Serum Leptin Receptor and the rs1137101 Variant of the LEPR Gene Are Associated with Bladder Cancer
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Design and Subject Description
2.2. Blood Sample Collection
2.3. Biochemical Measurements
2.4. Genomic DNA Extraction
2.5. Genotyping of the Study Subjects
2.5.1. Genotyping Using PCR-RFLP
2.5.2. Genotyping Using Sanger Sequencing
2.6. Statistical Analysis
3. Results
3.1. Baseline Variables
3.2. Association of LEP and LEPR Genetic Variants with BC
3.3. Haplotype Association of the LEPR Gene with BC Risk
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jubber, I.; Ong, S.; Bukavina, L.; Black, P.C.; Compérat, E.; Kamat, A.M.; Kiemeney, L.; Lawrentschuk, N.; Lerner, S.P.; Meeks, J.J.; et al. Epidemiology of Bladder Cancer in 2023: A Systematic Review of Risk Factors. Eur. Urol. 2023, 84, 176–190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, F.; Han, Z.; Lu, J.; Zhong, W. Development and validation of a tobacco smoking-related index for predicting overall survival and immunotherapy response in bladder cancer. Environ. Sci. Pollut. Res. 2023, 30, 68701–68715. [Google Scholar] [CrossRef] [Scilit]
- Silverman, D.T.; Koutros, S.; Figueroa, J.D.; Prokunina-Olsson, L.; Rothman, N. Bladder Cancer. In Cancer Epidemiology and Prevention, 4th ed.; Oxford Academic: New York, NY, USA, 2017; pp. 977–996. [Google Scholar] [CrossRef] [Scilit]
- Hadkhale, K.; Martinsen, J.I.; Weiderpass, E.; Kjaerheim, K.; Sparen, P.; Tryggvadottir, L.; Lynge, E.; Pukkala, E. Occupational exposure to solvents and bladder cancer: A population-based case control study in Nordic countries. Int. J. Cancer 2017, 140, 1736–1746. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Díaz De Ståhl, T.; Segersten, U.; Malmström, P.U. Molecular genetics of bladder cancer: An update. Minerva Urol. Nefrol. 2008, 60, 205–216. [Google Scholar]
- Turati, F.; Bosetti, C.; Polesel, J.; Serraino, D.; Montella, M.; Libra, M.; Facchini, G.; Ferraroni, M.; Tavani, A.; La Vecchia, C.; et al. Family history of cancer and the risk of bladder cancer: A case-control study from Italy. Cancer Epidemiol. 2017, 48, 29–35. [Google Scholar] [CrossRef] [Scilit]
- Lichtenstein, P.; Holm, N.V.; Verkasalo, P.K.; Iliadou, A.; Kaprio, J.; Koskenvuo, M.; Pukkala, E.; Skytthe, A.; Hemminki, K. Environmental and heritable factors in the causation of cancer—Analyses of cohorts of twins from Sweden, Denmark, and Finland. N. Engl. J. Med. 2000, 343, 78–85. [Google Scholar] [CrossRef] [Scilit]
- Mucci, L.A.; Hjelmborg, J.B.; Harris, J.R.; Czene, K.; Havelick, D.J.; Scheike, T.; Graff, R.E.; Holst, K.; Möller, S.; Unger, R.H.; et al. Familial Risk and Heritability of Cancer Among Twins in Nordic Countries. JAMA 2016, 315, 68–76. [Google Scholar] [CrossRef] [Scilit]
- García-Closas, M.; Malats, N.; Silverman, D.; Dosemeci, M.; Kogevinas, M.; Hein, D.W.; Tardón, A.; Serra, C.; Carrato, A.; García-Closas, R.; et al. NAT2 slow acetylation, GSTM1 null genotype, and risk of bladder cancer: Results from the Spanish Bladder Cancer Study and meta-analyses. Lancet 2005, 366, 649–659. [Google Scholar] [CrossRef] [Scilit]
