Inhibiting the Cholesterol Storage Enzyme ACAT1/SOAT1 in Myelin Debris-Treated Microglial Cell Lines Activates the Gene Expression of Cholesterol Efflux Transporter ABCA1
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Human Brain Samples
2.3. Cell Culture
2.4. Myelin Isolation and Characterization of Myelin Debris
2.5. Intact Cell 3H-Oleate Pulse
2.6. Nile Red Staining and Image Analysis
2.7. TLC Analysis of Intracellular Cholesterol, CE and TAG Contents
2.8. Whole Cell Protein Isolation and Western Blot Analyses
2.9. RNA Extraction
2.10. NanoString nCounter Elements XT Assay and Analysis
2.11. Synthesis of ACAT1/SOAT1 Inhibitors
2.12. Statistical Analysis
3. Results
3.1. Characterization of Myelin Debris Isolated from Human and Mouse Brain Tissues
3.2. Myelin Debris Loading in Mouse and Human Microglia Activates Cholesteryl Ester (CE) Synthesis in Intact Cells
3.3. Pharmaceutical Inhibition of ACAT1/SOAT1 Reduces CE Accumulation and Intracellular Cholesterol Content in HMC3 Treated Myelin Debris
3.4. Treatments with Myelin Debris and/or ACAT1 Inhibitor F12511 Do Not Change ACAT1 Protein Expression in HMC3 Cells
3.5. Pharmaceutical Inhibition of ACAT1 for 24 h in Myelin Debris-Loaded HMC3 Microglia Upregulates the Protein Expression of the Cholesterol Efflux Transporter ABCA1
3.6. F12511 Treatment in Myelin Debris-Loaded HMC3 Microglia Significantly Increases ABCA1 mRNA Expression
3.7. Liver X Receptors (LXR) Antagonist GSK2033 Treatment Blocks ABCA1 Protein Expression in Myelin Debris and ACAT1 Inhibitor-Treated HMC3 Microglial Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hughes, E.G.; Orthmann-Murphy, J.L.; Langseth, A.J.; Bergles, D.E. Myelin remodeling through experience-dependent oligodendrogenesis in the adult somatosensory cortex. Nat. Neurosci. 2018, 21, 696–706. [Google Scholar] [CrossRef] [PubMed]
- Dietschy, J.M.; Turley, S.D. Thematic review series: Brain Lipids. Cholesterol metabolism in the central nervous system during early development and in the mature animal. J. Lipid Res. 2004, 45, 1375–1397. [Google Scholar] [CrossRef]
- Hammel, G.; Zivkovic, S.; Ayazi, M.; Ren, Y. Consequences and mechanisms of myelin debris uptake and processing by cells in the central nervous system. Cell Immunol. 2022, 380, 104591. [Google Scholar] [CrossRef] [PubMed]
- Hill, R.A.; Li, A.M.; Grutzendler, J. Lifelong cortical myelin plasticity and age-related degeneration in the live mammalian brain. Nat. Neurosci. 2018, 21, 683–695. [Google Scholar] [CrossRef]
- Bartzokis, G.; Lu, P.H.; Tingus, K.; Mendez, M.F.; Richard, A.; Peters, D.G.; Oluwadara, B.; Barrall, K.A.; Finn, J.P.; Villablanca, P.; et al. Lifespan trajectory of myelin integrity and maximum motor speed. Neurobiol. Aging 2010, 31, 1554–1562. [Google Scholar] [CrossRef] [PubMed]
- Williams, K.; Ulvestad, E.; Waage, A.; Antel, J.P.; McLaurin, J. Activation of adult human derived microglia by myelin phagocytosis in vitro. J. Neurosci. Res. 1994, 38, 433–443. [Google Scholar] [CrossRef]
- Nugent, A.A.; Lin, K.; van Lengerich, B.; Lianoglou, S.; Przybyla, L.; Davis, S.S.; Llapashtica, C.; Wang, J.; Kim, D.J.; Xia, D.; et al. TREM2 Regulates Microglial Cholesterol Metabolism upon Chronic Phagocytic Challenge. Neuron 2020, 105, 837–854 e839. [Google Scholar] [CrossRef] [PubMed]
