O-GlcNAcylation and Regulation of Galectin-3 in Extraembryonic Endoderm Differentiation
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Western and Immunodot Blot Assays
2.3. Quantitative RT-PCR
2.4. RNA Sequencing
2.5. Galectin-3 ELISA
2.6. Statistical Analysis
3. Results
3.1. Global Reduction in O-GlcNAcylation Levels in Feeder-Free XEN Cells
3.2. OGA Inhibition Alters Pluripotency and XEN Marker Expression Patterns
3.3. Lgals3 Expression Is Decreased in XEN Compared to ES Cells
3.4. Elevated Extracellular to Intracellular Ratio of Galectin-3 in XEN Cells
3.5. Inhibiting OGT in ES Cells Increases Galectin-3 Secretion
3.6. OGA Inhibition Is Not Sufficient to Inhibit XEN Differentiation
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Holt, G.D.; Hart, G.W. The subcellular distribution of terminal N-acetylglucosamine moieties: Localization of a novel protein-saccharide linkage, O-linked GlcNAc. J. Biol. Chem. 1986, 261, 8049–8057. [Google Scholar] [CrossRef] [Scilit]
- Bond, M.R.; Hanover, J.A. A little sugar goes a long way: The cell biology of O-GlcNAc. J. Cell Biol. 2015, 208, 869–880. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Comer, F.I.; Hart, G.W. Reciprocity between O-GlcNAc and O-phosphate on the carboxyl terminal domain of RNA Polymerase II. Biochemistry 2001, 40, 7845–7852. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hart, G.W.; Housley, M.P.; Slawson, C. Cycling of O-linked β-N-acetylglucosamine on nucleocytoplasmic proteins. Nature 2007, 446, 1017–1022. [Google Scholar] [CrossRef] [Scilit]
- Zeidan, Q.; Hart, G.W. The intersections between O-GlcNAcylation and phosphorylation: Implications for multiple signaling pathways. J. Cell Sci. 2010, 123, 13–22. [Google Scholar] [CrossRef] [Scilit]
- Haltiwangers, R.S.; Blomberg, M.A.; Hart, G.W. Glycosylation of nuclear and cytoplasmic proteins: Purification and characterization of a uridine diphospho-N-acetylglucosamine:polypeptide b-N-acetylglucosaminyltransferase. J. Biol. Chem. 1992, 267, 9005–9013. [Google Scholar] [CrossRef] [Scilit]
- Dong, D.L.-Y.; Hart, G.W. Purification and characterization of an O-GlcNAc selective N-acetyl-b-d-glucosaminidase from rat spleen cytosol. J. Biol. Chem. 1994, 269, 19321–19330. [Google Scholar] [CrossRef] [Scilit]
- McClain, D.A. Hexosamines as mediators of nutrient sensing and regulation in diabetes. J. Diabetes Complicat. 2002, 16, 72–80. [Google Scholar] [CrossRef] [Scilit]
- Love, D.C.; Hanover, J.A. The hexosamine signaling pathway: Deciphering the “O-GlcNAc code”. Sci. STKE 2005, 2005, re13. [Google Scholar] [CrossRef] [Scilit]
- Walgren, J.L.E.; Vincent, T.S.; Schey, K.L.; Buse, M.G. High glucose and insulin promote O-GlcNAc modification of proteins, including alpha-tubulin. Am. J. Physiol. Endocrinol. Metab. 2003, 284, E424–E434. [Google Scholar] [CrossRef] [Scilit]
- Hawkins, M.; Barzilai, N.; Liu, R.; Hu, M.; Chen, W.; Rossetti, L. Role of the glucosamine pathway in fat-induced insulin resistance. J. Clin. Investig. 1997, 99, 2173–2182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, A.; Miller, D.; Henry, R.; Paruchuri, V.D.P.; O’Meally, R.N.; Boronina, T.; Cole, R.N.; Zachara, N.E. Combined antibody/lectin enrichment identifies extensive changes in the O-GlcNAc sub-proteome upon oxidative stress. J. Proteome Res. 2016, 15, 4318–4336. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Groves, J.A.; Maduka, A.O.; O’Meally, R.N.; Cole, R.N.; Zachara, N.E. Fatty acid synthase inhibits the O-GlcNAcase during oxidative stress. J. Biol. Chem. 2017, 292, 6493–6511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zachara, N.E.; O’Donnell, N.; Cheung, W.D.; Mercer, J.J.; Marth, J.D.; Hart, G.W. Dynamic O-GlcNAc modification of nucleocytoplasmic proteins in response to stress: A survival response of mammalian cells. J. Biol. Chem. 2004, 279, 30133–30142. [Google Scholar] [CrossRef] [Scilit]
