Loss of the MAF Transcription Factor in Laryngeal Squamous Cell Carcinoma
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Lines
2.2. LSCC Primary Samples
2.3. LSCC Paraffin Samples
2.4. Dual-Luciferase Reporter Assay
2.5. IHC Staining
2.6. Bisulfite Pyrosequencing
2.7. Mutation Screening and DNA Methylation Analysis of MAF by TCGA Database Mining
2.8. MAF Copy Number Variation Analysis
2.9. FIMO Analysis
2.10. Vector Preparation and LSCC Cell Line Transduction
2.11. Real-Time qPCR
2.12. Statistics
3. Results
3.1. MiR-1290 Interacts with the 3′UTR of MAF
3.2. LSCC Samples Are Characterized by the Absence of Nuclear Expression of MAF
3.3. Decreased Expression of MAF in LSCC Is Not Associated with Hypermethylation of Promoter nor Mutations nor with Changes in MAF Gene Copy Number
3.4. Potential Impact of MAF on Regulation of Apoptosis by Binding to Promoter Regions of Apoptosis-Related Genes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fu, X.; Han, Y.; Wu, Y.; Zhu, X.; Lu, X.; Mao, F.; Wang, X.; He, X.; Zhao, Y.; Zhao, Y. Prognostic Role of MicroRNA-21 in Various Carcinomas: A Systematic Review and Meta-Analysis. Eur. J. Clin. Investig. 2011, 41, 1245–1253. [Google Scholar] [CrossRef]
- Chang, S.S.; Jiang, W.W.; Smith, I.; Poeta, L.M.; Begum, S.; Glazer, C.; Shan, S.; Westra, W.; Sidransky, D.; Califano, J.A. MicroRNA Alterations in Head and Neck Squamous Cell Carcinoma. Int. J. Cancer 2008, 123, 2791–2797. [Google Scholar] [CrossRef] [PubMed]
- Janiszewska, J.; Szaumkessel, M.; Kostrzewska-Poczekaj, M.; Bednarek, K.; Paczkowska, J.; Jackowska, J.; Grenman, R.; Szyfter, K.; Wierzbicka, M.; Giefing, M.; et al. Global MiRNA Expression Profiling Identifies MiR-1290 as Novel Potential OncomiR in Laryngeal Carcinoma. PLoS ONE 2015, 10, e0144924. [Google Scholar] [CrossRef] [PubMed]
- Motohashi, H.; Shavit, J.A.; Igarashi, K.; Yamamoto, M.; Engel, J.D. The World According to Maf. Nucleic Acids Res. 1997, 25, 2953–2959. [Google Scholar] [CrossRef] [PubMed]
- Nishizawa, M.; Kataoka, K.; Goto, N.; Fujiwara, K.T.; Kawai, S. V-Maf, a Viral Oncogene That Encodes a “Leucine Zipper” Motif. Proc. Natl. Acad. Sci. USA 1989, 86, 7711–7715. [Google Scholar] [CrossRef] [PubMed]
- Murakami, Y.I.; Yatabe, Y.; Sakaguchi, T.; Sasaki, E.; Yamashita, Y.; Morito, N.; Yoh, K.; Fujioka, Y.; Matsuno, F.; Hata, H.; et al. C-Maf Expression in Angioimmunoblastic T-Cell Lymphoma. Am. J. Surg. Pathol. 2007, 31, 1695–1702. [Google Scholar] [CrossRef] [PubMed]
- Hurt, E.M.; Wiestner, A.; Rosenwald, A.; Shaffer, A.L.; Campo, E.; Grogan, T.; Bergsagel, P.L.; Kuehl, W.M.; Staudt, L.M. Overexpression of C-Maf Is a Frequent Oncogenic Event in Multiple Myeloma That Promotes Proliferation and Pathological Interactions with Bone Marrow Stroma. Cancer Cell 2004, 5, 191–199. [Google Scholar] [CrossRef]
- Pouponnot, C.; Sii-Felice, K.; Hmitou, I.; Rocques, N.; Lecoin, L.; Druillennec, S.; Felder-Schmittbuhl, M.-P.; Eychène, A. Cell Context Reveals a Dual Role for Maf in Oncogenesis. Oncogene 2006, 25, 1299–1310. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, V.; Bell, G.W.; Nam, J.-W.; Bartel, D.P. Predicting Effective MicroRNA Target Sites in Mammalian MRNAs. Elife 2015, 4. [Google Scholar] [CrossRef]