- Cantuti-Castelvetri, L.; Fitzner, D.; Bosch-Queralt, M.; Weil, M.T.; Su, M.; Sen, P.; Ruhwedel, T.; Mitkovski, M.; Trendelenburg, G.; Lutjohann, D.; et al. Defective cholesterol clearance limits remyelination in the aged central nervous system. Science 2018, 359, 684–688. [Google Scholar] [CrossRef]
- Marschallinger, J.; Iram, T.; Zardeneta, M.; Lee, S.E.; Lehallier, B.; Haney, M.S.; Pluvinage, J.V.; Mathur, V.; Hahn, O.; Morgens, D.W.; et al. Lipid-droplet-accumulating microglia represent a dysfunctional and proinflammatory state in the aging brain. Nat. Neurosci. 2020, 23, 194–208. [Google Scholar] [CrossRef]
- Zadoorian, A.; Du, X.; Yang, H. Lipid droplet biogenesis and functions in health and disease. Nat. Rev. Endocrinol. 2023, 19, 443–459. [Google Scholar] [CrossRef]
- Vitek, M.P.; Araujo, J.A.; Fossel, M.; Greenberg, B.D.; Howell, G.R.; Rizzo, S.J.S.; Seyfried, N.T.; Tenner, A.J.; Territo, P.R.; Windisch, M.; et al. Translational animal models for Alzheimer’s disease: An Alzheimer’s Association Business Consortium Think Tank. Alzheimers Dement 2020, 6, e12114. [Google Scholar] [CrossRef] [PubMed]
- Cameron, B.; Landreth, G.E. Inflammation, microglia, and Alzheimer’s disease. Neurobiol. Dis. 2010, 37, 503–509. [Google Scholar] [CrossRef]
- Spangenberg, E.E.; Lee, R.J.; Najafi, A.R.; Rice, R.A.; Elmore, M.R.; Blurton-Jones, M.; West, B.L.; Green, K.N. Eliminating microglia in Alzheimer’s mice prevents neuronal loss without modulating amyloid-beta pathology. Brain 2016, 139, 1265–1281. [Google Scholar] [CrossRef]
- Long, J.M.; Holtzman, D.M. Alzheimer Disease: An Update on Pathobiology and Treatment Strategies. Cell 2019, 179, 312–339. [Google Scholar] [CrossRef]
- Elmore, M.R.P.; Hohsfield, L.A.; Kramar, E.A.; Soreq, L.; Lee, R.J.; Pham, S.T.; Najafi, A.R.; Spangenberg, E.E.; Wood, M.A.; West, B.L.; et al. Replacement of microglia in the aged brain reverses cognitive, synaptic, and neuronal deficits in mice. Aging Cell 2018, 17, e12832. [Google Scholar] [CrossRef]
- Yamauchi, Y.; Chang, C.C.; Hayashi, M.; Abe-Dohmae, S.; Reid, P.C.; Chang, T.Y.; Yokoyama, S. Intracellular cholesterol mobilization involved in the ABCA1/apolipoprotein-mediated assembly of high density lipoprotein in fibroblasts. J. Lipid Res. 2004, 45, 1943–1951. [Google Scholar] [CrossRef]
- Bryleva, E.Y.; Rogers, M.A.; Chang, C.C.; Buen, F.; Harris, B.T.; Rousselet, E.; Seidah, N.G.; Oddo, S.; LaFerla, F.M.; Spencer, T.A.; et al. ACAT1 gene ablation increases 24(S)-hydroxycholesterol content in the brain and ameliorates amyloid pathology in mice with AD. Proc. Natl. Acad. Sci. USA 2010, 107, 3081–3086. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Spann, N.J.; Kaikkonen, M.U.; Lu, M.; Oh da, Y.; Fox, J.N.; Bandyopadhyay, G.; Talukdar, S.; Xu, J.; Lagakos, W.S.; et al. NCoR Repression of LXRs Restricts Macrophage Biosynthesis of Insulin-Sensitizing Omega 3 Fatty Acids. Cell 2013, 155, 200–214. [Google Scholar] [CrossRef] [PubMed]
- Rong, X.; Albert, C.J.; Hong, C.; Duerr, M.A.; Chamberlain, B.T.; Tarling, E.J.; Ito, A.; Gao, J.; Wang, B.; Edwards, P.A.; et al. LXRs regulate ER stress and inflammation through dynamic modulation of membrane phospholipid composition. Cell Metab. 2013, 18, 685–697. [Google Scholar] [CrossRef]
- Sodhi, R.K.; Singh, N. Liver X receptors: Emerging therapeutic targets for Alzheimer’s disease. Pharmacol. Res. 2013, 72, 45–51. [Google Scholar] [CrossRef]
