Placental Tissue Calcification and Its Molecular Pathways in Female Patients with Late-Onset Preeclampsia
Abstract
1. Introduction
2. Patients and Methods
2.1. Study Design and Participants
2.2. Sample Collection and Processing
2.3. Immunohistochemistry and Histological Visualization
2.4. Study of Gene Expression
2.5. Von Kossa Stain for Calcium Deposits
2.6. Statistical Analysis
3. Results
3.1. Placentas from Women with LO-PE Show JNK Activation
3.2. Placentas from Women with LO-PE Show Elevated Osteogenesis Markers RUNX2, OSC, and OSP
3.3. Placentas from Women with LO-PE Show Increased Expression of the Angiogenesis Inhibitor PEDF
3.4. Placentas from Women with LO-PE Show Activation of the Transcription Factors MSX2/HOX8 and SOX9
3.5. Placentas from Women with LO-PE Show an Increase in the Canonical Wnt Pathway
3.6. Increased Presence of Calcifications in the Placental Tissue of Patients with LO-PE
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Garovic, V.D.; White, W.M.; Vaughan, L.; Saiki, M.; Parashuram, S.; Garcia-Valencia, O.; Weissgerber, T.L.; Milic, N.; Weaver, A.; Mielke, M.M. Incidence and Long-Term Outcomes of Hypertensive Disorders of Pregnancy. J. Am. Coll. Cardiol. 2020, 75, 2323–2334. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Metoki, H.; Iwama, N.; Hamada, H.; Satoh, M.; Murakami, T.; Ishikuro, M.; Obara, T. Hypertensive disorders of pregnancy: Definition, management, and out-of-office blood pressure measurement. Hypertens. Res. 2022, 45, 1298–1309. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garovic, V.D.; Dechend, R.; Easterling, T.; Karumanchi, S.A.; Baird, S.M.; Magee, L.A.; Rana, S.; Vermunt, J.V.; August, P. Hypertension in Pregnancy: Diagnosis, Blood Pressure Goals, and Pharmacotherapy: A Scientific Statement From the American Heart Association. Hypertension 2021, 79, E21–E41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dimitriadis, E.; Rolnik, D.L.; Zhou, W.; Estrada-Gutierrez, G.; Koga, K.; Francisco, R.P.V.; Whitehead, C.; Hyett, J.; Costa, F.d.S.; Nicolaides, K.; et al. Pre-eclampsia. Nat. Rev. Dis. Primers 2023, 9, 1–22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abalos, E.; Cuesta, C.; Grosso, A.L.; Chou, D.; Say, L. Global and regional estimates of preeclampsia and eclampsia: A systematic review. Eur. J. Obstet. Gynecol. Reprod. Biol. 2013, 170, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Bisson, C.; Dautel, S.; Patel, E.; Suresh, S.; Dauer, P.; Rana, S. Preeclampsia pathophysiology and adverse outcomes during pregnancy and postpartum. Front. Med. 2023, 10, 1144170. [Google Scholar] [CrossRef] [Scilit]
- Chappell, L.C.; Enye, S.; Seed, P.; Briley, A.L.; Poston, L.; Shennan, A.H. Adverse Perinatal Outcomes and Risk Factors for Preeclampsia in Women with Chronic Hypertension. Hypertension 2008, 51, 1002–1009. [Google Scholar] [CrossRef] [Scilit]
- Pittara, T.; Vyrides, A.; Lamnisos, D.; Giannakou, K. Pre-eclampsia and long-term health outcomes for mother and infant: An umbrella review. BJOG Int. J. Obstet. Gynaecol. 2021, 128, 1421–1430. [Google Scholar] [CrossRef] [Scilit]
- Hoodbhoy, Z.; Mohammed, N.; Rozi, S.; Aslam, N.; Mohsin, S.; Ashiqali, S.; Ali, H.; Sattar, S.; Chowdhury, D.; Hasan, B.S. Cardiovascular Dysfunction in Children Exposed to Preeclampsia During Fetal Life. J. Am. Soc. Echocardiogr. 2021, 34, 653–661. [Google Scholar] [CrossRef] [Scilit]
- Ortega, M.A.; Fraile-Martínez, O.; García-Montero, C.; Sáez, M.A.; Álvarez-Mon, M.A.; Torres-Carranza, D.; Álvarez-Mon, M.; Bujan, J.; García-Honduvilla, N.; Bravo, C.; et al. The Pivotal Role of the Placenta in Normal and Pathological Pregnancies: A Focus on Preeclampsia, Fetal Growth Restriction, and Maternal Chronic Venous Disease. Cells 2022, 11, 568. [Google Scholar] [CrossRef] [Scilit]
- Aplin, J.D.; Myers, J.E.; Timms, K.; Westwood, M. Tracking placental development in health and disease. Nat. Rev. Endocrinol. 2020, 16, 479–494. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burton, G.J. Basic Structure of a Placental Villus. In Benirschke’s Pathology of the Human Placenta; Baergen, R.N., Burton, G.J., Kaplan, C.G., Eds.; Springer Nature: Cham, Switzerland, 2022; pp. 59–109. [Google Scholar]
