1. Introduction
Malaria remains a devastating disease and significant efforts have focused on developing novel therapeutics, vaccines, and mosquito-targeted strategies to eliminate human infection and disrupt parasite transmission. During development, malaria parasites must acquire essential host resources that they are unable to synthesize for themselves. Blocking parasite access to these resources, via altered host synthesis or by preventing parasite uptake, can be lethal and is the basis for novel anti-
Plasmodium strategies being explored for human treatment. Among the host nutrients required by malaria parasites is pantothenate or vitamin B5.
Plasmodium spp. cannot synthesize pantothenate de novo and, therefore, must acquire pantothenate from the vertebrate and mosquito hosts for survival [
1,
2]. Malaria parasites, like both of their hosts, convert pantothenate to coenzyme A (CoA), a critical co-factor for metabolism, via the initial enzyme in the CoA biosynthesis pathway, pantothenate kinase (PanK).
Once pantothenate enters the CoA biosynthesis pathway PanK initiates its rapid, multi-step conversion to CoA, with only the metabolite 4′-phosphopantetheine found at detectable levels [
3]. Mammalian genomes encode four PanK isoforms, including PanK1
α, PanK1
β, PanK2, and PanK3. Four additional pathway enzymes, including 4′-phospho-pantothenoylcysteine synthetase (PPCS), 4′-phosphopanto-thenoylcysteine decarboxylase (PPCDC), 4′- phosphopantetheine adenylyltransferase (PPAT), and dephospho-CoA kinase (DPCK) process intermediates of the pathway [
2]. The genome of the aggressive biter and invasive malaria vector
Anopheles stephensi [
4] encodes individual orthologs for PanK and other pathway gene products, with PPAT and DPCK encoded by a single
A. stephensi gene as in many other eukaryotes [
5].
Studies with both human and mouse malaria parasites highlight the importance of pantothenate-CoA metabolism across both asexual and sexual life stages [
2,
6,
7,
8,
9]. For example, Tjhin et al. [
8] showed that
Plasmodium falciparum PanK1 is essential for asexual parasite growth. Notably, pantothenate analogs, termed pantothenamides, capable of disrupting pantothenate metabolism and CoA utilization in
P. falciparum were also gametocytocidal [
9], extending the requirement of pantothenate-CoA to sexual stage parasite development. In recent work, Tjhin et al. demonstrated that
P. falciparum PanK1 and PanK2 form a protein complex with a single complete active site perhaps regulated by a bound dimer of
P. falciparum 14-3-3I [
7]. In contrast to
P. falciparum,
P. yoelii PanK1 or PanK2 knockouts successfully completed asexual development and gametocyte formation in infected mice [
6], affirming that some
Plasmodium spp. can utilize alternative host precursors for CoA synthesis. However, parasites with a double knockout of
P. yoelii PanK1/2 were severely deficient in ookinete and oocyst development and unable to produce sporozoites in
A. stephensi, indicating that, like
P. falciparum PanK1,
P. yoelii PanK1/2 are required for the completion of sexual stage development [
6]. In a subsequent study, Hart et al. [
2] confirmed that mosquito-stage parasites cannot acquire preformed CoA from the mosquito host, and thus are entirely dependent on the uptake of the pantothenate precursor from the mosquito.
To demonstrate the critical requirement of pantothenate by malaria parasites, pantothenamides have been developed with the goal of disrupting parasite CoA/acetyl-CoA biology via the formation of non-functional metabolites [
1,
8,
9,
10,
11]. A novel pantothenamide suppressed
P. falciparum parasitemia in a humanized mouse model [
9]. In these comprehensive studies, the authors selected pantothenamide-resistant
P. falciparum as a strategy to reveal the anti-parasite mode of action and to predict drug modifications that might prevent the development of pantothenamide resistance [
9]. Resistant parasites grew slowly and were deficient in CoA and acetyl-CoA, but generated oocyst infections in
A. stephensi comparable to normal parasites [
9], raising concerns about the spread of resistance and loss of a new drug strategy if this were to occur.