- Jang, H.; Kim, T.W.; Yoon, S.; Choi, S.-Y.; Kang, T.-W.; Kim, S.-Y.; Kwon, Y.-W.; Cho, E.-J.; Youn, H.-D. O-GlcNAc regulates pluripotency and reprogramming by directly acting on core components of the pluripotency network. Cell Stem Cell 2012, 11, 62–74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maury, J.J.P.; Chan, K.K.-K.; Zheng, L.; Bardor, M.; Choo, A.B.-H. Excess of O-linked N-acetylglucosamine modifies human pluripotent stem cell differentiation. Stem Cell Res. 2013, 11, 926–937. [Google Scholar] [CrossRef] [Scilit]
- Sherazi, A.A.; Jariwala, K.A.; Cybulski, A.N.; Lewis, J.W.; Karagiannis, J.; Cumming, R.C.; Timoshenko, A.V. Effects of global O-GlcNAcylation on galectin gene-expression profiles in human cancer cell lines. Anticancer Res. 2018, 38, 6691–6697. [Google Scholar] [CrossRef] [Scilit]
- Kim, H.-S.; Park, S.Y.; Choi, Y.R.; Kang, J.G.; Joo, H.J.; Moon, W.K.; Cho, J.W. Excessive O-GlcNAcylation of proteins suppresses spontaneous cardiogenesis in ES cells. FEBS Lett. 2009, 583, 2474–2478. [Google Scholar] [CrossRef] [Scilit]
- Johannes, L.; Jacob, R.; Leffler, H. Galectins at a glance. J. Cell Sci. 2018, 131, jcs208884. [Google Scholar] [CrossRef] [Scilit]
- Timoshenko, A.V. Towards molecular mechanisms regulating the expression of galectins in cancer cells under microenvironmental stress conditions. Cell. Mol. Life Sci. 2015, 72, 4327–4340. [Google Scholar] [CrossRef] [Scilit]
- Tazhitdinova, R.; Timoshenko, A.V. The emerging role of galectins and O-GlcNAc homeostasis in processes of cellular differentiation. Cells 2020, 9, 1792. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mathew, M.P.; Abramowitz, L.K.; Donaldson, J.G.; Hanover, J.A. Nutrient-responsive O-GlcNAcylation dynamically modulates the secretion of glycan-binding protein galectin 3. J. Biol. Chem. 2022, 298, 101743. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Magescas, J.; Sengmanivong, L.; Viau, A.; Mayeux, A.; Dang, T.; Burtin, M.; Nilsson, U.J.; Leffler, H.; Poirier, F.; Terzi, F.; et al. Spindle pole cohesion requires glycosylation-mediated localization of NuMA. Sci. Rep. 2017, 7, 1474. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hart, C.; Chase, L.G.; Hajivandi, M.; Agnew, B. Metabolic labeling and click chemistry detection of glycoprotein markers of mesenchymal stem cell differentiation. Methods Mol. Biol. 2011, 698, 459–484. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rossant, J.; Tam, P.P.L. Emerging asymmetry and embryonic patterning in early mouse development. Dev. Cell 2004, 7, 155–164. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dickson, B.J.; Gatie, M.I.; Spice, D.M.; Kelly, G.M. NOX1 and NOX4 are required for the differentiation of mouse F9 cells into extraembryonic endoderm. PLoS ONE 2017, 12, e0170812. [Google Scholar] [CrossRef] [Scilit]
- Gatie, M.I.; Kelly, G.M. Metabolic profile and differentiation potential of extraembryonic endoderm-like cells. Cell Death Discov. 2018, 4, 42. [Google Scholar] [CrossRef] [Scilit]