- Mets, E.; Van Peer, G.; Van der Meulen, J.; Boice, M.; Taghon, T.; Goossens, S.; Mestdagh, P.; Benoit, Y.; De Moerloose, B.; Van Roy, N.; et al. MicroRNA-128-3p Is a Novel OncomiR Targeting PHF6 in T-Cell Acute Lymphoblastic Leukemia. Haematologica 2014, 99, 1326–1333. [Google Scholar] [CrossRef] [PubMed]
- Bodnar, M.; Burduk, P.; Antosik, P.; Jarmuz-Szymczak, M.; Wierzbicka, M.; Marszalek, A. Assessment of BRAF V600E (VE1) Protein Expression and BRAF Gene Mutation Status in Codon 600 in Benign and Malignant Salivary Gland Neoplasms. J. Oral Pathol. Med. 2017, 46, 340–345. [Google Scholar] [CrossRef]
- Bodnar, M.; Szylberg, L.; Kazmierczak, W.; Marszalek, A. Tumor Progression Driven by Pathways Activating Matrix Metalloproteinases and Their Inhibitors. J. Oral Pathol. Med. Off. Publ. Int. Assoc. Oral Pathol. Am. Acad. Oral Pathol. 2014, 44, 437–443. [Google Scholar] [CrossRef]
- Remmele, W.; Stegner, H.E. Recommendation for uniform definition of an immunoreactive score (IRS) for immunohistochemical estrogen receptor detection (ER-ICA) in breast cancer tissue. Pathologe 1987, 8, 138–140. [Google Scholar]
- Szaumkessel, M.; Richter, J.; Giefing, M.; Jarmuz, M.; Kiwerska, K.; Tönnies, H.; Grenman, R.; Heidemann, S.; Szyfter, K.; Siebert, R. Pyrosequencing-Based DNA Methylation Profiling of Fanconi Anemia/BRCA Pathway Genes in Laryngeal Squamous Cell Carcinoma. Int. J. Oncol. 2011, 39, 505–514. [Google Scholar] [CrossRef] [PubMed]
- TCGA Research Network. Available online: https://www.cancer.gov/tcga (accessed on 12 July 2021).
- Mounir, M.; Lucchetta, M.; Silva, T.C.; Olsen, C.; Bontempi, G.; Chen, X.; Noushmehr, H.; Colaprico, A.; Papaleo, E. New Functionalities in the TCGAbiolinks Package for the Study and Integration of Cancer Data from GDC and GTEx. PLoS Comput. Biol. 2019, 15, e1006701. [Google Scholar] [CrossRef] [PubMed]
- Giefing, M.; Zemke, N.; Brauze, D.; Kostrzewska-Poczekaj, M.; Luczak, M.; Szaumkessel, M.; Pelinska, K.; Kiwerska, K.; Tönnies, H.; Grenman, R.; et al. High Resolution ArrayCGH and Expression Profiling Identifies PTPRD and PCDH17/PCH68 as Tumor Suppressor Gene Candidates in Laryngeal Squamous Cell Carcinoma. Genes Chromosomes Cancer 2011, 50, 154–166. [Google Scholar] [CrossRef]
- Giefing, M.; Martin-Subero, J.I.; Kiwerska, K.; Jarmuz, M.; Grenman, R.; Siebert, R.; Szyfter, K. Characterization of Homozygous Deletions in Laryngeal Squamous Cell Carcinoma Cell Lines. Cancer Genet. Cytogenet. 2008, 184, 38–43. [Google Scholar] [CrossRef] [PubMed]
- Kulakovskiy, I.V.; Vorontsov, I.E.; Yevshin, I.S.; Sharipov, R.N.; Fedorova, A.D.; Rumynskiy, E.I.; Medvedeva, Y.A.; Magana-Mora, A.; Bajic, V.B.; Papatsenko, D.A.; et al. HOCOMOCO: Towards a Complete Collection of Transcription Factor Binding Models for Human and Mouse via Large-Scale ChIP-Seq Analysis. Nucleic Acids Res. 2018, 46, D252–D259. [Google Scholar] [CrossRef]