These concerns supported our focus on the mosquito host as a potential secondary target for manipulation of parasite access to host pantothenate to block transmission of both susceptible parasites and those that might develop pantothenamide resistance. In earlier work, we demonstrated that
P. falciparum infection of
A. stephensi increased activation of c-Jun N-terminal kinase (JNK) signaling in the mosquito midgut and, conversely, that inhibition of JNK signaling activation was associated with increased CoA biosynthesis and expression of
A. stephensi PanK in the mosquito midgut [
12]. We proposed that parasite-induced JNK signaling would benefit the parasite by decreasing competition with the mosquito host for pantothenate, with studies showing that JNK signaling inhibition was also associated with upregulated CoA synthesis in the
A. stephensi midgut and increased resistance to
P. falciparum infection [
12]. These studies suggested for the first time that shifts in pantothenate-CoA metabolism in mosquito midgut might adversely affect sexual stage parasite development by starving the parasite of pantothenate [
12].
Here, we present data to test this novel hypothesis, affirming that A. stephensi PanK activity controls CoA levels in the midgut epithelium and that mosquito PanK-catalyzed CoA biosynthesis in the midgut can be controlled via orally available small molecules predicted to regulate A. stephensi PanK by the same allosteric mechanism observed for human PanK. Importantly, provisioning of these PanK-modulating small molecules that increased or decreased midgut CoA levels predictably decreased and increased, respectively, the infection of A. stephensi with both P. falciparum and the mouse parasite Plasmodium yoelii yoelli 17XNL. These findings demonstrate that small molecules can be delivered orally to A. stephensi in support of a longer-term goal of reducing mosquito-stage infection and development of markedly different parasite species that share a genus-level dependency on mosquito pantothenate for survival.
2. Materials and Methods
2.1. Chemicals and Reagents
Protease inhibitor solution (Complete™ Mini Protease Inhibitor Cocktail tablets; Sigma, St. Louis, MO, USA) was prepared by dissolving 1 tablet in 5 mL of 1X phosphate-buffered saline (PBS). Small molecule PanK modulators PZ-2891 (MedKoo Biosciences, Morrisville, NC, USA) and compound 7 (Calbiochem, San Diego, CA, USA) were purchased for these studies.
Plasmodium falciparum NF54 was maintained in RPMI-1640 medium (Sigma, St. Louis, MO, USA) supplemented with HEPES, L-glutamine, hypoxanthine (Thermo Scientific, Waltham, MA, USA) and DL-Lactic acid (Thermo Scientific, Waltham, MA, USA) with 10% (
v/
v) human serum and 4.0–6.0% washed type O+ red blood cells (RBCs, Interstate Blood Bank, Memphis, TN, USA). Propidium iodide (Sigma-Aldrich, St. Louis, MO, USA) was diluted to a final concentration of 10 µg/mL in PBS [
13]. An
A. stephensi PanK custom polyclonal antibody was generated against a 16 amino acid peptide (KALFLEHEGYFGAVGC) at the C-terminus of
A. stephensi PanK conjugated to KLH and inoculated into rabbits following the Proteintech 102-day immunization protocol (Proteintech, Rosemont, IL, USA). The neat serum was column affinity-purified against the
A. stephensi PanK peptide.
2.2. A. stephensi Rearing and Maintenance
A. stephensi (Indian strain) was maintained at 27 °C and 80% humidity with light/dark cycling. Adult mosquitoes were provided with a 10% sucrose solution ad libitum. For colony maintenance, adult female
A. stephensi were provisioned with bovine blood (University of Arizona Food Products & Safety Laboratory, Tucson, AZ, USA) via glass membrane feeders or were allowed to feed on CD-1 mice (Envigo, St. Louis, MO, USA) sedated with ketamine (50 mg/kg) and xylazine (5 mg/kg). Mouse protocols were performed at the University of Idaho and approved by the Animal Care and Use Committee and were in accordance with the federal regulatory guidelines and standards (University of Idaho IACUC-2020-10 protocol, approved 30 March 2020). For non-infectious experimental blood feeding, mosquitoes were provided with whole human blood (American Red Cross, Tucson, AZ, USA; IBC protocol 2010-014) via membrane feeders [
12]. All adult female mosquitoes used in these studies were 3–7 d old.