- Klimčáková, L.; Habalová, V.; Sivoňová, M.; Nagy, V.; Šalagovič, J.; Židzik, J. Effect of NAT2 gene polymorphism on bladder cancer risk in Slovak population. Mol. Biol. Rep. 2011, 38, 1287–1293. [Google Scholar] [CrossRef] [Scilit]
- Noguchi, J.L.; Liss, M.A.; Parsons, J.K. Obesity, Physical Activity and Bladder Cancer. Curr. Urol. Rep. 2015, 16, 74. [Google Scholar] [CrossRef] [Scilit]
- Qin, Q.; Xu, X.; Wang, X.; Zheng, X.Y. Obesity and risk of bladder cancer: A meta-analysis of cohort studies. Asian Pac. J. Cancer Prev. 2013, 14, 3117–3121. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Keimling, M.; Behrens, G.; Schmid, D.; Jochem, C.; Leitzmann, M.F. The association between physical activity and bladder cancer: Systematic review and meta-analysis. Br. J. Cancer 2014, 110, 1862–1870. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, Y.; Wang, Y.; Wu, Q.; Jin, H.; Ma, G.; Liu, H.; Wang, M.; Zhang, Z.; Chu, H. Association between obesity and bladder cancer recurrence: A meta-analysis. Clin. Chim. Acta 2018, 480, 41–46. [Google Scholar] [CrossRef] [Scilit]
- Seruga, B.; Zhang, H.; Bernstein, L.J.; Tannock, I.F. Cytokines and their relationship to the symptoms and outcome of cancer. Nat. Rev. Cancer 2008, 8, 887–899. [Google Scholar] [CrossRef] [Scilit]
- Fain, J.N. Release of interleukins and other inflammatory cytokines by human adipose tissue is enhanced in obesity and primarily due to the nonfat cells. Vitam. Horm. 2006, 74, 443–477. [Google Scholar] [CrossRef] [Scilit]
- Dey, P.; Li, J.; Zhang, J.; Chaurasiya, S.; Strom, A.; Wang, H.; Liao, W.T.; Cavallaro, F.; Denz, P.; Bernard, V.; et al. Oncogenic KRAS-Driven Metabolic Reprogramming in Pancreatic Cancer Cells Utilizes Cytokines from the Tumor Microenvironment. Cancer Discov. 2020, 10, 608–625. [Google Scholar] [CrossRef] [Scilit]
- Houseknecht, K.L.; Baile, C.A.; Matteri, R.L.; Spurlock, M.E. The biology of leptin: A review. J. Anim. Sci. 1998, 76, 1405–1420. [Google Scholar] [CrossRef] [Scilit]
- Friedman, J.M.; Mantzoros, C.S. 20 years of leptin: From the discovery of the leptin gene to leptin in our therapeutic armamentarium. Metabolism 2015, 64, 1–4. [Google Scholar] [CrossRef] [Scilit]
- Pelleymounter, M.A.; Cullen, M.J.; Baker, M.B.; Hecht, R.; Winters, D.; Boone, T.; Collins, F. Effects of the obese gene product on body weight regulation in ob/ob mice. Science 1995, 269, 540–543. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mazahreh, T.S.; Alfaqih, M.; Saadeh, R.; Al-Zoubi, N.A.; Hatamleh, M.; Alqudah, A.; Aleshawi, A.J.; Alzoubi, A. The Effects of Laparoscopic Sleeve Gastrectomy on the Parameters of Leptin Resistance in Obesity. Biomolecules 2019, 9, 533. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Enriori, P.J.; Evans, A.E.; Sinnayah, P.; Cowley, M.A. Leptin resistance and obesity. Obesity 2006, 14 (Suppl. S5), 254s–258s. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aljanabi, M.A.; Alfaqih, M.A.; Khanfar, M.; Amarin, Z.O.; Elsalem, L.; Saadeh, R.; Al-Mughales, F. Leptin and the GA genotype of rs2167270 of the LEP gene increase the risk of prediabetes. Biomed. Rep. 2021, 14, 44. [Google Scholar] [CrossRef] [Scilit]