- Nairn, A.V.; Aoki, K.; dela Rosa, M.; Porterfield, M.; Lim, J.-M.; Kulik, M.; Pierce, J.M.; Wells, L.; Dalton, S.; Tiemeyer, M.; et al. Regulation of glycan structures in murine embryonic stem cells: Combined transcript profiling of glycan-related genes and glycan structural analysis. J. Biol. Chem. 2012, 287, 37835–37856. [Google Scholar] [CrossRef] [Scilit]
- Speakman, C.M.; Domke, T.C.E.; Wongpaiboonwattana, W.; Sanders, K.; Mudalair, M.; van Aalten, D.M.F.; Barton, G.J.; Stavridis, M.P. Elevated O-GlcNAc levels activate epigenetically repressed genes and delay mouse ESC differentiation without affecting naıve to primed cell transition. Stem Cells 2014, 32, 2605–2615. [Google Scholar] [CrossRef] [Scilit]
- Ying, Q.-L.; Wray, J.; Nichols, J.; Batlle-Morera, L.; Doble, B.; Woodgett, J.; Cohen, P.; Smith, A. The ground state of embryonic stem cell self-renewal. Nature 2008, 453, 519–523. [Google Scholar] [CrossRef] [Scilit]
- Kunath, T.; Arnaud, D.; Uy, G.D.; Okamoto, I.; Chureau, C.; Yamanaka, Y.; Heard, E.; Gardner, R.L.; Avner, P.; Rossant, J. Imprinted X-inactivation in extra-embryonic endoderm cell lines from mouse blastocysts. Development 2005, 132, 1649–1661. [Google Scholar] [CrossRef] [Scilit]
- Anderson, K.G.V.; Hamilton, W.B.; Roske, F.V.; Azad, A.; Knudsen, T.E.; Canham, M.A.; Forrester, L.M.; Brickman, J.M. Insulin fine-tunes self-renewal pathways governing naive pluripotency and extra-embryonic endoderm. Nat. Cell Biol. 2017, 19, 1164–1177. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parrish, N.; Hormozdiari, F.; Eskin, E. Assembly of non-unique insertion content using next-generation sequencing. BMC Bioinform. 2011, 12, 21–40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cecioni, S.; Vocadlo, D.J. Tools for probing and perturbing O-GlcNAc in cells and in vivo. Curr. Opin. Chem. Biol. 2013, 17, 719–728. [Google Scholar] [CrossRef] [Scilit]
- Gatie, M.I.; Cooper, T.T.; Khazaee, R.; Lajoie, G.A.; Kelly, G.M. Lactate enhances mouse ES cell differentiation towards XEN cells in vitro. Stem Cells 2022, 40, 239–259. [Google Scholar] [CrossRef] [Scilit]
- Vinnai, J.R.; Cumming, R.C.; Thompson, G.J.; Timoshenko, A.V. The association between oxidative stress-induced galectins and differentiation of human promyelocytic HL-60 cells. Exp. Cell Res. 2017, 355, 113–123. [Google Scholar] [CrossRef] [Scilit]
- Konrad, R.J.; Zhang, F.; Hale, J.E.; Knierman, M.D.; Becker, G.W.; Kudlow, J.E. Alloxan is an inhibitor of the enzyme O-linked N-acetylglucosamine transferase. Biochem. Biophys. Res. Commun. 2002, 293, 207–212. [Google Scholar] [CrossRef] [Scilit]
- Lu, Y.; Amos, B.; Cruise, E.; Lotan, D.; Lotan, R. A parallel association between differentiation and induction of galectin-1, and inhibition of galectin-3 by retinoic acid in mouse embryonal carcinoma F9 cells. Biol. Chem. 1998, 379, 1323–1331. [Google Scholar] [CrossRef] [Scilit]
- Lu, Y.; Lotan, D.; Lotan, R. Differential regulation of constitutive and retinoic acid-induced galectin-1 gene transcription in murine embryonal carcinoma and myoblastic cells. Biochim. Biophys. Acta Gene Struct. Expr. 2000, 1491, 13–19. [Google Scholar] [CrossRef] [Scilit]