- Karolchik, D.; Hinrichs, A.S.; Furey, T.S.; Roskin, K.M.; Sugnet, C.W.; Haussler, D.; Kent, W.J. The UCSC Table Browser Data Retrieval Tool. Nucleic Acids Res. 2004, 32, D493–D496. [Google Scholar] [CrossRef] [PubMed]
- Grant, C.E.; Bailey, T.L.; Noble, W.S. FIMO: Scanning for Occurrences of a given Motif. Bioinformatics 2011, 27, 1017–1018. [Google Scholar] [CrossRef]
- Da Silva, A.R.; Malafaia, G.; Menezes, I.P.P. Biotools: An R Function to Predict Spatial Gene Diversity via an Individual-Based Approach. Genet. Mol. Res. 2017, 16. [Google Scholar] [CrossRef] [PubMed]
- Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Systematic and Integrative Analysis of Large Gene Lists Using DAVID Bioinformatics Resources. Nat. Protoc. 2009, 4, 44–57. [Google Scholar] [CrossRef] [PubMed]
- Kluiver, J.; Slezak-Prochazka, I.; van den Berg, A. Studying MicroRNAs in Lymphoma. Methods Mol. Biol. 2013, 971, 265–276. [Google Scholar] [CrossRef]
- Paczkowska, J.; Janiszewska, J.; Bein, J.; Schneider, M.; Bednarek, K.; Ustaszewski, A.; Hartmann, S.; Hansmann, M.-L.; Giefing, M. The Tumor Suppressive Mir-148a Is Epigenetically Inactivated in Classical Hodgkin Lymphoma. Cells 2020, 9, 2292. [Google Scholar] [CrossRef]
- Chomczynski, P. A Reagent for the Single-Step Simultaneous Isolation of RNA, DNA and Proteins from Cell and Tissue Samples. Biotechniques 1993, 15, 532–534, 536–537. [Google Scholar]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A Tool to Design Target-Specific Primers for Polymerase Chain Reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef]
- Kostrzewska-Poczekaj, M.; Giefing, M.; Jarmuz, M.; Brauze, D.; Pelinska, K.; Grenman, R.; Bartochowska, A.; Szyfter, W.; Szyfter, K. Recurrent Amplification in the 22q11 Region in Laryngeal Squamous Cell Carcinoma Results in Overexpression of the CRKL but Not the MAPK1 Oncogene. Cancer Biomark 2010, 8, 11–19. [Google Scholar] [CrossRef]
- R Development Core Team. R: A Language and Environment for Statistical Computing 2008; R Development Core Team: Vienna, Austria, 2008. [Google Scholar]
- Uhlén, M.; Fagerberg, L.; Hallström, B.M.; Lindskog, C.; Oksvold, P.; Mardinoglu, A.; Sivertsson, Å.; Kampf, C.; Sjöstedt, E.; Asplund, A.; et al. Proteomics. Tissue-Based Map of the Human Proteome. Science 2015, 347, 1260419. [Google Scholar] [CrossRef]
- Zheng, J.; Que, Q.; Xu, H.; Luo, D.; Sun, Z.; Ni, J.; Que, H.; Ma, J.; Wu, D.; Shi, H. Hypoxia Activates SOX5/Wnt/β-Catenin Signaling by Suppressing MiR-338-3p in Gastric Cancer. Technol. Cancer Res. Treat. 2020, 19. [Google Scholar] [CrossRef] [PubMed]
- Day, T.W.; Najafi, F.; Wu, C.-H.; Safa, A.R. Cellular FLICE-like Inhibitory Protein (c-FLIP): A Novel Target for Taxol-Induced Apoptosis. Biochem. Pharmacol. 2006, 71, 1551–1561. [Google Scholar] [CrossRef]
- Liu, T.-H.; Zheng, F.; Cai, M.-Y.; Guo, L.; Lin, H.-X.; Chen, J.-W.; Liao, Y.-J.; Kung, H.-F.; Zeng, Y.-X.; Xie, D. The Putative Tumor Activator ARHGEF3 Promotes Nasopharyngeal Carcinoma Cell Pathogenesis by Inhibiting Cellular Apoptosis. Oncotarget 2016, 7, 25836–25848. [Google Scholar] [CrossRef]