- Chen, W.; Chen, G.; Head, D.L.; Mangelsdorf, D.J.; Russell, D.W. Enzymatic reduction of oxysterols impairs LXR signaling in cultured cells and the livers of mice. Cell Metab. 2007, 5, 73–79. [Google Scholar] [CrossRef] [PubMed]
- Litvinchuk, A.; Suh, J.H.; Guo, J.L.; Lin, K.; Davis, S.S.; Bien-Ly, N.; Tycksen, E.; Tabor, G.T.; Remolina Serrano, J.; Manis, M.; et al. Amelioration of Tau and ApoE4-linked glial lipid accumulation and neurodegeneration with an LXR agonist. Neuron 2024, 112, 384–403 e388. [Google Scholar] [CrossRef] [PubMed]
- Oram, J.F.; Heinecke, J.W. ATP-binding cassette transporter A1: A cell cholesterol exporter that protects against cardiovascular disease. Physiol. Rev. 2005, 85, 1343–1372. [Google Scholar] [CrossRef] [PubMed]
- Gouna, G.; Klose, C.; Bosch-Queralt, M.; Liu, L.; Gokce, O.; Schifferer, M.; Cantuti-Castelvetri, L.; Simons, M. TREM2-dependent lipid droplet biogenesis in phagocytes is required for remyelination. J. Exp. Med. 2021, 218, e20210227. [Google Scholar] [CrossRef] [PubMed]
- Stansley, B.; Post, J.; Hensley, K. A comparative review of cell culture systems for the study of microglial biology in Alzheimer’s disease. J. Neuroinflamm. 2012, 9, 115. [Google Scholar] [CrossRef]
- Dello Russo, C.; Cappoli, N.; Coletta, I.; Mezzogori, D.; Paciello, F.; Pozzoli, G.; Navarra, P.; Battaglia, A. The human microglial HMC3 cell line: Where do we stand? A systematic literature review. J. Neuroinflamm. 2018, 15, 259. [Google Scholar] [CrossRef]
- Akhter, R.; Shao, Y.; Formica, S.; Khrestian, M.; Bekris, L.M. TREM2 alters the phagocytic, apoptotic and inflammatory response to Abeta(42) in HMC3 cells. Mol. Immunol. 2021, 131, 171–179. [Google Scholar] [CrossRef]
- Munoz Herrera, O.M.; Zivkovic, A.M. Microglia and Cholesterol Handling: Implications for Alzheimer’s Disease. Biomedicines 2022, 10, 3105. [Google Scholar] [CrossRef]
- Yamazaki, S.; Yamaguchi, K.; Someya, A.; Nagaoka, I.; Hayashida, M. Anti-Inflammatory Action of Dexmedetomidine on Human Microglial Cells. Int. J. Mol. Sci. 2022, 23, 10096. [Google Scholar] [CrossRef]
- Baek, M.; Yoo, E.; Choi, H.I.; An, G.Y.; Chai, J.C.; Lee, Y.S.; Jung, K.H.; Chai, Y.G. The BET inhibitor attenuates the inflammatory response and cell migration in human microglial HMC3 cell line. Sci. Rep. 2021, 11, 8828. [Google Scholar] [CrossRef]
- Wang, Y.; Peng, Y.; Yan, H. Commentary: Neuroinflammatory In Vitro Cell Culture Models and the Potential Applications for Neurological Disorders. Front. Pharmacol. 2021, 12, 792614. [Google Scholar] [CrossRef] [PubMed]
- Shibuya, Y.; Chang, C.C.; Huang, L.H.; Bryleva, E.Y.; Chang, T.Y. Inhibiting ACAT1/SOAT1 in microglia stimulates autophagy-mediated lysosomal proteolysis and increases Abeta1-42 clearance. J. Neurosci. 2014, 34, 14484–14501. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Huynh, T.N.; Duong, M.T.; Gow, J.G.; Chang, C.C.Y.; Chang, T.Y. ACAT1/SOAT1 Blockade Suppresses LPS-Mediated Neuroinflammation by Modulating the Fate of Toll-like Receptor 4 in Microglia. Int. J. Mol. Sci. 2023, 24, 5616. [Google Scholar] [CrossRef] [PubMed]
- Harned, T.C.; Stan, R.V.; Cao, Z.; Chakrabarti, R.; Higgs, H.N.; Chang, C.C.Y.; Chang, T.Y. Acute ACAT1/SOAT1 Blockade Increases MAM Cholesterol and Strengthens ER-Mitochondria Connectivity. Int. J. Mol. Sci. 2023, 24, 5525. [Google Scholar] [CrossRef] [PubMed]
