D.; Gillespie, S.H.; McHugh, T.D. Mycobacterium tuberculosis DNA repair in response to subinhibitory concentrations of ciprofloxacin. J. Antimicrob. Chemother. 2008, 62, 1199–1202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Srinath, T.; Bharti, S.K.; Varshney, U. Substrate specificities and functional characterization of a thermo-tolerant uracil DNA glycosylase (UdgB) from Mycobacterium tuberculosis. DNA Repair 2007, 6, 1517–1528. [Google Scholar] [CrossRef] [Scilit]
- Kurthkoti, K.; Srinath, T.; Kumar, P.; Malshetty, V.S.; Sang, P.B.; Jain, R.; Manjunath, R.; Varshney, U. A distinct physiological role of MutY in mutation prevention in mycobacteria. Microbiology 2010, 156, 88–93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singh, A. Guardians of the mycobacterial genome: A review on DNA repair systems in Mycobacterium tuberculosis. Microbiology 2017, 163, 1740–1758. [Google Scholar] [CrossRef] [Scilit]
- Castañeda-García, A.; Prieto, A.I.; Rodríguez-Beltrán, J.; Alonso, N.; Cantillon, D.; Costas, C.; Pérez-Lago, L.; Zegeye, E.D.; Herranz, M.; Plociński, P.; et al. A non-canonical mismatch repair pathway in prokaryotes. Nat. Commun. 2017, 8, 14246. [Google Scholar] [CrossRef] [Scilit]
- Romero, D.; Traxler, M.F.; López, D.; Kolter, R. Antibiotics as signal molecules. Chem. Rev. 2011, 111, 5492–5505. [Google Scholar] [CrossRef] [Scilit]
- Sun, G.; Luo, T.; Yang, C.; Dong, X.; Li, J.; Zhu, Y.; Zheng, H.; Tian, W.; Wang, S.; Barry, C.E.; et al. Dynamic population changes in Mycobacterium tuberculosis during acquisition and fixation of drug resistance in patients. J. Infect. Dis. 2012, 206, 1724–1733. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ragheb, M.N.; Ford, C.B.; Chase, M.R.; Lin, P.L.; Flynn, J.L.; Fortune, S.M. The mutation rate of mycobacterial repetitive unit loci in strains of M. tuberculosis from cynomolgus macaque infection. BMC Genom. 2013, 14, 145. [Google Scholar] [CrossRef] [Scilit]
- Kucukyildirim, S.; Long, H.; Sung, W.; Miller, S.F.; Doak, T.G.; Lynch, M. The Rate and Spectrum of Spontaneous Mutations in Mycobacterium smegmatis, a Bacterium Naturally Devoid of the Postreplicative Mismatch Repair Pathway. G3 Genes Genomes Genet. 2016, 6, 2157–2163. [Google Scholar] [CrossRef] [Scilit]
- Ford, C.B.; Lin, P.L.; Chase, M.R.; Shah, R.R.; Iartchouk, O.; Galagan, J.; Mohaideen, N.; Ioerger, T.R.; Sacchettini, J.C.; Lipsitch, M.; et al. Use of whole genome sequencing to estimate the mutation rate of Mycobacterium tuberculosis during latent infection. Nat. Genet. 2011, 43, 482–486. [Google Scholar] [CrossRef] [Scilit]
- Colangeli, R.; Arcus, V.L.; Cursons, R.T.; Ruthe, A.; Karalus, N.; Coley, K.; Manning, S.D.; Kim, S.; Marchiano, E.; Alland, D. Whole genome sequencing of Mycobacterium tuberculosis reveals slow growth and low mutation rates during latent infections in humans. PLoS ONE 2014, 9, e91024. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Z.; Li, X.; Xia, H. Roles of LuxR-family regulators in the biosynthesis of secondary metabolites in Actinobacteria. World J. Microbiol. Biotechnol. 2022, 38, 250. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, L.; Yu, S.; Ning, X.; Fang, H.; Li, J.; Zhi, F.; Li, J.; Zhou, D.; Wang, A.; Jin, Y. A lysr transcriptional regulator manipulates macrophage autophagy flux during brucella infection. Front. Cell. Infect. Microbiol. 2022, 12, 858173. [Google Scholar] [CrossRef] [Scilit]