- Magee, L.A.; Brown, M.A.; Hall, D.R.; Gupte, S.; Hennessy, A.; Karumanchi, S.A.; Kenny, L.C.; McCarthy, F.; Myers, J.; Poon, L.C.; et al. The 2021 International Society for the Study of Hypertension in Pregnancy classification, diagnosis & management recommendations for international practice. Pregnancy Hypertens. 2021, 27, 148–169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Herzog, E.M.; Eggink, A.J.; Reijnierse, A.; Kerkhof, M.A.; de Krijger, R.R.; Roks, A.J.; Reiss, I.K.; Nigg, A.L.; Eilers, P.H.; Steegers, E.A.; et al. Impact of early- and late-onset preeclampsia on features of placental and newborn vascular health. Placenta 2016, 49, 72–79. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Teka, H.; Yemane, A.; Abraha, H.E.; Berhe, E.; Tadesse, H.; Gebru, F.; Yahya, M.; Tadesse, Y.; Gebre, D.; Abrha, M.; et al. Clinical presentation, maternal-fetal, and neonatal outcomes of early-onset versus late onset preeclampsia-eclampsia syndrome in a teaching hospital in a low-resource setting: A retrospective cohort study. PLoS ONE 2023, 18, e0281952. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lyall, F.; Robson, S.C.; Bulmer, J.N. Spiral Artery Remodeling and Trophoblast Invasion in Preeclampsia and Fetal Growth Restriction. Hypertension 2013, 62, 1046–1054. [Google Scholar] [CrossRef] [Scilit]
- Rana, S.; Lemoine, E.; Granger, J.P.; Karumanchi, S.A. Preeclampsia: Pathophysiology, challenges, and perspectives. Circ. Res. 2019, 124, 1094–1112. [Google Scholar] [CrossRef] [Scilit]
- Redman, C.W.; Staff, A.C.; Roberts, J.M. Syncytiotrophoblast stress in preeclampsia: The convergence point for multiple pathways. Am. J. Obstet. Gynecol. 2021, 226, S907–S927. [Google Scholar] [CrossRef] [Scilit]
- Roberts, J.M.; Escudero, C. The placenta in preeclampsia. Pregnancy Hypertens. 2012, 2, 72–83. [Google Scholar] [CrossRef] [Scilit]
- Ortega, M.A.; Romero, B.; Asúnsolo, Á.; Sola, M.; Álavrez-Rocha, M.J.; Sainz, F.; Álavrez-Mon, M.; Buján, J.; García-Honduvilla, N. Patients with Incompetent Valves in Chronic Venous Insufficiency Show Increased Systematic Lipid Peroxidation and Cellular Oxidative Stress Markers. Oxidative Med. Cell. Longev. 2019, 2019, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Parrish, M.R.; Murphy, S.R.; Rutland, S.; Wallace, K.; Wenzel, K.; Wallukat, G.; Keiser, S.; Ray, L.F.; Dechend, R.; Martin, J.N.; et al. The Effect of Immune Factors, Tumor Necrosis Factor-α, and Agonistic Autoantibodies to the Angiotensin II Type I Receptor on Soluble fms-Like Tyrosine-1 and Soluble Endoglin Production in Response to Hypertension during Pregnancy. Am. J. Hypertens. 2010, 23, 911–916. [Google Scholar] [CrossRef] [Scilit]
- Raghupathy, R. Cytokines as Key Players in the Pathophysiology of Preeclampsia. Med. Princ. Pract. 2013, 22, 8–19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bînă, A.M.; Sturza, A.; Iancu, I.; Mocanu, A.G.; Bernad, E.; Chiriac, D.V.; Borza, C.; Craina, M.L.; Popa, Z.L.; Muntean, D.M.; et al. Placental oxidative stress and monoamine oxidase expression are increased in severe preeclampsia: A pilot study. Mol. Cell. Biochem. 2022, 477, 2851–2861. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Erlandsson, L.; Ohlsson, L.; Masoumi, Z.; Rehnström, M.; Cronqvist, T.; Edvinsson, L.; Hansson, S.R. Preliminary evidence that blocking the uptake of placenta-derived preeclamptic extracellular vesicles protects the vascular endothelium and prevents vasoconstriction. Sci. Rep. 2023, 13, 1–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burton, G.; Woods, A.; Jauniaux, E.; Kingdom, J. Rheological and Physiological Consequences of Conversion of the Maternal Spiral Arteries for Uteroplacental Blood Flow during Human Pregnancy. Placenta 2009, 30, 473–482. [Google Scholar] [CrossRef] [Scilit]
- Bhojwani, K.; Agrawal, A. Study of Histopathological Changes in the Placenta in Preeclampsia. Cureus 2022, 14, e30347. [Google Scholar] [CrossRef] [Scilit]
- Ortega, M.A.; De Leon-Oliva, D.; Gimeno-Longas, M.J.; Boaru, D.L.; Fraile-Martinez, O.; García-Montero, C.; de Castro, A.V.; Barrena-Blázquez, S.; López-González, L.; Amor, S.; et al. Vascular Calcification: Molecular Networking, Pathological Implications and Translational Opportunities. Biomolecules 2024, 14, 275. [Google Scholar] [CrossRef] [Scilit]
- Fournier, D.E.; Kiser, P.K.; Beach, R.J.; Dixon, S.J.; Séguin, C.A. Dystrophic calcification and heterotopic ossification in fibrocartilaginous tissues of the spine in diffuse idiopathic skeletal hyperostosis (DISH). Bone Res. 2020, 8, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Kerr, D. Hypercalcemia and metastatic calcification. Cardiovasc. Res. 1997, 36, 293–297. [Google Scholar] [CrossRef] [Scilit]
- Baergen, R.; Burton, G.; Kaplan, C. (Eds.) Benirschke’s Pathology of the Human Placenta, 7th ed.; Springer: New York, NY, USA, 2022. [Google Scholar]
- Mirza, F.G.; Ghulmiyyah, L.M.; Tamim, H.; Makki, M.; Jeha, D.; Nassar, A. To ignore or not to ignore placental calcifications on prenatal ultrasound: A systematic review and meta-analysis. J. Matern. Fetal Neonatal Med. 2017, 31, 797–804. [Google Scholar] [CrossRef] [Scilit]