2.3. Mosquito Dissections, RNA Isolation, cDNA Synthesis, and qPCR
Midguts of female A. stephensi were dissected prior to provisioning with human blood (non-blood-fed or NBF) and at 2, 6, 12, 24, 36, 48, 72 h post-blood feeding for PanK transcript analysis. Midgut dissections were performed in 1X PBS and stored in 25 μL RNAlater (Invitrogen, Waltham, MA, USA) at −80 °C. Total RNA was isolated from dissected midguts using the RNeasy mini kit (Qiagen, Germantown, MD, USA) and quantified using a Nanodrop 2000 Spectrophotometer (Thermo Scientific, Grand Island, NY, USA). Total RNA samples were treated with TURBO DNase I (Invitrogen, Waltham, MA, USA) as per the manufacturer’s protocol to eliminate genomic DNA contamination. The high-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA) was used to synthesize cDNA using random hexamer primers according to the manufacturer’s protocol. Quantitative PCR was performed using the Maxima SYBR Green/ROX qPCR master mix (Thermo Scientific, Waltham, MA, USA) and A. stephensi PanK forward (5′ GGACAACTACAAGCGCATCTC 3′) and reverse (5′ TCACCCTTCGTAGCTAACTG 3′) primers.
2.4. A. stephensi PanK RNA Interference (RNAi)
PanK RNAi forward and reverse primers were designed using NetPrimer (PREMIER Biosoft, San Francisco, CA) to knock down
A. stephensi PanK transcript: PanK RNAi-F 5′
TAATACGACTCACTATAGGGAGAACGCTGACGAAGCTGGTGTA 3′ and PanK RNAi-R 5′
TAATACGACTCACTATAGGGAGACGGTGAGCAGACAGCACAG 3′ (T7 RNA polymerase promoter sequence is underlined). The expected amplicon (607 bp) was PCR amplified using Taq 2X Master Mix (New England Biolabs, Ipswich, MA, USA) with
A. stephensi midgut cDNA as the template. Double stranded RNA (dsRNA) was synthesized using HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA, USA). Cold-anesthetized female mosquitoes were intrathoracically microinjected twice with 276 nL dsRNA (8 μg/μL) using a Nanoject II microinjector (Drummond Scientific, Broomall, PA). The first injection was performed within 4 h of adult eclosion and the second injection was completed at 3 d post-eclosion. Injected mosquitoes were maintained on 10% sucrose throughout the experiments. Firefly luciferase dsRNA (dsRNA-FLuc) was synthesized and injected following the above protocol as a negative control [
14,
15]. Injected mosquitoes were provided a blood meal at 5 d after adult eclosion; dissected midguts were collected for analysis immediately prior to blood feeding (NBF) and at 2, 6, and 24 h post-blood feeding.
2.5. Coenzyme A Quantification
Coenzyme A (CoA) levels in midguts of female A. stephensi were measured using the CoA Assay Kit (Sigma-Aldrich, St. Louis, MO, USA). For this assay, midguts from 10 mosquitoes were dissected on ice in PBS and 1X protease inhibitor (Complete™ Mini Protease Inhibitor Cocktail; Sigma-Aldrich, St. Louis, MO, USA) from NBF mosquitoes and from mosquitoes at 2, 6, and 24 h post-blood feeding with the blood bolus removed. Midguts were transferred to 50 µL of ice-cold 5X protease inhibitor-PBS solution after which CoA assay buffer (50 μL) was added to the samples and the midguts were homogenized in 1.5 mL centrifuge tubes. CoA concentrations in two midgut equivalents (20 μL) from each homogenized sample were determined using an EPOCH/2 microplate reader (BioTek Instruments, Winooski, VT, USA) at 570 nm absorbance and a CoA standard curve as per the manufacturer’s instructions.