- Schultz, J.R.; Tu, H.; Luk, A.; Repa, J.J.; Medina, J.C.; Li, L.; Schwendner, S.; Wang, S.; Thoolen, M.; Mangelsdorf, D.J.; et al. Role of LXRs in control of lipogenesis. Genes Dev. 2000, 14, 2831–2838. [Google Scholar] [CrossRef]
- Cashikar, A.G.; Toral-Rios, D.; Timm, D.; Romero, J.; Strickland, M.; Long, J.M.; Han, X.; Holtzman, D.M.; Paul, S.M. Regulation of astrocyte lipid metabolism and ApoE secretionby the microglial oxysterol, 25-hydroxycholesterol. J. Lipid Res. 2023, 64, 100350. [Google Scholar] [CrossRef] [PubMed]
- Rolfe, A.J.; Bosco, D.B.; Broussard, E.N.; Ren, Y. In Vitro Phagocytosis of Myelin Debris by Bone Marrow-Derived Macrophages. J. Vis. Exp. 2017, 130, 56322. [Google Scholar] [CrossRef]
- Goldstein, J.L.; Dana, S.E.; Brown, M.S. Esterification of low density lipoprotein cholesterol in human fibroblasts and its absence in homozygous familial hypercholesterolemia. Proc. Natl. Acad. Sci. USA 1974, 71, 4288–4292. [Google Scholar] [CrossRef]
- Chang, C.C.; Chang, T.Y. Cycloheximide sensitivity in regulation of acyl coenzyme A:cholesterol acyltransferase activity in Chinese hamster ovary cells. 2. Effect of sterol endogenously synthesized. Biochemistry 1986, 25, 1700–1706. [Google Scholar] [CrossRef]
- Igal, R.A.; Wang, P.; Coleman, R.A. Triacsin C blocks de novo synthesis of glycerolipids and cholesterol esters but not recycling of fatty acid into phospholipid: Evidence for functionally separate pools of acyl-CoA. Biochem. J. 1997, 324 Pt 2, 529–534. [Google Scholar] [CrossRef]
- Millar, J.S.; Stone, S.J.; Tietge, U.J.; Tow, B.; Billheimer, J.T.; Wong, J.S.; Hamilton, R.L.; Farese, R.V., Jr.; Rader, D.J. Short-term overexpression of DGAT1 or DGAT2 increases hepatic triglyceride but not VLDL triglyceride or apoB production. J. Lipid Res. 2006, 47, 2297–2305. [Google Scholar] [CrossRef] [PubMed]
- Cheng, D.; Iqbal, J.; Devenny, J.; Chu, C.H.; Chen, L.; Dong, J.; Seethala, R.; Keim, W.J.; Azzara, A.V.; Lawrence, R.M.; et al. Acylation of acylglycerols by acyl coenzyme A:diacylglycerol acyltransferase 1 (DGAT1). Functional importance of DGAT1 in the intestinal fat absorption. J. Biol. Chem. 2008, 283, 29802–29811. [Google Scholar] [CrossRef] [PubMed]
- Chang, C.C.; Sakashita, N.; Ornvold, K.; Lee, O.; Chang, E.T.; Dong, R.; Lin, S.; Lee, C.Y.; Strom, S.C.; Kashyap, R.; et al. Immunological quantitation and localization of ACAT-1 and ACAT-2 in human liver and small intestine. J. Biol. Chem. 2000, 275, 28083–28092. [Google Scholar] [CrossRef] [PubMed]
- Cadigan, K.M.; Chang, C.C.; Chang, T.Y. Isolation of Chinese hamster ovary cell lines expressing human acyl-coenzyme A/cholesterol acyltransferase activity. J. Cell Biol. 1989, 108, 2201–2210. [Google Scholar] [CrossRef] [PubMed]
- Macala, L.J.; Yu, R.K.; Ando, S. Analysis of brain lipids by high performance thin-layer chromatography and densitometry. J. Lipid Res. 1983, 24, 1243–1250. [Google Scholar] [CrossRef]
- Chang, T.Y.; Chang, C.C.Y.; Harned, T.C.; De La Torre, A.L.; Lee, J.; Huynh, T.N.; Gow, J.G. Blocking cholesterol storage to treat Alzheimer’s disease. Explor. Neuroprotective Ther. 2021, 1, 173–184. [Google Scholar] [CrossRef]