- Wallingford, M.C.; Benson, C.; Chavkin, N.W.; Chin, M.T.; Frasch, M.G. Placental Vascular Calcification and Cardiovascular Health: It Is Time to Determine How Much of Maternal and Offspring Health Is Written in Stone. Front. Physiol. 2018, 9, 1044. [Google Scholar] [CrossRef] [Scilit]
- Poggi, S.; Bostrom, K.; Demer, L.; Skinner, H.; Koos, B. Placental Calcification: A Metastatic Process? Placenta 2001, 22, 591–596. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schiffer, V.; van Haren, A.; De Cubber, L.; Bons, J.; Coumans, A.; van Kuijk, S.M.; Spaanderman, M.; Al-Nasiry, S. Ultrasound evaluation of the placenta in healthy and placental syndrome pregnancies: A systematic review. Eur. J. Obstet. Gynecol. Reprod. Biol. 2021, 262, 45–56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ortega, M.A.; Garcia-Puente, L.M.; Fraile-Martinez, O.; Pekarek, T.; García-Montero, C.; Bujan, J.; Pekarek, L.; Barrena-Blázquez, S.; Gragera, R.; Rodríguez-Rojo, I.C.; et al. Oxidative Stress, Lipid Peroxidation and Ferroptosis Are Major Pathophysiological Signatures in the Placental Tissue of Women with Late-Onset Preeclampsia. Antioxidants 2024, 13, 591. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garcia-Puente, L.M.; Fraile-Martinez, O.; García-Montero, C.; Bujan, J.; De León-Luis, J.A.; Bravo, C.; Rodríguez-Benitez, P.; Pintado, P.; Ruiz-Labarta, F.J.; Álvarez-Mon, M.; et al. Placentas from Women with Late-Onset Preeclampsia Exhibit Increased Expression of the NLRP3 Inflammasome Machinery. Biomolecules 2023, 13, 1644. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Proudfoot, D. Calcium Signaling and Tissue Calcification. Cold Spring Harb. Perspect. Biol. 2019, 11, a035303. [Google Scholar] [CrossRef] [Scilit]
- Yung, L.-M.; Sánchez-Duffhues, G.; Dijke, P.T.; Yu, P.B. Bone morphogenetic protein 6 and oxidized low-density lipoprotein synergistically recruit osteogenic differentiation in endothelial cells. Cardiovasc. Res. 2015, 108, 278–287. [Google Scholar] [CrossRef] [Scilit]
- Rusanescu, G.; Weissleder, R.; Aikawa, E. Notch Signaling in Cardiovascular Disease and Calcification. Curr. Cardiol. Rev. 2008, 4, 148–156. [Google Scholar] [CrossRef] [Scilit]
- Cui, J.; Zhang, M.; Zhang, Y.-Q.; Xu, Z.-H. JNK pathway: Diseases and therapeutic potential. Acta Pharmacol. Sin. 2007, 28, 601–608. [Google Scholar] [CrossRef] [Scilit]
- Jang, W.-G.; Kim, E.-J.; Kim, D.-K.; Ryoo, H.-M.; Lee, K.-B.; Kim, S.-H.; Choi, H.-S.; Koh, J.-T. BMP2 Protein Regulates Osteocalcin Expression via Runx2-mediated Atf6 Gene Transcription. J. Biol. Chem. 2012, 287, 905–915. [Google Scholar] [CrossRef] [Scilit]
- Zhu, L.; Zhang, N.; Yan, R.; Yang, W.; Cong, G.; Yan, N.; Ma, W.; Hou, J.; Yang, L.; Jia, S. Hyperhomocysteinemia induces vascular calcification by activating the transcription factor RUNX2 via Krüppel-like factor 4 up-regulation in mice. J. Biol. Chem. 2019, 294, 19465–19474. [Google Scholar] [CrossRef] [Scilit]
- Rashdan, N.A.; Sim, A.M.; Cui, L.; Phadwal, K.; Roberts, F.L.; Carter, R.; Ozdemir, D.D.; Hohenstein, P.; Hung, J.; Kaczynski, J.; et al. Osteocalcin Regulates Arterial Calcification Via Altered Wnt Signaling and Glucose Metabolism. J. Bone Miner. Res. 2019, 35, 357–367. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ortega, M.A.; Saez, M.; Asúnsolo, Á.; Romero, B.; Bravo, C.; Coca, S.; Sainz, F.; Álvarez-Mon, M.; Buján, J.; García-Honduvilla, N. Upregulation of VEGF and PEDF in Placentas of Women with Lower Extremity Venous Insufficiency during Pregnancy and Its Implication in Villous Calcification. BioMed Res. Int. 2019, 2019, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Takahashi, K.; Nuckolls, G.; Takahashi, I.; Nonaka, K.; Nagata, M.; Ikura, T.; Slavkin, H.; Shum, L. Msx2 is a repressor of chondrogenic differentiation in migratory cranial neural crest cells. Dev. Dyn. 2001, 222, 252–262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, G.; Zheng, Q.; Engin, F.; Munivez, E.; Chen, Y.; Sebald, E.; Krakow, D.; Lee, B. Dominance of SOX9 function over RUNX2 during skeletogenesis. Proc. Natl. Acad. Sci. USA 2006, 103, 19004–19009. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Xiao, Q.; Xiao, J.; Niu, C.; Li, Y.; Zhang, X.; Zhou, Z.; Shu, G.; Yin, G. Wnt/β-catenin signalling: Function, biological mechanisms, and therapeutic opportunities. Signal Transduct. Target. Ther. 2022, 7, 1–23. [Google Scholar] [CrossRef] [Scilit]
- Albanese, I.; Khan, K.; Barratt, B.; Al-Kindi, H.; Schwertani, A. Atherosclerotic Calcification: Wnt Is the Hint. J. Am. Heart Assoc. 2018, 7, e007356. [Google Scholar] [CrossRef] [Scilit]