- Modrzejewska, M.; Kawalek, A.; Bartosik, A.A. The LysR-Type Transcriptional Regulator BsrA (PA2121) Controls Vital Metabolic Pathways in Pseudomonas aeruginosa. Msystems 2021, 6, e00015. [Google Scholar] [CrossRef] [Scilit]
- Kappes, R.M.; Kempf, B.; Kneip, S.; Boch, J.; Gade, J.; Meier-Wagner, J.; Bremer, E. Two evolutionarily closely related ABC transporters mediate the uptake of choline for synthesis of the osmoprotectant glycine betaine in Bacillus subtilis. Mol. Microbiol. 1999, 32, 203–216. [Google Scholar] [CrossRef] [Scilit]
- Kappes, R.M.; Kempf, B.; Bremer, E. Three transport systems for the osmoprotectant glycine betaine operate in Bacillus subtilis: Characterization of OpuD. J. Bacteriol. 1996, 178, 5071–5079. [Google Scholar] [CrossRef] [Scilit]
- De Rossi, E.; Aínsa, J.A.; Riccardi, G. Role of mycobacterial efflux transporters in drug resistance: An unresolved question. FEMS Microbiol. Rev. 2006, 30, 36–52. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Briffotaux, J.; Liu, S.; Gicquel, B. Genome-Wide Transcriptional Responses of Mycobacterium to Antibiotics. Front. Microbiol. 2019, 10, 249. [Google Scholar] [CrossRef] [Scilit]
- Li, W.; Sanchez-Hidalgo, A.; Jones, V.; de Moura, V.C.N.; North, E.J.; Jackson, M. Synergistic Interactions of MmpL3 Inhibitors with Antitubercular Compounds In Vitro. Antimicrob. Agents Chemother. 2017, 61, 10–1128. [Google Scholar] [CrossRef] [Scilit]
- Niki, M.; Niki, M.; Tateishi, Y.; Ozeki, Y.; Kirikae, T.; Lewin, A.; Inoue, Y.; Matsumoto, M.; Dahl, J.L.; Ogura, H.; et al. A novel mechanism of growth phase-dependent tolerance to isoniazid in mycobacteria. J. Biol. Chem. 2012, 287, 27743–27752. [Google Scholar] [CrossRef] [Scilit]
- Wayne, L.G.; Diaz, G.A. A double staining method for differentiating between two classes of mycobacterial catalase in polyacrylamide electrophoresis gels. Anal. Biochem. 1986, 157, 89–92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arrigoni, R.; Ballini, A.; Topi, S.; Bottalico, L.; Jirillo, E.; Santacroce, L. Antibiotic Resistance to Mycobacterium tuberculosis and Potential Use of Natural and Biological Products as Alternative Anti-Mycobacterial Agents. Antibiotics 2022, 11, 1431. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gupta, K.R.; Arora, G.; Mattoo, A.; Sajid, A. Stringent response in mycobacteria: From biology to therapeutic potential. Pathogens 2021, 10, 1417. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arbiser, J.L.; Moschella, S.L. Clofazimine: A review of its medical uses and mechanisms of action. J. Am. Acad. Dermatol. 1995, 32, 241–247. [Google Scholar] [CrossRef] [Scilit]




| Treatment | Liquid Culture Experiments | Agar Plate Experiments | |||||
|---|---|---|---|---|---|---|---|
| Category | Name | Abbreviation | Mechanism of Action | Subinhinitory Concentration [µg/mL] | CFU Compared to Control | Subinhinitory Concentration [µg/mL] | CFU Compared to Control |