- Ikenoya, M.; Yoshinaka, Y.; Kobayashi, H.; Kawamine, K.; Shibuya, K.; Sato, F.; Sawanobori, K.; Watanabe, T.; Miyazaki, A. A selective ACAT-1 inhibitor, K-604, suppresses fatty streak lesions in fat-fed hamsters without affecting plasma cholesterol levels. Atherosclerosis 2007, 191, 290–297. [Google Scholar] [CrossRef]
- Lopez-Farre, A.J.; Sacristan, D.; Zamorano-Leon, J.J.; San-Martin, N.; Macaya, C. Inhibition of acyl-CoA cholesterol acyltransferase by F12511 (Eflucimibe): Could it be a new antiatherosclerotic therapeutic? Cardiovasc. Ther. 2008, 26, 65–74. [Google Scholar] [CrossRef]
- Guan, C.; Niu, Y.; Chen, S.C.; Kang, Y.; Wu, J.X.; Nishi, K.; Chang, C.C.Y.; Chang, T.Y.; Luo, T.; Chen, L. Structural insights into the inhibition mechanism of human sterol O-acyltransferase 1 by a competitive inhibitor. Nat. Commun. 2020, 11, 2478. [Google Scholar] [CrossRef]
- Knapp, P.E.; Benjamins, J.A.; Skoff, R.P. Epigenetic factors up-regulate expression of myelin proteins in the dysmyelinating jimpy mutant mouse. J. Neurobiol. 1996, 29, 138–150. [Google Scholar] [CrossRef]
- Boggs, J.M. Myelin basic protein: A multifunctional protein. Cell Mol. Life Sci. 2006, 63, 1945–1961. [Google Scholar] [CrossRef] [PubMed]
- Larocca, J.N.; Norton, W.T. Isolation of myelin. Curr. Protoc. Cell Biol. 2007, 3, Unit3 25. [Google Scholar] [CrossRef] [PubMed]
- Chang, C.C.; Huh, H.Y.; Cadigan, K.M.; Chang, T.Y. Molecular cloning and functional expression of human acyl-coenzyme A:cholesterol acyltransferase cDNA in mutant Chinese hamster ovary cells. J. Biol. Chem. 1993, 268, 20747–20755. [Google Scholar] [CrossRef] [PubMed]
- Fowler, S.; Brown, W.; Warfel, J.; Greenspan, P. Use of nile red for the rapid in situ quantitation of lipids on thin-layer chromatograms. J. Lipid Res. 1987, 28, 1225–1232. [Google Scholar] [CrossRef]
- Greenspan, P.; Fowler, S.D. Spectrofluorometric studies of the lipid probe, nile red. J. Lipid Res. 1985, 26, 781–789. [Google Scholar] [CrossRef]
- Junquero, D.; Bruniquel, F.; N’Guyen, X.; Autin, J.M.; Patoiseau, J.F.; Degryse, A.D.; Colpaert, F.C.; Delhon, A. F 12511, a novel ACAT inhibitor, and atorvastatin regulate endogenous hypercholesterolemia in a synergistic manner in New Zealand rabbits fed a casein-enriched diet. Atherosclerosis 2001, 155, 131–142. [Google Scholar] [CrossRef]
- Junquero, D.; Oms, P.; Carilla-Durand, E.; Autin, J.; Tarayre, J.; Degryse, A.; Patoiseau, J.; Colpaert, F.C.; Delhon, A. Pharmacological profile of F 12511, (S)-2′,3′, 5′-trimethyl-4′-hydroxy-alpha-dodecylthioacetanilide a powerful and systemic acylcoenzyme A: Cholesterol acyltransferase inhibitor. Biochem. Pharmacol. 2001, 61, 97–108. [Google Scholar] [CrossRef]
- Junquero, D.; Pilon, A.; Carilla-Durand, E.; Patoiseau, J.F.; Tarayre, J.P.; Torpier, G.; Staels, B.; Fruchart, J.C.; Colpaert, F.C.; Clavey, V.; et al. Lack of toxic effects of F 12511, a novel potent inhibitor of acyl-coenzyme A: Cholesterol O-acyltransferase, on human adrenocortical cells in culture. Biochem. Pharmacol. 2001, 61, 387–398. [Google Scholar] [CrossRef]
- De La Torre, A.L.; Huynh, T.N.; Chang, C.C.Y.; Pooler, D.B.; Ness, D.B.; Lewis, L.D.; Pannem, S.; Feng, Y.; Samkoe, K.S.; Hickey, W.F.; et al. Stealth Liposomes Encapsulating a Potent ACAT1/SOAT1 Inhibitor F12511: Pharmacokinetic, Biodistribution, and Toxicity Studies in Wild-Type Mice and Efficacy Studies in Triple Transgenic Alzheimer’s Disease Mice. Int. J. Mol. Sci. 2023, 24(13), 11013. [Google Scholar] [CrossRef]