- Chien, T.-M.; Chan, T.-C.; Huang, S.K.-H.; Yeh, B.-W.; Li, W.-M.; Huang, C.-N.; Li, C.-C.; Wu, W.-J.; Li, C.-F. Role of Microtubule-Associated Protein 1b in Urothelial Carcinoma: Overexpression Predicts Poor Prognosis. Cancers 2020, 12, 630. [Google Scholar] [CrossRef]
- Zareba, I.; Surazynski, A.; Chrusciel, M.; Miltyk, W.; Doroszko, M.; Rahman, N.; Palka, J. Functional Consequences of Intracellular Proline Levels Manipulation Affecting PRODH/POX-Dependent Pro-Apoptotic Pathways in a Novel in Vitro Cell Culture Model. Cell. Physiol. Biochem. 2017, 43, 670–684. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Li, S. Protein Mislocalization: Mechanisms, Functions and Clinical Applications in Cancer. Biochim. Biophys. Acta 2014, 1846, 13–25. [Google Scholar] [CrossRef]
- Eychène, A.; Rocques, N.; Pouponnot, C. A New MAFia in Cancer. Nat. Rev. Cancer 2008, 8, 683–693. [Google Scholar] [CrossRef]
- Xu, Y.; Xu, M.; Tong, J.; Tang, X.; Chen, J.; Chen, X.; Zhang, Z.; Cao, B.; Stewart, A.K.; Moran, M.F.; et al. Targeting the Otub1/c-Maf Axis for the Treatment of Multiple Myeloma. Blood 2020, 137, 1478–1490. [Google Scholar] [CrossRef] [PubMed]
- Watson, J.E.V.; Doggett, N.A.; Albertson, D.G.; Andaya, A.; Chinnaiyan, A.; van Dekken, H.; Ginzinger, D.; Haqq, C.; James, K.; Kamkar, S.; et al. Integration of High-Resolution Array Comparative Genomic Hybridization Analysis of Chromosome 16q with Expression Array Data Refines Common Regions of Loss at 16q23-Qter and Identifies Underlying Candidate Tumor Suppressor Genes in Prostate Cancer. Oncogene 2004, 23, 3487–3494. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Hale, T.K.; Myers, C.; Maitra, R.; Kolzau, T.; Nishizawa, M.; Braithwaite, A.W. Maf Transcriptionally Activates the Mouse P53 Promoter and Causes a P53-Dependent Cell Death. J. Biol. Chem. 2000, 275, 17991–17999. [Google Scholar] [CrossRef] [PubMed]
Parameters | Number | Percent (%) | |
---|---|---|---|
Gender | Male | 111 | 86.7% |
Female | 17 | 13.3% | |
Age | >60 | 61 | 47.7% |
<60 | 67 | 52.3% | |
Tumor grade | G1 | 10 | 7.8% |
G2 | 107 | 83.6% | |
G3 | 10 | 7.8% | |
T classification | pT1 | 1 | 0.8% |
pT2 | 0 | 0.0% | |
pT3 | 88 | 68.8% | |
pT4 | 39 | 30.5% | |
Lymph node status | pN0 | 71 | 55.5% |
pN ≠ 0 | 57 | 44.5% |
Oligo | Forward | Reverse |
---|---|---|
MAF 1 WT | 5′ cttttagcattgttatgctaaaatagagaaa- -AAAATCC- -tcatgaaccttccacaatcaagcctgcatct 3′ | 5′ ctagagatgcaggcttgattgtggaaggttcatga- -GGATTTT- -tttctctattttagcataacaatgctaaaagagct 3′ |
MAF 1 MUT | 5′ cttttagcattgttatgctaaaatagagaac- -ACCCTCC- -tcatgaaccttccacaatcaagcctgcatct 3′ | 5′ ctagagatgcaggcttgattgtggaaggttcatga- -GGAGGGT- -gttctctattttagcataacaatgctaaaagagct 3′ |
MAF 2 WT | 5′ ctgcagaactggattttctgtaacttaaaaa- -AAAATCCA- -cagttttaaaggcaataatcagtaaatgttt 3′ | 5′ ctagaaacatttactgattattgcctttaaaactg- -TGGATTTT- -tttttaagttacagaaaatccagttctgcagagct 3′ |
MAF 2 MUT | 5′ ctgcagaactggattttctgtaacttaaaac- -ACCCTCCA- -cagttttaaaggcaataatcagtaaatgttt 3′ | 5′ ctagaaacatttactgattattgcctttaaaactg- -TGGAGGGT- -gttttaagttacagaaaatccagttctgcagagct 3′ |