| 2nd line antibiotics | Bedaquiline | BDQ | ATP synthase inhibitor | 0.5 | 51% | 0.01 | <0.1% |
| Clofazimine | CFZ | Binds to DNA | 5 | 30% | 0.1 | <0.1% | |
| Linezolide | LZD | Protein synthesis inhibitor | 1 | 15% | 0.1 | 12% | |
| Positive Control | UV * | Pyr dimers, DSBs | ND | N/D | 65 | 11% | |
| None | Mock * | N/A | N/A | 100% | N/A | 100% | |
| Position | Sample | Reference | Mutation | AA Mutation | Gene Code | Protein | Gene Ontology |
|---|---|---|---|---|---|---|---|
| 366337 | bed_B | G | GCCGGTACA | P217frameshift 221stop | MSMEG_0330 | Transcriptional regulator, LuxR family protein | Regulation of transcription, DNA-dependent, Sequence-specific DNA binding, Phosphorelay response regulator activity, Phosphorelay signal transduction system, Intracellular |
| 4098833 | bed_B | T | C | Q29R | MSMEG_4025 | Transcriptional regulator, LysR family protein | Sequence-specific DNA binding transcription factor activity, Regulation of transcription, DNA-dependent |
| 193256 | bed_C | C | T | N/A | N/A | N/A | Intergenic region |
| 2990225 | bed_C | C | T | G165D | MSMEG_2927 | ABC transporter, permease protein OpuCB | Transport, Plasma membrane, Transporter activity, Integral to membrane |
| 4508029 | bed_C | G | A | W167stop | MSMEG_4427 | Transmembrane efflux pump | Transmembrane transport, Integral to membrane |
| 2006423 | clf_A | T | TG | M138frameshift | MSMEG_1928 | protein-serine/threonine phosphatase | Phosphoprotein phosphatase activity |
| 2784157 | clf_C | C | T | A37T | MSMEG_2713 | Peptidase M52, hydrogen uptake protein | Peptidase activity, Enzyme activator activity |
| 5994006 | clf_C | G | A | T301T | MSMEG_5933 | ArsR family transcriptional regulator | Regulation of transcription, DNA-dependent, DNA binding |
| 971780 | lzd_A | A | G | V344A | MSMEG_0886 | serine/threonine-protein kinase PknD | Protein phosphorylation, Protein serine/threonine kinase activity, ATP binding |
| 5293841 | lzd_B | T | TGGGCGCCGCTATTGCGGCCGC | V378frameshift | MSMEG_5194 | Integral membrane protein | Transmembrane transport |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Molnár, D.; Surányi, É.V.; Gálik, N.; Tóth, J.; Hirmondó, R. Assessing the Impact of Bedaquiline, Clofazimine, and Linezolid on Mycobacterial Genome Integrity. Biomolecules 2024, 14, 1451. https://doi.org/10.3390/biom14111451
Molnár D, Surányi ÉV, Gálik N, Tóth J, Hirmondó R. Assessing the Impact of Bedaquiline, Clofazimine, and Linezolid on Mycobacterial Genome Integrity. Biomolecules. 2024; 14(11):1451. https://doi.org/10.3390/biom14111451
Chicago/Turabian StyleMolnár, Dániel, Éva Viola Surányi, Nikoletta Gálik, Judit Tóth, and Rita Hirmondó. 2024. "Assessing the Impact of Bedaquiline, Clofazimine, and Linezolid on Mycobacterial Genome Integrity" Biomolecules 14, no. 11: 1451. https://doi.org/10.3390/biom14111451
APA StyleMolnár, D., Surányi, É. V., Gálik, N., Tóth, J., & Hirmondó, R. (2024). Assessing the Impact of Bedaquiline, Clofazimine, and Linezolid on Mycobacterial Genome Integrity. Biomolecules, 14(11), 1451. https://doi.org/10.3390/biom14111451