- De La Torre, A.L.; Smith, C.; Granger, J.; Anderson, F.L.; Harned, T.C.; Havrda, M.C.; Chang, C.C.Y.; Chang, T.Y. Facile method to incorporate high-affinity ACAT/SOAT1 inhibitor F12511 into stealth liposome-based nanoparticle and demonstration of its efficacy in blocking cholesteryl ester biosynthesis without overt toxicity in neuronal cell culture. J. Neurosci. Methods 2022, 367, 109437. [Google Scholar] [CrossRef]
- Machlovi, S.I.; Neuner, S.M.; Hemmer, B.M.; Khan, R.; Liu, Y.; Huang, M.; Zhu, J.D.; Castellano, J.M.; Cai, D.; Marcora, E.; et al. APOE4 confers transcriptomic and functional alterations to primary mouse microglia. Neurobiol. Dis. 2022, 164, 105615. [Google Scholar] [CrossRef] [PubMed]
- Haney, M.S.; Palovics, R.; Munson, C.N.; Long, C.; Johansson, P.K.; Yip, O.; Dong, W.; Rawat, E.; West, E.; Schlachetzki, J.C.M.; et al. APOE4/4 is linked to damaging lipid droplets in Alzheimer’s disease microglia. Nature 2024, 628, 154–161. [Google Scholar] [CrossRef] [PubMed]
- Sugimoto, K.; Tsujita, M.; Wu, C.A.; Suzuki, K.; Yokoyama, S. An inhibitor of acylCoA: Cholesterol acyltransferase increases expression of ATP-binding cassette transporter A1 and thereby enhances the ApoA-I-mediated release of cholesterol from macrophages. Biochim. Biophys. Acta 2004, 1636, 69–76. [Google Scholar] [CrossRef] [PubMed]
- Prakash, P.; Manchanda, P.; Paouri, E.; Bisht, K.; Sharma, K.; Wijewardhane, P.R.; Randolph, C.E.; Clark, M.G.; Fine, J.; Thayer, E.A.; et al. Amyloid beta Induces Lipid Droplet-Mediated Microglial Dysfunction in Alzheimer’s Disease. bioRxiv 2023, 6, 543525. [Google Scholar] [CrossRef]
- Poitelon, Y.; Kopec, A.M.; Belin, S. Myelin Fat Facts: An Overview of Lipids and Fatty Acid Metabolism. Cells 2020, 9, 812. [Google Scholar] [CrossRef] [PubMed]
- Sastry, P.S. Lipids of nervous tissue: Composition and metabolism. Prog. Lipid Res. 1985, 24, 69–176. [Google Scholar] [CrossRef]
- Rogers, M.A.; Liu, J.; Song, B.L.; Li, B.L.; Chang, C.C.; Chang, T.Y. Acyl-CoA:cholesterol acyltransferases (ACATs/SOATs): Enzymes with multiple sterols as substrates and as activators. J. Steroid Biochem. Mol. Biol. 2015, 151, 102–107. [Google Scholar] [CrossRef]
- Tontonoz, P. Transcriptional and posttranscriptional control of cholesterol homeostasis by liver X receptors. Cold Spring Harb. Symp. Quant. Biol. 2011, 76, 129–137. [Google Scholar] [CrossRef]
- Rogers, M.A.; Chang, C.C.Y.; Maue, R.A.; Melton, E.M.; Peden, A.A.; Garver, W.S.; Lee, J.; Schroen, P.; Huang, M.; Chang, T.Y. Acat1/Soat1 knockout extends the mutant Npc1 mouse lifespan and ameliorates functional deficiencies in multiple organelles of mutant cells. Proc. Natl. Acad. Sci. USA 2022, 119, e2201646119. [Google Scholar] [CrossRef]
- Li, A.C.; Binder, C.J.; Gutierrez, A.; Brown, K.K.; Plotkin, C.R.; Pattison, J.W.; Valledor, A.F.; Davis, R.A.; Willson, T.M.; Witztum, J.L.; et al. Differential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARalpha, beta/delta, and gamma. J. Clin. Invest. 2004, 114, 1564–1576. [Google Scholar] [CrossRef]
- Hsieh, V.; Kim, M.J.; Gelissen, I.C.; Brown, A.J.; Sandoval, C.; Hallab, J.C.; Kockx, M.; Traini, M.; Jessup, W.; Kritharides, L. Cellular cholesterol regulates ubiquitination and degradation of the cholesterol export proteins ABCA1 and ABCG1. J. Biol. Chem. 2014, 289, 7524–7536. [Google Scholar] [CrossRef] [PubMed]