- Ortega, M.A.; García-Montero, C.; Fraile-Martinez, Ó.; De Leon-Oliva, D.; Boaru, D.L.; Bravo, C.; De Leon-Luis, J.A.; Saez, M.A.; Asúnsolo, A.; Romero-Gerechter, I.; et al. Assessment of Tissue Expression of the Oxytocin–Vasopressin Pathway in the Placenta of Women with a First-Episode Psychosis during Pregnancy. Int. J. Mol. Sci. 2023, 24, 10254. [Google Scholar] [CrossRef] [Scilit]
- Sánchez-Trujillo, L.; Fraile-Martinez, O.; García-Montero, C.; García-Puente, L.M.; Guijarro, L.G.; De Leon-Oliva, D.; Boaru, D.L.; Gardón-Alburquerque, D.; Lobo, M.d.V.T.; Royuela, M.; et al. Chronic Venous Disease during Pregnancy Is Related to Inflammation of the Umbilical Cord: Role of Allograft Inflammatory Factor 1 (AIF-1) and Interleukins 10 (IL-10), IL-12 and IL-18. J. Pers. Med. 2023, 13, 956. [Google Scholar] [CrossRef] [Scilit]
- García-Honduvilla, N.; Ortega, M.A.; Asúnsolo, Á.; Álvarez-Rocha, M.J.; Romero, B.; De León-Luis, J.; Álvarez-Mon, M.; Buján, J. Placentas from women with pregnancy-associated venous insufficiency show villi damage with evidence of hypoxic cellular stress. Hum. Pathol. 2018, 77, 45–53. [Google Scholar] [CrossRef] [Scilit]
- Chomczynski, P.; Sacchi, N. The single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction: Twenty-something years on. Nat. Protoc. 2006, 1, 581–585. [Google Scholar] [CrossRef] [Scilit]
- Vallone, P.M.; Butler, J.M. AutoDimer: A screening tool for primer-dimer and hairpin structures. BioTechniques 2004, 37, 226–231. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hogan, M.C.; Foreman, K.J.; Naghavi, M.; Ahn, S.Y.; Wang, M.; Makela, S.M.; Lopez, A.D.; Lozano, R.; Murray, C.J. Maternal mortality for 181 countries, 1980–2008: A systematic analysis of progress towards Millennium Development Goal 5. Lancet 2010, 375, 1609–1623. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, K.-H.; Chen, L.-R.; Lee, Y.-H. The Role of Preterm Placental Calcification in High-Risk Pregnancy as a Predictor of Poor Uteroplacental Blood Flow and Adverse Pregnancy Outcome. Ultrasound Med. Biol. 2012, 38, 1011–1018. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, K.-H.; Seow, K.-M.; Chen, L.-R. The role of preterm placental calcification on assessing risks of stillbirth. Placenta 2015, 36, 1039–1044. [Google Scholar] [CrossRef] [Scilit]
- Chen, K.H.; Chen, L.R.; Lee, Y.H. Exploring the relationship between preterm placental calcification and adverse maternal and fetal outcome. Ultrasound Obstet. Gynecol. 2011, 37, 328–334. [Google Scholar] [CrossRef] [Scilit]
- Vafaei, H.; Karimi, Z.; Akbarzadeh-Jahromi, M.; Asadian, F. Association of placental chorangiosis with pregnancy complication and prenatal outcome: A case-control study. BMC Pregnancy Childbirth 2021, 21, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Moran, M.C.; Mulcahy, C.; Zombori, G.; Ryan, J.; Downey, P.; McAuliffe, F.M. Placental volume, vasculature and calcification in pregnancies complicated by pre-eclampsia and intra-uterine growth restriction. Eur. J. Obstet. Gynecol. Reprod. Biol. 2015, 195, 12–17. [Google Scholar] [CrossRef] [Scilit]
- Awuah, S.P.; Okai, I.; Ntim, E.A.; Bedu-Addo, K. Prevalence, placenta development, and perinatal outcomes of women with hypertensive disorders of pregnancy at Komfo Anokye Teaching Hospital. PLoS ONE 2020, 15, e0233817. [Google Scholar] [CrossRef] [Scilit]
- Wallingford, M.C.; Gammill, H.S.; Giachelli, C.M. Slc20a2 deficiency results in fetal growth restriction and placental calcification associated with thickened basement membranes and novel CD13 and lamininα1 expressing cells. Reprod. Biol. 2016, 16, 13–26. [Google Scholar] [CrossRef] [Scilit]
- Cooley, S.M.; Donnelly, J.C.; Walsh, T.; McMahon, C.; Gillan, J.; Geary, M.P. The impact of ultrasonographic placental architecture on antenatal course, labor and delivery in a low-risk primigravid population. J. Matern. Fetal Neonatal Med. 2010, 24, 493–497. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McKenna, D.; Tharmaratnam, S.; Mahsud, S.; Dornan, J. Ultrasonic evidence of placental calcification at 36 weeks’ gestation: Maternal and fetal outcomes. Acta Obstet. Gynecol. Scand. 2004, 84, 7–10. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Li, X.; Zhang, W.; He, J.; Xu, B.; Lei, B.; Wang, Z.; Cates, C.; Rousselle, T.; Li, J. Activation of AMPK inhibits inflammatory response during hypoxia and reoxygenation through modulating JNK-mediated NF-κB pathway. Metabolism 2018, 83, 256–270. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Zhou, S.; Cai, W.; Han, G.; Li, J.; Chen, M.; Li, H. Hypoxia/reoxygenation activates the JNK pathway and accelerates synovial senescence. Mol. Med. Rep. 2020, 22, 265–276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ortega, M.A.; Asúnsolo, Á.; Pekarek, L.; Alvarez-Mon, M.A.; Delforge, A.; Sáez, M.A.; Coca, S.; Sainz, F.; Mon, M.Á.; Buján, J.; et al. Histopathological study of JNK in venous wall of patients with chronic venous insufficiency related to osteogenesis process. Int. J. Med. Sci. 2021, 18, 1921–1934. [Google Scholar] [CrossRef] [Scilit]