- Saadeh, N.; Alfaqih, M.A.; Mansour, H.; Khader, Y.S.; Saadeh, R.; Al-Dwairi, A.; Nusier, M. Serum homocysteine is associated with polycystic ovarian syndrome in Jordan. Biomed. Rep. 2018, 9, 439–445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alfaqih, M.A.; Khader, Y.S.; Al-Dwairi, A.N.; Alzoubi, A.; Al-Shboul, O.; Hatim, A. Lower Levels of Serum Adiponectin and the T Allele of rs1501299 of the ADIPOQ Gene Are Protective against Polycystic Ovarian Syndrome in Jordan. Korean J. Fam. Med. 2018, 39, 108–113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alfaqih, M.A.; Al-Mughales, F.; Al-Shboul, O.; Al Qudah, M.; Khader, Y.S.; Al-Jarrah, M. Association of Adiponectin and rs1501299 of the ADIPOQ Gene with Prediabetes in Jordan. Biomolecules 2018, 8, 117. [Google Scholar] [CrossRef] [Scilit]
- Shi, Y.Y.; He, L. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell. Res. 2005, 15, 97–98. [Google Scholar] [CrossRef] [Scilit]
- Shen, J.; Li, Z.; Chen, J.; Song, Z.; Zhou, Z.; Shi, Y. SHEsisPlus, a toolset for genetic studies on polyploid species. Sci. Rep. 2016, 6, 24095. [Google Scholar] [CrossRef] [Scilit]
- Basen-Engquist, K.; Chang, M. Obesity and cancer risk: Recent review and evidence. Curr. Oncol. Rep. 2011, 13, 71–76. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Scarpace, P.J. The role of leptin in leptin resistance and obesity. Physiol. Behav. 2006, 88, 249–256. [Google Scholar] [CrossRef] [Scilit]
- Gruzdeva, O.; Borodkina, D.; Uchasova, E.; Dyleva, Y.; Barbarash, O. Leptin resistance: Underlying mechanisms and diagnosis. Diabetes Metab. Syndr. Obes. 2019, 12, 191–198. [Google Scholar] [CrossRef] [Scilit]
- Huang, X.F.; Chen, J.Z. Obesity, the PI3K/Akt signal pathway and colon cancer. Obes. Rev. 2009, 10, 610–616. [Google Scholar] [CrossRef] [Scilit]
- Cantley, L.C. The phosphoinositide 3-kinase pathway. Science 2002, 296, 1655–1657. [Google Scholar] [CrossRef] [Scilit]
- Philp, A.J.; Campbell, I.G.; Leet, C.; Vincan, E.; Rockman, S.P.; Whitehead, R.H.; Thomas, R.J.; Phillips, W.A. The phosphatidylinositol 3’-kinase p85alpha gene is an oncogene in human ovarian and colon tumors. Cancer Res. 2001, 61, 7426–7429. [Google Scholar]
- Vivanco, I.; Sawyers, C.L. The phosphatidylinositol 3-Kinase AKT pathway in human cancer. Nat. Rev. Cancer 2002, 2, 489–501. [Google Scholar] [CrossRef]
- Knowles, M.A.; Platt, F.M.; Ross, R.L.; Hurst, C.D. Phosphatidylinositol 3-kinase (PI3K) pathway activation in bladder cancer. Cancer Metastasis Rev. 2009, 28, 305–316. [Google Scholar] [CrossRef] [Scilit]
- Yuan, S.S.; Chung, Y.F.; Chen, H.W.; Tsai, K.B.; Chang, H.L.; Huang, C.H.; Su, J.H. Aberrant expression and possible involvement of the leptin receptor in bladder cancer. Urology 2004, 63, 408–413. [Google Scholar] [CrossRef] [Scilit]