2.6. PanK Homology Modeling
Protein sequences for
A. stephensi PanK and human PANK1, PANK2, and PANK3 were obtained from the Uniprot data base (
https://www.uniprot.org/, accessed on 6 April 2021) and compared using Align Sequences Protein BLAST within the blastp suite [
16]. Sequences were aligned using Clustal Omega (
https://www.ebi.ac.uk/Tools/msa/clustalo/, accessed on 6 April 2021) and sequence conservation was visualized using ESPript (
http://endscript.ibcp.fr/ESPript/ESPript/index.php, accessed on 6 April 2021). The
A. stephensi PanK•ATP•Mg
2+•PZ-2891 threaded structure was constructed using SWISS-MODEL (
https://swissmodel.expasy.org/, accessed on 6 April 2021), Uniprot accession A0A182YPP9 and the template PANK3•ATP•Mg
2+•PZ-2891 (PDB: 6B3V) [
17]. The global model quality estimation was 0.8 and the QMEAN was −0.85 indicating high reliability, high expected accuracy, and good agreement between the model and the expected experimental structure. Coordinates were visualized using PyMOL.
2.7. Western Blotting
Midguts were dissected on ice from female
A. stephensi prior to blood feeding (NBF) and 2, 6, 12, 24, 36, 48, and 72 h post-blood meal in PBS with 1X protease inhibitor and the blood bolus removed. Ten midguts were pooled and transferred to 25 µL of protease inhibitor (5X) solution with an equal volume of cell lysis buffer (1X PBS, 1% Triton X-100, 12 mM sodium deoxycholate, 2% SDS) and 25 µL of Laemmli sample buffer (50 mM Tris-HCl pH 6.8, 10% glycerol, 2% SDS, 0.2 mg/mL bromophenol blue, 0.1 M dithiothreitol). Lysed tissues were homogenized, denatured at 95 °C for 10 min, and centrifuged at 14,000×
g for 5 min at room temperature. The supernatants were transferred to sterile microcentrifuge tubes and stored at −80 °C. For each protein sample, a single midgut equivalent was loaded onto precast 12% SDS-PAGE gels (NuSep, Germantown, MD, USA) with PageRuler™ Prestained Protein Ladder (Thermo Scientific, Waltham, MA, USA) as a molecular marker. Size-fractionated proteins were transferred to nitrocellulose membranes (LI-COR, Lincoln, NE, USA) for 1 h at 100 V. Membranes were blocked in non-fat milk (4%
w/
v) in 1X PBS (pH 7.4) for 1 h at room temperature, then incubated with 1:1000
A. stephensi PanK polyclonal antibody and 1:1000 alpha-tubulin monoclonal antibody (Developmental Studies Hybridoma Bank, Iowa City, IA, USA) in PBST (1X PBS with 0.1% Tween 20, Sigma, St. Louis, MO, USA) with non-fat milk (4%
w/
v) overnight at 4 °C. Following primary antibody incubation, membranes were washed ten times, 5 min each with 1X PBST, then incubated with secondary antibodies goat anti-rabbit 800 CW (1:10,000, LI-COR, Lincoln, NE, USA) and goat anti-mouse 680 RD (1:10,000, LI-COR, Lincoln, NE, USA) in PBST for 1 h at room temperature. The membranes were washed an additional ten times, 5 min each with PBST. A LI-COR imaging system with Image Studio software was used to acquire membrane signals. Densitometry quantification of protein bands was performed using ImageJ (NIH) as previously described [
18].