- Szabo, S.; Mody, M.; Romero, R.; Xu, Y.; Karaszi, K.; Mihalik, N.; Xu, Z.; Bhatti, G.; Fule, T.; Hupuczi, P.; et al. Activation of Villous Trophoblastic P38 and ERK1/2 Signaling Pathways in Preterm Preeclampsia and HELLP Syndrome. Pathol. Oncol. Res. 2015, 21, 659–668. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Shen, L.; Nguyen-Hoang, L.; Zhou, Q.; Wang, C.C.; Lu, X.; Sahota, D.; Chong, K.C.; Ying, H.; Gu, W.; et al. Aspirin versus metformin in pregnancies at high risk of preterm pre-eclampsia in China (AVERT): Protocol for a multicentre, double-blind, 3-arm randomised controlled trial. BMJ Open 2024, 14, e074493. [Google Scholar] [CrossRef] [Scilit]
- He, L.; Wu, X.; Zhan, F.; Li, X.; Wu, J. Protective role of metformin in preeclampsia via the regulation of NF-κB/sFlt-1 and Nrf2/HO-1 signaling pathways by activating AMPK. Placenta 2023, 143, 91–99. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Wang, W.; Chao, Y.; Zhang, F.; Wang, C. CTRP13 attenuates vascular calcification by regulating Runx2. FASEB J. 2019, 33, 9627–9637. [Google Scholar] [CrossRef] [Scilit]
- Peng, B.; Zhu, H.; Klausen, C.; Ma, L.; Wang, Y.-L.; Leung, P.C. GnRH regulates trophoblast invasion via RUNX2-mediated MMP2/9 expression. Mol. Hum. Reprod. 2015, 22, 119–129. [Google Scholar] [CrossRef] [Scilit]
- Martinez-Fierro, M.L.; Carrillo-Arriaga, J.G.; Luevano, M.; Lugo-Trampe, A.; Delgado-Enciso, I.; Rodriguez-Sanchez, I.P.; Garza-Veloz, I. Serum levels of miR-628-3p and miR-628-5p during the early pregnancy are increased in women who subsequently develop preeclampsia. Pregnancy Hypertens. 2019, 16, 120–125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fu, L.; Peng, S.; Wu, W.; Ouyang, Y.; Tan, D.; Fu, X. LncRNA HOTAIRM1 promotes osteogenesis by controlling JNK/AP-1 signalling-mediated RUNX2 expression. J. Cell. Mol. Med. 2019, 23, 7517–7524. [Google Scholar] [CrossRef] [Scilit]
- Sancisi, V.; Manzotti, G.; Gugnoni, M.; Rossi, T.; Gandolfi, G.; Gobbi, G.; Torricelli, F.; Catellani, F.; Valle, I.F.D.; Remondini, D.; et al. RUNX2 expression in thyroid and breast cancer requires the cooperation of three non-redundant enhancers under the control of BRD4 and c-JUN. Nucleic Acids Res. 2017, 45, 11249–11267. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kong, P.; Chen, R.; Zou, F.-Q.; Wang, Y.; Liu, M.-C.; Wang, W.-G. HIF-1α repairs degenerative chondrocyte glycolytic metabolism by the transcriptional regulation of Runx2. Eur. Rev. Med. Pharmacol. Sci. 2021, 25, 1206–1214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tao, J.; Miao, R.; Liu, G.; Qiu, X.; Yang, B.; Tan, X.; Liu, L.; Long, J.; Tang, W.; Jing, W. Spatiotemporal correlation between HIF-1α and bone regeneration. FASEB J. 2022, 36, e22520. [Google Scholar] [CrossRef] [Scilit]
- Kwon, T.-G.; Zhao, X.; Yang, Q.; Li, Y.; Ge, C.; Zhao, G.; Franceschi, R.T. Physical and functional interactions between Runx2 and HIF-1α induce vascular endothelial growth factor gene expression. J. Cell. Biochem. 2011, 112, 3582–3593. [Google Scholar] [CrossRef] [Scilit]
- Merceron, C.; Ranganathan, K.; Wang, E.; Tata, Z.; Makkapati, S.; Khan, M.P.; Mangiavini, L.; Yao, A.Q.; Castellini, L.; Levi, B.; et al. Hypoxia-inducible factor 2α is a negative regulator of osteoblastogenesis and bone mass accrual. Bone Res. 2019, 7, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Song, L.; Huang, Y.; Long, J.; Li, Y.; Pan, Z.; Fang, F.; Long, Y.; Huang, C.; Qi, N.; Guo, Y.; et al. The Role of Osteocalcin in Placental Function in Gestational Diabetes Mellitus. Reprod. Biol. 2021, 21, 100566. [Google Scholar] [CrossRef] [Scilit]
- Millar, S.A.; Patel, H.; Anderson, S.I.; England, T.J.; O’sullivan, S.E. Osteocalcin, Vascular Calcification, and Atherosclerosis: A Systematic Review and Meta-analysis. Front. Endocrinol. 2017, 8, 183. [Google Scholar] [CrossRef] [Scilit]
- Scatena, M.; Liaw, L.; Giachelli, C.M. Osteopontin: A multifunctional molecule regulating chronic inflammation and vascular disease. Arterioscler. Thromb. Vasc. Biol. 2007, 27, 2302–2309. [Google Scholar] [CrossRef] [Scilit]