- Bogie, J.F.; Jorissen, W.; Mailleux, J.; Nijland, P.G.; Zelcer, N.; Vanmierlo, T.; Van Horssen, J.; Stinissen, P.; Hellings, N.; Hendriks, J.J. Myelin alters the inflammatory phenotype of macrophages by activating PPARs. Acta Neuropathol. Commun. 2013, 1, 43. [Google Scholar] [CrossRef] [PubMed]
- El-Gendy, B.E.M.; Goher, S.S.; Hegazy, L.S.; Arief, M.M.H.; Burris, T.P. Recent Advances in the Medicinal Chemistry of Liver X Receptors. J. Med. Chem. 2018, 61, 10935–10956. [Google Scholar] [CrossRef] [PubMed]
- Mendez, M.F. Early-Onset Alzheimer Disease. Neurol. Clin. 2017, 35, 263–281. [Google Scholar] [CrossRef]
- Tall, A.R.; Yvan-Charvet, L. Cholesterol, inflammation and innate immunity. Nat. Rev. Immunol. 2015, 15, 104–116. [Google Scholar] [CrossRef]
- Bi, X.; Vitali, C.; Cuchel, M. ABCA1 and Inflammation: From Animal Models to Humans. Arterioscler. Thromb. Vasc. Biol. 2015, 35, 1551–1553. [Google Scholar] [CrossRef]
- Ito, A.; Hong, C.; Rong, X.; Zhu, X.; Tarling, E.J.; Hedde, P.N.; Gratton, E.; Parks, J.; Tontonoz, P. LXRs link metabolism to inflammation through Abca1-dependent regulation of membrane composition and TLR signaling. Elife 2015, 4, e08009. [Google Scholar] [CrossRef]
- He, P.; Gelissen, I.C.; Ammit, A.J. Regulation of ATP-binding cassette transporter A1 (ABCA1) expression: Cholesterol-dependent and-independent signaling pathways with relevance to inflammatory lung disease. Respir. Res. 2020, 21, 250. [Google Scholar] [CrossRef] [PubMed]
- Tang, C.; Liu, Y.; Kessler, P.S.; Vaughan, A.M.; Oram, J.F. The macrophage cholesterol exporter ABCA1 functions as an anti-inflammatory receptor. J. Biol. Chem. 2009, 284, 32336–32343. [Google Scholar] [CrossRef]
- Saito, H.; Tachiura, W.; Nishimura, M.; Shimizu, M.; Sato, R.; Yamauchi, Y. Hydroxylation site-specific and production-dependent effects of endogenous oxysterols on cholesterol homeostasis: Implications for SREBP-2 and LXR. J. Biol. Chem. 2023, 299, 102733. [Google Scholar] [CrossRef]
- Repa, J.J.; Liang, G.; Ou, J.; Bashmakov, Y.; Lobaccaro, J.M.; Shimomura, I.; Shan, B.; Brown, M.S.; Goldstein, J.L.; Mangelsdorf, D.J. Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRalpha and LXRbeta. Genes Dev. 2000, 14, 2819–2830. [Google Scholar] [CrossRef] [PubMed]
- Blanchard, J.W.; Akay, L.A.; Davila-Velderrain, J.; von Maydell, D.; Mathys, H.; Davidson, S.M.; Effenberger, A.; Chen, C.Y.; Maner-Smith, K.; Hajjar, I.; et al. APOE4 impairs myelination via cholesterol dysregulation in oligodendrocytes. Nature 2022, 611, 769–779. [Google Scholar] [CrossRef] [PubMed]
- Tcw, J.; Qian, L.; Pipalia, N.H.; Chao, M.J.; Liang, S.A.; Shi, Y.; Jain, B.R.; Bertelsen, S.E.; Kapoor, M.; Marcora, E.; et al. Cholesterol and matrisome pathways dysregulated in astrocytes and microglia. Cell 2022, 185, 2213–2233 e2225. [Google Scholar] [CrossRef] [PubMed]
- Russell, D.W.; Halford, R.W.; Ramirez, D.M.; Shah, R.; Kotti, T. Cholesterol 24-hydroxylase: An enzyme of cholesterol turnover in the brain. Annu. Rev. Biochem. 2009, 78, 1017–1040. [Google Scholar] [CrossRef]
- Hutter-Paier, B.; Huttunen, H.J.; Puglielli, L.; Eckman, C.B.; Kim, D.Y.; Hofmeister, A.; Moir, R.D.; Domnitz, S.B.; Frosch, M.P.; Windisch, M.; et al. The ACAT inhibitor CP-113,818 markedly reduces amyloid pathology in a mouse model of Alzheimer’s disease. Neuron 2004, 44, 227–238. [Google Scholar] [CrossRef]