- Jenkins, A.B.; Markovic, T.P.; Fleury, A.; Campbell, L.V. Carbohydrate intake and short-term regulation of leptin in humans. Diabetologia 1997, 40, 348–351. [Google Scholar] [CrossRef] [Scilit]
- Nyante, S.J.; Gammon, M.D.; Kaufman, J.S.; Bensen, J.T.; Lin, D.Y.; Barnholtz-Sloan, J.S.; Hu, Y.; He, Q.; Luo, J.; Millikan, R.C. Common genetic variation in adiponectin, leptin, and leptin receptor and association with breast cancer subtypes. Breast Cancer Res. Treat. 2011, 129, 593–606. [Google Scholar] [CrossRef] [Scilit]
- Pechlivanis, S.; Bermejo, J.L.; Pardini, B.; Naccarati, A.; Vodickova, L.; Novotny, J.; Hemminki, K.; Vodicka, P.; Försti, A. Genetic variation in adipokine genes and risk of colorectal cancer. Eur. J. Endocrinol. 2009, 160, 933–940. [Google Scholar] [CrossRef] [Scilit]
- Marcello, M.A.; Calixto, A.R.; de Almeida, J.F.; Martins, M.B.; Cunha, L.L.; Cavalari, C.A.; Etchebehere, E.C.; da Assumpção, L.V.; Geloneze, B.; Carvalho, A.L.; et al. Polymorphism in LEP and LEPR May Modify Leptin Levels and Represent Risk Factors for Thyroid Cancer. Int. J. Endocrinol. 2015, 2015, 173218. [Google Scholar] [CrossRef] [Scilit]
- Rodrigues, P.R.; Maia, L.L.; Santos, M.; Peterle, G.T.; Alves, L.U.; Takamori, J.T.; Souza, R.P.; Barbosa, W.M.; Mercante, A.M.; Nunes, F.D.; et al. Leptin receptor expression and Gln223Arg polymorphism as prognostic markers in oral and oropharyngeal cancer. Genet. Mol. Res. 2015, 14, 14979–14988. [Google Scholar] [CrossRef] [Scilit]
- He, J.; Xi, B.; Ruiter, R.; Shi, T.Y.; Zhu, M.L.; Wang, M.Y.; Li, Q.X.; Zhou, X.Y.; Qiu, L.X.; Wei, Q.Y. Association of LEP G2548A and LEPR Q223R polymorphisms with cancer susceptibility: Evidence from a meta-analysis. PLoS ONE 2013, 8, e75135. [Google Scholar] [CrossRef] [Scilit]
- Bains, V.; Kaur, H.; Badaruddoza, B. Association analysis of polymorphisms in LEP (rs7799039 and rs2167270) and LEPR (rs1137101) gene towards the development of type 2 diabetes in North Indian Punjabi population. Gene 2020, 754, 144846. [Google Scholar] [CrossRef] [Scilit]
- Gorska, E.; Popko, K.; Stelmaszczyk-Emmel, A.; Ciepiela, O.; Kucharska, A.; Wasik, M. Leptin receptors. Eur. J. Med. Res. 2010, 15, 50. [Google Scholar] [CrossRef] [Scilit]
- Farrokhi, M.; Dabirzadeh, M.; Fadaee, E.; Beni, A.A.; Saadatpour, Z.; Rezaei, A.; Heidari, Z. Polymorphism in Leptin and Leptin Receptor Genes May Modify Leptin Levels and Represent Risk Factors for Multiple Sclerosis. Immunol. Investig. 2016, 45, 328–335. [Google Scholar] [CrossRef] [Scilit]
- van Rossum, C.T.; Hoebee, B.; van Baak, M.A.; Mars, M.; Saris, W.H.; Seidell, J.C. Genetic variation in the leptin receptor gene, leptin, and weight gain in young Dutch adults. Obes. Res. 2003, 11, 377–386. [Google Scholar] [CrossRef] [Scilit]
- Staiger, H.; Tschritter, O.; Machann, J.; Thamer, C.; Fritsche, A.; Maerker, E.; Schick, F.; Häring, H.U.; Stumvoll, M. Relationship of serum adiponectin and leptin concentrations with body fat distribution in humans. Obes. Res. 2003, 11, 368–372. [Google Scholar] [CrossRef] [Scilit]