- Lund, S.A.; Giachelli, C.M.; Scatena, M. The role of osteopontin in inflammatory processes. J. Cell Commun. Signal. 2009, 3, 311–322. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johnson, G.A.; Burghardt, R.C.; Bazer, F.W.; Spencer, T.E. Osteopontin: Roles in Implantation and Placentation. Biol. Reprod. 2003, 69, 1458–1471. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ke, R.; Zheng, L.; Zhao, F.; Xia, J. Osteopontin Promotes Trophoblast Invasion in the Smooth Muscle Cell-Endothelial Co-Culture at Least via Targeting Integrin αvβ3. Cell Transplant. 2020, 29, 0963689720965979. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stenczer, B.; Rigó, J., Jr.; Prohászka, Z.; Derzsy, Z.; Lázár, L.; Makó, V.; Cervenak, L.; Balogh, K.; Mézes, M.; Karádi, I.; et al. Plasma osteopontin concentrations in preeclampsia–is there an association with endothelial injury? Clin. Chem. Lab. Med. CCLM 2009, 48, 181–187. [Google Scholar] [CrossRef] [Scilit]
- Xia, J.; Qiao, F.; Su, F.; Liu, H. Implication of expression of osteopontin and its receptor integrin ανβ3 in the placenta in the development of preeclampsia. J. Huazhong Univ. Sci. Technol. [Med. Sci.] 2009, 29, 755–760. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Steitz, S.A.; Speer, M.Y.; McKee, M.D.; Liaw, L.; Almeida, M.; Yang, H.; Giachelli, C.M. Osteopontin Inhibits Mineral Deposition and Promotes Regression of Ectopic Calcification. Am. J. Pathol. 2002, 161, 2035–2046. [Google Scholar] [CrossRef] [Scilit]
- Wada, T.; McKee, M.D.; Steitz, S.; Giachelli, C.M. Calcification of Vascular Smooth Muscle Cell Cultures. Circ. Res. 1999, 84, 166–178. [Google Scholar] [CrossRef] [Scilit]
- Lok, Z.S.Y.; Lyle, A.N. Osteopontin in Vascular Disease. Arterioscler. Thromb. Vasc. Biol. 2019, 39, 613–622. [Google Scholar] [CrossRef] [Scilit]
- Ge, Q.; Ruan, C.-C.; Ma, Y.; Tang, X.-F.; Wu, Q.-H.; Wang, J.-G.; Zhu, D.-L.; Gao, P.-J. Osteopontin regulates macrophage activation and osteoclast formation in hypertensive patients with vascular calcification. Sci. Rep. 2017, 7, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Tossetta, G.; Fantone, S.; Giannubilo, S.R.; Busilacchi, E.M.; Ciavattini, A.; Castellucci, M.; Di Simone, N.; Mattioli-Belmonte, M.; Marzioni, D. Pre-eclampsia onset and SPARC: A possible involvement in placenta development. J. Cell. Physiol. 2018, 234, 6091–6098. [Google Scholar] [CrossRef] [Scilit]
- Loegl, J.; Nussbaumer, E.; Hiden, U.; Majali-Martinez, A.; Ghaffari-Tabrizi-Wizy, N.; Cvitic, S.; Lang, I.; Desoye, G.; Huppertz, B. Pigment epithelium-derived factor (PEDF): A novel trophoblast-derived factor limiting feto-placental angiogenesis in late pregnancy. Angiogenesis 2016, 19, 373–388. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Y.; Chen, X.; Jiao, S.; Wang, Y. Upregulated pigment epithelium-derived factor (PEDF) promotes trophoblast apoptosis and inhibits invasion in preeclampsia. Reprod. Biol. 2021, 21, 100576. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, F.; Song, N.; Tombran-Tink, J.; Niyibizi, C. Pigment Epithelium-Derived Factor Enhances Differentiation and Mineral Deposition of Human Mesenchymal Stem Cells. Stem Cells 2013, 31, 2714–2723. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tyson, K.L.; Reynolds, J.L.; McNair, R.; Zhang, Q.; Weissberg, P.L.; Shanahan, C.M. Osteo/Chondrocytic Transcription Factors and Their Target Genes Exhibit Distinct Patterns of Expression in Human Arterial Calcification. Arterioscler. Thromb. Vasc. Biol. 2003, 23, 489–494. [Google Scholar] [CrossRef] [Scilit]
- Faleeva, M.; Ahmad, S.; Theofilatos, K.; Lynham, S.; Watson, G.; Whitehead, M.; Marhuenda, E.; Iskratsch, T.; Cox, S.; Shanahan, C.M. Sox9 Accelerates Vascular Aging by Regulating Extracellular Matrix Composition and Stiffness. Circ. Res. 2024, 134, 307–324. [Google Scholar] [CrossRef] [Scilit]
- Liang, H.; Zhang, Q.; Lu, J.; Yang, G.; Tian, N.; Wang, X.; Tan, Y.; Tan, D. MSX2 Induces Trophoblast Invasion in Human Placenta. PLoS ONE 2016, 11, e0153656. [Google Scholar] [CrossRef] [Scilit]
- Hornbachner, R.; Lackner, A.; Papuchova, H.; Haider, S.; Knöfler, M.; Mechtler, K.; Latos, P.A. MSX2 safeguards syncytiotrophoblast fate of human trophoblast stem cells. Proc. Natl. Acad. Sci. USA 2021, 118, e2105130118. [Google Scholar] [CrossRef] [Scilit]
- Kwon, D.-H.; Choe, N.; Shin, S.; Ryu, J.; Kim, N.; Eom, G.H.; Nam, K.-I.; Kim, H.S.; Ahn, Y.; Kim, Y.-K.; et al. Regulation of MDM2 E3 ligase-dependent vascular calcification by MSX1/2. Exp. Mol. Med. 2021, 53, 1781–1791. [Google Scholar] [CrossRef] [Scilit]
- Shao, J.-S.; Cheng, S.-L.; Pingsterhaus, J.M.; Charlton-Kachigian, N.; Loewy, A.P.; Towler, D.A. Msx2 promotes cardiovascular calcification by activating paracrine Wnt signals. J. Clin. Investig. 2005, 115, 1210–1220. [Google Scholar] [CrossRef]