- Huttunen, H.J.; Kovacs, D.M. ACAT as a drug target for Alzheimer’s disease. Neurodegener. Dis. 2008, 5, 212–214. [Google Scholar] [CrossRef] [PubMed]
- Puglielli, L.; Konopka, G.; Pack-Chung, E.; Ingano, L.A.; Berezovska, O.; Hyman, B.T.; Chang, T.Y.; Tanzi, R.E.; Kovacs, D.M. Acyl-coenzyme A: Cholesterol acyltransferase modulates the generation of the amyloid beta-peptide. Nat. Cell Biol. 2001, 3, 905–912. [Google Scholar] [CrossRef]
- Valencia-Olvera, A.C.; Balu, D.; Faulk, N.; Amiridis, A.; Wang, Y.; Pham, C.; Avila-Munoz, E.; York, J.M.; Thatcher, G.R.J.; LaDu, M.J. Inhibition of ACAT as a Therapeutic Target for Alzheimer’s Disease Is Independent of ApoE4 Lipidation. Neurotherapeutics 2023, 20, 1120–1137. [Google Scholar] [CrossRef]











| Gene | Probe A (5′-3′) | Probe B (5′-3′) |
|---|---|---|
| ABCA1 | GGTCTGAGAGCCGGTCATCAATCTCATGAAAGAGTTCCACAAAGGCTCCACAATTCTGCGGGTTAGCAGGAAGGTTAGGGAAC | CGAAAGCCATGACCTCCGATCACTCGAATATTTCTTCCAGGGTCGTCTCTGAGATGCCATAACTAGAAATGCCCA |
| PPARγ | GTACTCTTGAAGTTTCAGGTCATACTTGTAATCTGCAACCACTGGATCTGCATCCTCTTCTTTTCTTGGTGTTGAGAAGATGCTC | CGAAAGCCATGACCTCCGATCACTCTTCTCAGAATAATAAGGTGGAGATGCAGGCTCCACTTTGATTGCACTTTG |
| CH25H | ATGTCGAAGAAGCCCAAAGAAAACAGTTCCCAGACGCTCATATACTGCGTCAAAGACGCCTATCTTCCAGTTTGATCGGGAAACT | CGAAAGCCATGACCTCCGATCACTCTGAGCGGGTGGCACCCGAGCAGTGTGACGTTCATC |
| CYP27A1 | GATGGATCGCTGCAGGCAGCCAATGCGTTTCTCGAACAGGATGTAGCAAACTGTTGAGATTATTGAGCTTCATCATGACCAGAAG | CGAAAGCCATGACCTCCGATCACTCTTCTGGAACATTAACCCGATGGATCTGACGAAGGTCACGGTGTCCTCGGG |
| LXRα | AGGCAGCCACCAGGCCTCAGCCATCCGGCCAAGAAAACAGAAAATATGGGCCTCAAGACCTAAGCGACAGCGTGACCTTGTTTCA | CGAAAGCCATGACCTCCGATCACTCAGGAATGTTTGCCCTTCTCAGTCTGTTCCACTTCTAGG |
| ABCF1 (housekeeping) | CCAGCTTGATGTCAGATGCATTTTCTAACATGGCTTGGCGGGAGGACATCCTTTCGGGTTATATCTATCATTTACTTGACACCCT | CGAAAGCCATGACCTCCGATCACTCGTCTGCATTGACGAACAGCTCCTTGCCATGAGCGGAGATGCTGAACTTCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huynh, T.N.; Havrda, M.C.; Zanazzi, G.J.; Chang, C.C.Y.; Chang, T.Y. Inhibiting the Cholesterol Storage Enzyme ACAT1/SOAT1 in Myelin Debris-Treated Microglial Cell Lines Activates the Gene Expression of Cholesterol Efflux Transporter ABCA1. Biomolecules 2024, 14, 1301. https://doi.org/10.3390/biom14101301
Huynh TN, Havrda MC, Zanazzi GJ, Chang CCY, Chang TY. Inhibiting the Cholesterol Storage Enzyme ACAT1/SOAT1 in Myelin Debris-Treated Microglial Cell Lines Activates the Gene Expression of Cholesterol Efflux Transporter ABCA1. Biomolecules. 2024; 14(10):1301. https://doi.org/10.3390/biom14101301
Chicago/Turabian StyleHuynh, Thao N., Matthew C. Havrda, George J. Zanazzi, Catherine C. Y. Chang, and Ta Yuan Chang. 2024. "Inhibiting the Cholesterol Storage Enzyme ACAT1/SOAT1 in Myelin Debris-Treated Microglial Cell Lines Activates the Gene Expression of Cholesterol Efflux Transporter ABCA1" Biomolecules 14, no. 10: 1301. https://doi.org/10.3390/biom14101301
APA StyleHuynh, T. N., Havrda, M. C., Zanazzi, G. J., Chang, C. C. Y., & Chang, T. Y. (2024). Inhibiting the Cholesterol Storage Enzyme ACAT1/SOAT1 in Myelin Debris-Treated Microglial Cell Lines Activates the Gene Expression of Cholesterol Efflux Transporter ABCA1. Biomolecules, 14(10), 1301. https://doi.org/10.3390/biom14101301