MAF 3 WT | 5′ ctgaagatcatttgtcttaaataggaaaaag- -AAAATCCA- -ctccttacttccatatttccaagtacatatt 3′ | 5′ ctagaatatgtacttggaaatatggaagtaaggag- -TGGATTTT- -ctttttcctatttaagacaaatgatcttcagagct 3′ |
MAF 3 MUT | 5′ ctgaagatcatttgtcttaaataggaaaaag- -CACCGCCA- -ctccttacttccatatttccaagtacatatt 3′ | 5′ ctagaatatgtacttggaaatatggaagtaaggag- -TGGCGGTG- -ctttttcctatttaagacaaatgatcttcagagct 3′ |
MAF 4 WT | 5 ′caaatagatattcgactccccttccctaaac- -AAATCCA- -cgggcagaggctccagcggagccgagcccct 3′ | 5 ′ctagaggggctcggctccgctggagcctctgcccg- -TGGATTT- -gtttagggaaggggagtcgaatatctatttgagct 3′ |
MAF 4 MUT | 5 ′caaatagatattcgactccccttccctaaac- -CACGACA- -cgggcagaggctccagcggagccgagcccct 3′ | 5 ′ctagaggggctcggctccgctggagcctctgcccg- -TGTCGTG- -gtttagggaaggggagtcgaatatctatttgagct 3′ |
Technics | Primer | Sequence |
---|---|---|
Bisulfite pyrosequencing | Forward (biotinylated) | 5′ Biotin-GTTGTTAATTAGGGTTTAATTAGTTGAT 3′ |
Reverse | 5′ AAAAAAACTCCTTCCCCTCTTACA 3′ | |
Sequencing | 5′ CCCTCTTACACCAAACTTTAC 3′ | |
Sanger sequencing | pmirGLO_F | 5′ AACACCCCAACATCTTCGAC 3′ |
pmirGLO_R | 5′ CTTTCGGGCTTTGTTAGCAG 3′ | |
Real-Time qPCR | MAF NM_005360 Forward | 5′ AATACGAGAAGTTGGTGA 3′ |
MAF NM_005360 Reverse | 5′ TTTGTGAACACACTGGTA 3′ | |
MAF NM_001031804 Forward | 5′ AATACGAGAAGTTGGTGAG 3′ | |
MAF NM_001031804 Reverse | 5′ ACTTATCAGGGTGGCTAG 3′ | |
PRODH Forward | 5′ ACGAATAAGCGGGACAAGCA 3′ | |
PRODH Reverse | 5′ CCGTCATCGCTGACTCTACC 3′ | |
β-ACTIN Forward | 5′ CACCACACCTTCTACAATG 3′ | |
β-ACTIN Reverse | 5′ TAGCACAGCCTGGATAG 3′ | |
GAPDH Forward | 5′ GTCGGAGTCAACGGATT 3′ | |
GAPDH Reverse | 5′ CCTGGAAGATGGTGATGG 3′ | |
has-miR-1290 miRCURY LNA miRNA PCR Assay | GeneGlobe ID—P02118634; Catalog No.—339306 | |
U6 snRNA miRCURY LNA miRNA PCR Assay | GeneGlobe ID—YP00203907; Catalog No.—339306 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Janiszewska, J.; Bodnar, M.; Paczkowska, J.; Ustaszewski, A.; Smialek, M.J.; Szylberg, L.; Marszalek, A.; Kiwerska, K.; Grenman, R.; Szyfter, K.; et al. Loss of the MAF Transcription Factor in Laryngeal Squamous Cell Carcinoma. Biomolecules 2021, 11, 1035. https://doi.org/10.3390/biom11071035
Janiszewska J, Bodnar M, Paczkowska J, Ustaszewski A, Smialek MJ, Szylberg L, Marszalek A, Kiwerska K, Grenman R, Szyfter K, et al. Loss of the MAF Transcription Factor in Laryngeal Squamous Cell Carcinoma. Biomolecules. 2021; 11(7):1035. https://doi.org/10.3390/biom11071035
Chicago/Turabian StyleJaniszewska, Joanna, Magdalena Bodnar, Julia Paczkowska, Adam Ustaszewski, Maciej J. Smialek, Lukasz Szylberg, Andrzej Marszalek, Katarzyna Kiwerska, Reidar Grenman, Krzysztof Szyfter, and et al. 2021. "Loss of the MAF Transcription Factor in Laryngeal Squamous Cell Carcinoma" Biomolecules 11, no. 7: 1035. https://doi.org/10.3390/biom11071035
APA StyleJaniszewska, J., Bodnar, M., Paczkowska, J., Ustaszewski, A., Smialek, M. J., Szylberg, L., Marszalek, A., Kiwerska, K., Grenman, R., Szyfter, K., Wierzbicka, M., Giefing, M., & Jarmuz-Szymczak, M. (2021). Loss of the MAF Transcription Factor in Laryngeal Squamous Cell Carcinoma. Biomolecules, 11(7), 1035. https://doi.org/10.3390/biom11071035