- Al-Aly, Z.; Shao, J.-S.; Lai, C.-F.; Huang, E.; Cai, J.; Behrmann, A.; Cheng, S.-L.; Towler, D.A. Aortic Msx2-Wnt Calcification Cascade Is Regulated by TNF-α–Dependent Signals in Diabetic Ldlr−/− Mice. Arterioscler. Thromb. Vasc. Biol. 2007, 27, 2589–2596. [Google Scholar] [CrossRef] [Scilit]
- Sonderegger, S.; Pollheimer, J.; Knöfler, M. Wnt Signalling in Implantation, Decidualisation and Placental Differentiation–Review. Placenta 2010, 31, 839–847. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Knöfler, M.; Pollheimer, J. Human placental trophoblast invasion and differentiation: A particular focus on Wnt signaling. Front. Genet. 2013, 4, 190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dietrich, B.; Haider, S.; Meinhardt, G.; Pollheimer, J.; Knöfler, M. WNT and NOTCH signaling in human trophoblast development and differentiation. Cell. Mol. Life Sci. 2022, 79, 1–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Z.; Wang, X.; Zhang, L.; Shi, Y.; Wang, J.; Yan, H. Wnt/β-catenin signaling pathway in trophoblasts and abnormal activation in preeclampsia. Mol. Med. Rep. 2017, 16, 1007–1013. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Zhang, Z.; Zeng, X.; Wang, J.; Zhang, L.; Song, W.; Shi, Y. Wnt/β-catenin signaling pathway in severe preeclampsia. J. Mol. Histol. 2018, 49, 317–327. [Google Scholar] [CrossRef] [Scilit]
- Tayyar, A.T.; Karakus, R.; Sahin, M.E.; Topbas, N.F.; Sahin, E.; Karakus, S.; Yalcın, E.T.; Tayyar, A. Wnt signaling pathway in early- and late-onset preeclampsia: Evaluation with Dickkopf-1 and R-Spondin-3 glycoproteins. Arch. Gynecol. Obstet. 2019, 299, 1551–1556. [Google Scholar] [CrossRef] [Scilit]
- Bartoli-Leonard, F.; Wilkinson, F.L.; Langford-Smith, A.W.W.; Alexander, M.Y.; Weston, R. The Interplay of SIRT1 and Wnt Signaling in Vascular Calcification. Front. Cardiovasc. Med. 2018, 5, 183. [Google Scholar] [CrossRef] [Scilit]
- Bundy, K.; Boone, J.; Simpson, C.L. Wnt Signaling in Vascular Calcification. Front. Cardiovasc. Med. 2021, 8, 708470. [Google Scholar] [CrossRef] [Scilit]
- Gaur, T.; Lengner, C.J.; Hovhannisyan, H.; Bhat, R.A.; Bodine, P.V.N.; Komm, B.S.; Javed, A.; van Wijnen, A.J.; Stein, J.L.; Stein, G.S.; et al. Canonical WNT Signaling Promotes Osteogenesis by Directly Stimulating Runx2 Gene Expression. J. Biol. Chem. 2005, 280, 33132–33140. [Google Scholar] [CrossRef] [Scilit]
- Vega, O.A.; Lucero, C.M.J.; Araya, H.F.; Jerez, S.; Tapia, J.C.; Antonelli, M.; Salazar-Onfray, F.; Heras, F.L.; Thaler, R.; Riester, S.M.; et al. Wnt/β-Catenin Signaling Activates Expression of the Bone-Related Transcription Factor RUNX2 in Select Human Osteosarcoma Cell Types. J. Cell. Biochem. 2017, 118, 3662–3674. [Google Scholar] [CrossRef] [Scilit]
- Lutze, G.; Haarmann, A.; Demanou Toukam, J.A.; Buttler, K.; Wilting, J.; Becker, J. Non-canonical WNT-signaling controls differentiation of lymphatics and extension lymphangiogenesis via RAC and JNK signaling. Sci. Rep. 2019, 9, 4739. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rosso, S.B.; Sussman, D.; Wynshaw-Boris, A.; Salinas, P.C. Wnt signaling through Dishevelled, Rac and JNK regulates dendritic development. Nat. Neurosci. 2004, 8, 34–42. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, L.; Jin, Y.; Feng, S.; Zou, Y.; Xu, S.; Qiu, S.; Li, L.; Zheng, J. Role of Wnt/β-catenin, Wnt/c-Jun N-terminal kinase and Wnt/Ca2+ pathways in cisplatin-induced chemoresistance in ovarian cancer. Exp. Ther. Med. 2016, 12, 3851–3858. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zeng, J.; Marcus, A.; Buhtoiarova, T.; Mittal, K. Distribution and potential significance of intravillous and intrafibrinous particulate microcalcification. Placenta 2017, 50, 94–98. [Google Scholar] [CrossRef] [Scilit]
- Winarno, G.N.A.; Pribadi, A.; Maruli, H.J.; Achmad, E.D.; Anwar, R.; Mose, J.C.; Nisa, A.S.; Trianasari, N. Ratio of Serum Calcium to Magnesium Levels on Pregnancy with and without Preeclampsia. Med. Sci. Monit. 2021, 27, e932032. [Google Scholar] [CrossRef] [Scilit]
- Omotayo, M.O.; Dickin, K.L.; O’Brien, K.O.; Neufeld, L.M.; De Regil, L.M.; Stoltzfus, R.J. Calcium Supplementation to Prevent Preeclampsia: Translating Guidelines into Practice in Low-Income Countries. Adv. Nutr. Int. Rev. J. 2016, 7, 275–278. [Google Scholar] [CrossRef] [Scilit]
- Huppertz, B.; Kingdom, J.; Caniggia, I.; Desoye, G.; Black, S.; Korr, H.; Kaufmann, P. Hypoxia Favours Necrotic versus Apoptotic Shedding of Placental Syncytiotrophoblast into the Maternal Circulation. Placenta 2003, 24, 181–190. [Google Scholar] [CrossRef] [Scilit]