- Banerji, M.A.; Faridi, N.; Atluri, R.; Chaiken, R.L.; Lebovitz, H.E. Body composition, visceral fat, leptin, and insulin resistance in Asian Indian men. J. Clin. Endocrinol. Metab. 1999, 84, 137–144. [Google Scholar] [CrossRef] [Scilit]
| Locus | SNP ID 1 | Location and Base Change | Forward Primer Reverse Primer | PCR 2 Program (34 Cycles) | PCR Product Size (bp) | Restriction Enzyme, Incubation Temperature, and Time | RFLP 3 Product (bp) |
|---|---|---|---|---|---|---|---|
| LEP | rs7799039 | Promoter (GA) | 5′GGGCTGGGAACTTTCTCTAAAG′3 5′CCTGACTTCCTGCAACATCT′3 | 95 °C for 3 min, 35 cycles of 30 s at 95 °C, 30 s at 58.8 °C, and 1 min at 72 °C | 276 | BtsIMutI, 55 °C, 1 h | GG: 276 GA: 276, 222, and 54 AA: 222 and 54 |
| LEP | rs791620 | Regulatory region (CA) | 5′CTGGAGGGACATCAAGGATTT′3 5′AAGAAAGACCAGCAGAGAAGG′3 | 95 °C for 3 min, 35 cycles of 30 s at 95 °C, 30 s at 63.0 °C, and 1 min at 72 °C | 348 | AscI 37 °C, 1 h | AA: 348 CA: 348, 262, and 86 CC: 262 and 86 |
| LEP | rs2167270 | 5′ UTR (GA) | 5′CTGGAGGGACATCAAGGATTT’3 5′AAGAAAGACCAGCAGAGAAGG′3 | 95 °C for 3 min, 35 cycles of 30 s at 95 °C, 30 s at 58.8 °C, and 1 min at 72 °C | 348 | HPYCH4III 37 °C, 1 h | GG: 348 GA: 348, 292, and 56 AA: 292 and 56 |
| LEPR | rs1137101 | Exon 6 (AG) | 5′CTGTGCCAACAGCCAAACTC′3 5′ACAGAATTTAAGTGACAATGGCAGA′3 | 95 °C for 3 min, 35 cycles of 30 s at 95 °C, 30 s at 58.8 °C, and 1 min at 72 °C | 315 | BsrI 65 °C, 1 h | AA: 315 AG: 72, 170, and 242 GG: 72 and 170 |
| Locus | SNP ID 1 | Location and Base Change | Forward Primer Reverse Primer | PCR Program (34 Cycles) | PCR Product Size (bp) | Sequencing Primer |
|---|---|---|---|---|---|---|
| LEPR | rs1137100 | Exon 4 variant (AG) | 5′TGCCTGCTGGACTCTCAAAG′3 5′AAGGTGTGTTTTTCTATTTCAAAGC′3 | 95 °C for 3 min, 35 cycles of 30 s at 95 °C, 30 s at 58.8 °C, and 1 min at 72 °C | 492 | 5′GCAAATTTAGAAGACTACAAGG′3 |
| LEPR | rs1805094 | Exon 14 variant (GC) | 5′GTTCAGGTGCGCTGTAAGA′3 5′CTCCAAGAAACACTGCCTATCA′3 | 95 °C for 3 min, 35 cycles of 30 s at 95 °C, 30 s at 59.8 °C, and 1 min at 72 °C | 604 | 5′CTGAGGCCCAAAGAGTCTAA G′3 |
| Variable | Control (n = 116) | Bladder Cancer (n = 116) | p-Value 1 |
|---|---|---|---|
| Gender (n) (%) | 0.66 | ||
| Males | 103 (88.79%) | 100 (86.21%) | |
| Females | 13 (11.21%) | 16 (13.79%) | |
| Smoking (n) (%) | 0.08 | ||
| Yes | 64 (55.17%) | 77 (66.38%) | |
| No | 52 (44.83%) | 39 (33.62%) | |
| DM 2 (n) (%) | 0.89 | ||
| Yes | 42 (36.21%) | 43 (37.07%) | |
| No | 74 (63.79%) | 73 (62.93%) | |
| Age (years) | 60.60 ± 12.12 | 64.71 ± 12.40 | 0.01 |
| BMI 3 (kg/m2) | 27.68 (5.43) | 28.10 (7.43) | 0.93 |
| Leptin (ng/mL) | 12.12 (18.49) | 15.59 (15.44) | 0.04 |
| Leptin/BMI 3 | 0.39 (0.67) | 0.58 (0.61) | 0.01 |
| Leptin Receptor (ng/mL) | 29.05 (38.68) | 21.49 (24.53) | 0.001 |
| Locus | SNP ID | Allele | Control n (%) | Bladder Cancer n (%) | p-Value 1 |
|---|---|---|---|---|---|
| LEP | rs7799039 | G A | 130 (56.0%) 102 (44.0%) | 160 (69.0%) 72 (31.0%) | 0.004 |
| LEP | rs791620 | C A | 227 (97.8%) 5 (2.3%) | 220 (94.8%) 12 (5.2%) | 0.08 |
| LEP | rs2167270 | G A | 151 (65.1%) 81 (34.9%) | 151 (65.1%) 81 (34.9%) | 1.00 |