- Iacobini, C.; Fantauzzi, C.B.; Pugliese, G.; Menini, S. Role of galectin-3 in bone cell differentiation, bone pathophysiology and vascular osteogenesis. Int. J. Mol. Sci. 2017, 18, 2481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, T.N.; Alborn, W.E.; Knierman, M.D.; Konrad, R.J. Alloxan is an inhibitor of O-GlcNAc-selective N-acetyl-β-D-glucosaminidase. Biochem. Biophys. Res. Commun. 2006, 350, 1038–1043. [Google Scholar] [CrossRef] [Scilit]
- Bänfer, S.; Schneider, D.; Dewes, J.; Strauss, M.T.; Freibert, S.-A.; Heimerl, T.; Maier, U.G.; Elsässer, H.P.; Jungmann, R.; Jacob, R. Molecular mechanism to recruit galectin-3 into multivesicular bodies for polarized exosomal secretion. Proc. Natl. Acad. Sci. USA 2018, 115, E4396–E4405. [Google Scholar] [CrossRef] [Scilit]
- Hughes, R.C. Secretion of the galectin family of mammalian carbohydrate-binding proteins. Biochim. Biophys. Acta 1999, 1473, 172–185. [Google Scholar] [CrossRef] [Scilit]
- Popa, S.J.; Stewart, S.E.; Moreau, K. Unconventional secretion of annexins and galectins. Semin. Cell Dev. Biol. 2018, 83, 42–50. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chaiyawat, P.; Weeraphan, C.; Netsirisawan, P.; Chokchaichamnankit, D.; Srisomsap, C.; Svasti, J.; Champattanachai, V. Elevated O-GlcNAcylation of extracellular vesicle proteins derived from metastatic colorectal cancer cells. Cancer Genom. Proteom. 2016, 13, 387–398. [Google Scholar]






| Gene | Forward Primer (5′→3′) | Reverse Primer (5′→3′) |
|---|---|---|
| Lgals1 | TCTCAAACCTGGGGAATGTCTC | CTCAAAGGCCACGCACTTAATC |
| Lgals2 | AACATGAAACCAGGGATGTCC | CGAGGGTTAAAATGCAGGTTGAG |
| Lgals3 | AGGAGAGGGAATGATGTTGC | TAGCGCTGGTGAGGGTTATG |
| Lgals4 | GGTCGTGGTGAACGGAAATTC | GTGGAGGGTTGTACCCAGGA |
| Lgals7 | GTGAGGAGCAAGGAGCAGAT | CGGTGGTGGAAGTGGAGATA |
| Lgals8 | CCGATAATCCCCTATGTTGG | GTTCACTTTGCCGTAGATGC |
| Lgals9 | TTGAGGAAGGAGGGTATGTG | AACTGGACTGGCTGAGAGAA |
| Lgals12 | TATGGCACAACAATTTTTGGTGG | GCTTGACAGTGTAGAATCGAGGG |
| Ogt | TTGGCAATTAAACAGAATCCCCT | GGCATGTCGATAATGCTCGAT |
| Oga | TGGTGCCAGTTTGGTTCCAG | TGCTCTGAGGTCGGGTTCA |
| Gfpt1 | GAAGCCAACGCCTGCAAAATC | CCAACGGGTATGAGCTATTCC |
| Gfpt2 | CCAACGGGTATGAGCTATTCC | GACTCTTTCGACCAATGTGGAA |
| Oct4 | CCCAATGCCGTGAAGTTGGA | GCTTTCATGTCCTGGGACTCCT |
| Nanog | TCTTCCTGGTCCCCACAGTTT | GCAAGAATAGTTCTCGGGATGAA |
| FoxA2 | CCCTACGCCAACATGAACTCG | GTTCTGCCGGTAGAAAGGGA |
| Dab2 | GGAGCATGTAGACCATGATG | AAAGGATTTCCGAAAGGGCT |
| Gata6 | ATGGCGTAGAAATGCTGAGG | TGAGGTGGTCGCTTGTGTAG |
| L14 | GGGAGAGGTGGCCTCGGACGC | GGCTGGCTTTCACTCAAAGGCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gatie, M.I.; Spice, D.M.; Garha, A.; McTague, A.; Ahmer, M.; Timoshenko, A.V.; Kelly, G.M. O-GlcNAcylation and Regulation of Galectin-3 in Extraembryonic Endoderm Differentiation. Biomolecules 2022, 12, 623. https://doi.org/10.3390/biom12050623
Gatie MI, Spice DM, Garha A, McTague A, Ahmer M, Timoshenko AV, Kelly GM. O-GlcNAcylation and Regulation of Galectin-3 in Extraembryonic Endoderm Differentiation. Biomolecules. 2022; 12(5):623. https://doi.org/10.3390/biom12050623
Chicago/Turabian StyleGatie, Mohamed I., Danielle M. Spice, Amritpal Garha, Adam McTague, Mariam Ahmer, Alexander V. Timoshenko, and Gregory M. Kelly. 2022. "O-GlcNAcylation and Regulation of Galectin-3 in Extraembryonic Endoderm Differentiation" Biomolecules 12, no. 5: 623. https://doi.org/10.3390/biom12050623
APA StyleGatie, M. I., Spice, D. M., Garha, A., McTague, A., Ahmer, M., Timoshenko, A. V., & Kelly, G. M. (2022). O-GlcNAcylation and Regulation of Galectin-3 in Extraembryonic Endoderm Differentiation. Biomolecules, 12(5), 623. https://doi.org/10.3390/biom12050623