2.8. P. falciparum NF54 In Vitro Growth Assay
Frozen stocks of
P. falciparum NF54 infected RBCs were thawed at 37 °C, washed three times with NaCl (12%, 1.6% and 0.9% respectively) to remove glycerol and transferred to culture flasks [
19]. Parasites were maintained at 37 °C in RPMI-1640 medium supplemented with HEPES, L-glutamine, hypoxanthine and DL-Lactic acid (supplemented RPMI) with 4.0-6.0% washed type O+ RBCs. Flask media were changed daily, followed by injection of mixed gas (5% CO
2, 5% O
2, 90% N
2). Parasitemia was assessed via microscopic examination of thin films stained with Giemsa [
20]. For growth assays, cultures were synchronized by the addition of sorbitol (5%, 1:25
v/
v) and incubation at 37 °C for 5 min. The treated culture was centrifuged at 800×
g for 10 min to pellet infected RBCs with young trophozoites, then resuspended in supplemented RPMI and returned to culture [
21]. For growth assays, 200 μL of synchronized
P. falciparum culture was transferred to each well of a 96-well plate at an initial parasitemia of 0.5–1.0% and hematocrit of 1.0% [
22]. Growth was assessed at 48 h and 96 h or one and two parasite life cycles, respectively. Parasites were treated with chloroquine diphosphate (19.5, 39, 78 and 156 nM; Sigma) as a positive control for suppression of parasite growth. PZ-2891 effects on
P. falciparum growth
in vitro were tested at 1.3 nM (reported EC
50 for human PanK3 [
17]) and at 13 nM, 130 nM, and 1.3 µM, while compound 7 effects were tested at 62 nM (mean EC
50 for human PanK3, PanK1β and PanK2 [
23]) and at 620 nM, 6.2 µM and 62 µM. Control parasites were treated with a volume of DMSO equivalent to that added for PZ-2891 or compound 7. At 48 h or 96 h after treatment, samples were collected from the 96-well plate, fixed with 10% formalin (Sigma), stained with 10 µg/mL PI in PBS [
13], and analyzed using flow cytometry (Beckman Coulter Life Sciences, Indianapolis, IN, USA) and CytExpert software for the CytoFLEX Platform.
2.9. P. falciparum NF54 Gametocyte Culture
P. falciparum NF54 culture was initiated at 6% hematocrit and 0.5% parasitemia, with most parasites at the immature trophozoite stage and maintained in supplemented RPMI [
10] and gas mixture described above. At 5 d after culture initiation or when parasites are present as unhealthy young trophozoites, the hematocrit was reduced to 3–4% with the addition of medium. Stage IV and V gametocytes were typically observed 8–12 d following hematocrit reduction. The 14, 15, and 17 d old cultures were combined for mosquito feeding, where days are counted beginning with the culture dilution to 0.5% parasitemia at 6% hematocrit, after which only the medium was changed daily [
24].
2.10. P. falciparum NF54 and P. yoelii yoelii 17XNL Infection of A. stephensi
P. falciparum gametocyte cultures were prepared as above for infection of adult female
A. stephensi, but without synchronization. Exflagellation was confirmed on the day of mosquito feeding before addition of fresh media. About 10% sucrose-soaked cotton balls were removed from the mosquitoes 30 min to 1 h before feeding on a meal of 1:1 (
v/
v) human RBCs (35–45% infected RBCs, 55–65% uninfected RBCs) and heat-inactivated human serum, with the meal supplemented immediately before feeding with 1.3 nM or 13 nM PZ-2891, 62 nM or 620 nM compound 7 or an equivalent volume of DMSO used to deliver the treatments as a control. The
P. falciparum infectious blood meal was provisioned via a Hemotek Insect Feeding System (Discovery Workshops, Accrington, UK) and glass bell feeders (Chemglass Life Sciences, Vineland, NJ, USA). Mosquitoes were allowed access to the blood meal for 15 min, after which partially fed and non-fed mosquitoes were removed from each group. Fed mosquitoes were returned to 10% sucrose-soaked cotton balls for nutrition and maintained accordingly until dissection to assess infection [
19].