| HC (n = 43) | LO-PE (n = 68) | p-Value | |
|---|---|---|---|
| Average age (years) ± SD | 31,348 ± 5117 | 29,015 ± 4816 | * p = 0.0154 |
| Nulliparous (total number) n (%) | 14 (32.56) | 53 (77.94) | *** p < 0.0001 |
| Average gestational age (weeks) ± SD | 39,069 ± 1486 | 38,627 ± 1434 | NS |
| Cesarean sections (total number) n (%) | 8 (18.60) | 15 (22.06) | NS |
| Placenta weight (g) mean ± SD | 500,977 ± 65,331 | 370,254 ± 61,647 | *** p < 0.0001 |
| Antigen | Species | Dilution | Provider | Protocol Specifications |
|---|---|---|---|---|
| JNK | Rabbit | 1:250 | Abcam (ab124956) Cambridge, UK | 0.1% Triton in PBS, 10 min before incubation with blocking solution. |
| RUNX2 | Goat | 1:100 | Santa Cruz (sc-8566) Dallas, TX, USA | 0.1% Triton in PBS, 10 min before incubation with blocking solution. |
| OSC | Goat | 1:50 | Santa Cruz (sc-18319) Dallas, TX, USA | 0.1% Triton in PBS, 10 min before incubation with blocking solution. |
| OSP | Mouse | 1:50 | Santa Cruz (sc-73631) Dallas, TX, USA | 0.1% Triton in PBS, 10 min before incubation with blocking solution. |
| PEDF | Mouse | 1:500 | Abcam (ab115489) Cambridge, UK | Citrate buffer in heat (pH = 6). |
| MSX2/HOX8 | Rabbit | 1:100 | Abcam (ab190070) Cambridge, UK | Sodium citrate 10 mM pH = 6 before incubation with blocking solution. |
| SOX9 | Mouse | 1:250 | Abcam (ab76997) Cambridge, UK | Sodium citrate 10 mM pH = 6 before incubation with blocking solution. |
| WNT-1 | Rabbit | 1:50 | Abcam (ab63934) Cambridge, UK | 0.1% Triton in PBS, 10 min before incubation with blocking solution. |
| β-catenin | Mouse | 1:100 | Abcam (ab231305) Cambridge, UK | No protocol specifications |
| IgG (Rabbit) | Mouse | 1:1000 | Sigma-Aldrich (RG96/B5283) St. Louis, MO, USA | No protocol specifications |
| IgG (Cabra) | Mouse | 1:100 | Sigma-Aldrich (GT34/B3148) St. Louis, MO, USA | No protocol specifications |
| IgG (Ratón) | Goat | 1:300 | Sigma-Aldrich (F2012/045K6072) St. Louis, MO, USA | No protocol specifications |
| Gene | Sequence Fwd (5′ → 3′) | Sequence Rev (5′ → 3′) | T (°C) |
|---|---|---|---|
| TBP | TGCACAGGAGCCAAGAGTGAA | CACATCACAGCTCCCCACCA | 60 |
| JNK | TGCCTGACAAAAGCAAGCAATCA | TCTGAGTCAGCGTTTTCCTTGT | 61 |
| RUNX2 | CGCCTCACAAACAACCACAG | TCACTGTGCTGAAGAGGCTG | 59 |
| OSC | ATGAGAGCCCTCACACTCCT | CTTGGACACAAAGGCTGCAC | 61 |
| OSP | AGCAGAATCTCCTAGCCCCA | ACGGCTGTCCCAATCAGAAG | 57 |
| PEDF | GTGTGCAGGCTTAGAGGGACTA | ATGCAGAGGAGTAGCACCAG | 50 |
| MSX2/HOX8 | ATTCAGAAGATGGAGCGGCG | ATATGTCCTCCTACTCCTGCCC | 59 |
| SOX9 | GGAAGTCGGTGAAGAACGGG | CAAGGTCGAGTGAGCTGTGT | 57 |
| WNT-1 | TGCGCTTCCTCATGAACCTT | TGCTAGCGAGTCTGTTTGGG | 59 |
| β-catenin 1 | GGAGGAAGGTCTGAGGAGCA | AGGCTCCAGAAGCAGTCATC | 60 |
| HC (n = 43) | LO-PE (n = 68) | p-Value | |
|---|---|---|---|
| No calcification % (n) | 51.16% (22) | 10.29% (7) | *** p < 0.0001 |
| Calcification % (n) | 48.84% (21) | 89.71% (61) | |
| Metastatic % (n) | 47.62% (10) | 62.30% (38) | |
| Dystrophic % (n) | 52.38% (11) | 37.70% (23) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ortega, M.A.; Pekarek, T.; De Leon-Oliva, D.; Boaru, D.L.; Fraile-Martinez, O.; García-Montero, C.; Bujan, J.; Pekarek, L.; Barrena-Blázquez, S.; Gragera, R.; et al. Placental Tissue Calcification and Its Molecular Pathways in Female Patients with Late-Onset Preeclampsia. Biomolecules 2024, 14, 1237. https://doi.org/10.3390/biom14101237
Ortega MA, Pekarek T, De Leon-Oliva D, Boaru DL, Fraile-Martinez O, García-Montero C, Bujan J, Pekarek L, Barrena-Blázquez S, Gragera R, et al. Placental Tissue Calcification and Its Molecular Pathways in Female Patients with Late-Onset Preeclampsia. Biomolecules. 2024; 14(10):1237. https://doi.org/10.3390/biom14101237
Chicago/Turabian StyleOrtega, Miguel A., Tatiana Pekarek, Diego De Leon-Oliva, Diego Liviu Boaru, Oscar Fraile-Martinez, Cielo García-Montero, Julia Bujan, Leonel Pekarek, Silvestra Barrena-Blázquez, Raquel Gragera, and et al. 2024. "Placental Tissue Calcification and Its Molecular Pathways in Female Patients with Late-Onset Preeclampsia" Biomolecules 14, no. 10: 1237. https://doi.org/10.3390/biom14101237
APA StyleOrtega, M. A., Pekarek, T., De Leon-Oliva, D., Boaru, D. L., Fraile-Martinez, O., García-Montero, C., Bujan, J., Pekarek, L., Barrena-Blázquez, S., Gragera, R., Rodríguez-Benitez, P., Hernández-Fernández, M., López-González, L., Díaz-Pedrero, R., Asúnsolo, Á., Álvarez-Mon, M., García-Honduvilla, N., Saez, M. A., De León-Luis, J. A., & Bravo, C. (2024). Placental Tissue Calcification and Its Molecular Pathways in Female Patients with Late-Onset Preeclampsia. Biomolecules, 14(10), 1237. https://doi.org/10.3390/biom14101237