| LEPR | rs1137100 | A G | 225 (97.0%) 7 (3.0%) | 214 (92.2%) 18 (7.8) | 0.02 |
| LEPR | rs1137101 | A G | 176 (76.0%) 56 (24.0) | 150 (64.7%) 82 (35.3%) | 0.008 |
| LEPR | rs1805094 | G C | 175 (75.4%) 57 (24.6%) | 163 (70.3%) 69 (29.7%) | 0.21 |
| Locus | SNP ID | Genotype | Control n (%) | Bladder Cancer n (%) | p-Value 1 |
|---|---|---|---|---|---|
| LEP | rs7799039 | GG GA AA | 41 (35.3%) 48 (41.4%) 27 (23.3%) | 55 (47.4%) 50 (43.1%) 11 (9.1%) | 0.01 |
| LEP | rs791620 | CC CA AA | 112 (96.5%) 3 (2.6%) 1 (0.9%) | 106 (91.4%) 8 (6.9%) 2 (1.7%) | 0.29 |
| LEP | rs2167270 | GG GA AA | 48 (41.4%) 55 (47.4%) 13 (11.2%) | 55 (47.4%) 41 (35.4%) 20 (17.2%) | 0.13 |
| LEPR | rs1137100 | AA AG GG | 109 (93.9%) 7 (44.0%) 0 (6.0%) | 99 (85.3%) 16 (13.8%) 1 (0.9%) | 0.05 |
| LEPR | rs1137101 | AA AG GG | 67 (57.8%) 42 (36.2%) 7 (6.0%) | 51 (43.9%) 48 (41.4%) 17 (14.7%) | 0.03 |
| LEPR | rs1805094 | GG GC CC | 71 (61.2%) 33 (28.5%) 12 (10.3%) | 65 (56.0%) 33 (28.5%) 18 (15.5%) | 0.48 |
| Variable | OR 1 | 95% CI 2 | p-Value 3 |
|---|---|---|---|
| Age (years) | 1.03 | 1.01–1.05 | 0.02 |
| Leptin Receptor (ng/mL) | 0.98 | 0.97–0.99 | 0.002 |
| rs1137101 | |||
| AA | Reference | - | - |
| AG | 1.51 | 0.85–2.70 | 0.16 |
| GG | 3.42 | 1.27–9.20 | 0.02 |
| LEP | rs7799039 | rs791620 | rs2167270 | Control | Bladder Cancer | OR 1 (95% CI) 2 | p-Value 3 |
| 1 | A | C | A | 0.13 | 0.05 | 0.34 (0.17–0.70) | 0.002 |
| 2 | A | C | G | 0.31 | 0.24 | 0.73 (0.49–1.10) | 0.13 |
| 3 | G | C | A | 0.21 | 0.29 | 1.60 (1.05–2.46) | 0.03 |
| 4 | G | C | G | 0.33 | 0.36 | 1.17 (0.80–1.72) | 0.42 |
| LEPR | rs1137100 | rs1137101 | rs1805094 | Control | Bladder Cancer | OR 1 (95% CI) 2 | p-Value 3 |
| 1 | A | A | C | 0.24 | 0.24 | 1.03 (0.67–1.57) | 0.90 |
| 2 | A | A | G | 0.52 | 0.41 | 0.65 (0.45–0.94) | 0.02 |
| 3 | A | G | G | 0.21 | 0.24 | 1.231 (0.79–1.91) | 0.35 |
| 4 | G | G | G | 0.03 | 0.06 | 1.89 (0.74–4.85) | 0.18 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alfaqih, M.A.; Elsalem, L.; Nusier, M.; Mhedat, K.; Khader, Y.; Ababneh, E. Serum Leptin Receptor and the rs1137101 Variant of the LEPR Gene Are Associated with Bladder Cancer. Biomolecules 2023, 13, 1498. https://doi.org/10.3390/biom13101498
Alfaqih MA, Elsalem L, Nusier M, Mhedat K, Khader Y, Ababneh E. Serum Leptin Receptor and the rs1137101 Variant of the LEPR Gene Are Associated with Bladder Cancer. Biomolecules. 2023; 13(10):1498. https://doi.org/10.3390/biom13101498
Chicago/Turabian StyleAlfaqih, Mahmoud A., Lina Elsalem, Mohamad Nusier, Khawla Mhedat, Yousef Khader, and Ebaa Ababneh. 2023. "Serum Leptin Receptor and the rs1137101 Variant of the LEPR Gene Are Associated with Bladder Cancer" Biomolecules 13, no. 10: 1498. https://doi.org/10.3390/biom13101498
APA StyleAlfaqih, M. A., Elsalem, L., Nusier, M., Mhedat, K., Khader, Y., & Ababneh, E. (2023). Serum Leptin Receptor and the rs1137101 Variant of the LEPR Gene Are Associated with Bladder Cancer. Biomolecules, 13(10), 1498. https://doi.org/10.3390/biom13101498