To test the effects of PZ-2891 and compound 7 on infection of A. stephensi by P. y. yoelii 17XNL, adult female mosquitoes were provisioned for 3 d prior to infection with 1.3 nM or 13 nM PZ-2891, 62 nM or 620 nM compound 7 or an equivalent volume of DMSO in water via soaked cotton balls changed twice daily. Female 8–10 week-old CD-1 mice (Envigo) were used for P. y. yoelii 17XNL infection of A. stephensi. The development and patterns of parasite infection in male and female CD-1 mice are identical, but female mice were used because they are larger and easier to manipulate. Mice were infected via intraperitoneal injection of 1 × 107 P. y. yoelii 17XNL-infected RBCs, then monitored daily for parasitemia starting at 2 d post-infection (PI) via microscopic analysis of Giemsa-stained thin blood smears. Wet preps of blood drops were evaluated for exflagellation events per higher power field (HPF) of male gametocytes before mosquito feeding. Mice with similar exflagellation events per HPF were anesthetized and placed on mosquito cartons for 20 min to allow mosquitoes to feed. After mosquito feeding was complete, partially fed and non-fed mosquitoes were removed from each group and mice were euthanized by CO2 inhalation followed by cervical dislocation. Fed mosquitoes were maintained until dissection at 24 °C and 80% humidity with twice daily changes of PZ-2891, compound 7, or DMSO in water as soaked cotton balls. Mouse infection and euthanasia were conducted as approved by the Institutional Animal Care and Use Committee of the University of Idaho (IACUC-2020-10 protocol, approved 30 March 2020).
For both P. falciparum NF54 and P. y. yoelii 17XNL infection studies, midguts were dissected at 10 d PI and stained for 2 min in 1% mercurochrome for oocyst counting by microscopy. Infection studies with P. falciparum were completed with two separate biological cohorts of A. stephensi and two independent gametocyte cultures, while studies with P. y. yoelii 17XNL were completed with three separate biological cohorts of A. stephensi and three separate sets of infected mice. Sporozoite infections were analyzed in two of the three cohorts of P. y. yoelii 17XNL-infected A. stephensi. For these analyses, salivary glands were dissected at 12–15 d PI, with sporozoite infections scored on a scale of 1–4 per pair of glands, with 1 for 100–1000 sporozoites, 2 for 1000–10,000 sporozoites, 3 for 10,000–100,000 sporozoites, and 4 for 100,000+ sporozoites.
2.11. Statistical Analyses
A. stephensi PanK transcript and PanK protein levels, CoA concentrations, and P. falciparum NF54 in vitro growth data were analyzed using ANOVA and Tukey’s post hoc test or Student’s t-test. Infection intensity data (oocysts per midgut, salivary gland sporozoite scores) were analyzed using one-way Kruskal–Wallace ANOVA with Tukey’s post hoc test. Prevalences of A. stephensi infection were analyzed using Chi-square and Fisher’s exact tests. All differences were considered significant at α = 0.05.
4. Discussion
The absolute requirement for exogenous pantothenate by
Plasmodium spp. makes it an attractive target for parasite control in both the vertebrate host and mosquito vector [
2]. Depletion of pantothenate in the mosquito through manipulation of CoA biosynthesis is expected to negatively impact
Plasmodium survival by starving the parasite of this essential nutrient. PanK is a logical target to assess whether pantothenate depletion in the mosquito can impact parasite development as it is the first enzyme in the CoA biosynthesis pathway. PanK is highly conserved across a range of organisms, and while there is limited research on PanK biology in invertebrates, putative
PanK orthologs have been identified from numerous arthropod genomes.
Drosophila melanogaster encodes a single
PanK gene
fumble (
fbl), which is the source of seven transcript variants (
fbl-RA to
fbl-RG) [
32,
33]. Flies with
fbl mutations have a shortened adult lifespan, sterility, neurodegeneration and typically perish before adult eclosion [
32,
34]. We identified at least two putative
A. stephensi PanK isoforms with predicted molecular weights of 67.6 and 42.2 kDa, which correspond to the major protein bands that cross-reacted with our
A. stephensi PanK antibody (
Figure 1). Despite variable PanK N-termini, the C-terminal kinase domains of
D. melanogaster PanK and the predicted
A. stephensi PanK proteins are highly conserved, suggesting that core kinase activity is conserved across these variants.
Our RNAi data confirmed that the 67.6 kDa and 42.2 kDa proteins are
A. stephensi PanK isoforms based on the robust reduction of both protein bands following the inoculation of
PanK dsRNA but not
Fluc dsRNA. Furthermore, the lower molecular weight protein (~30 kDa) we routinely observed appears to be a non-specific target of the PanK antibody, since treatment with
PanK dsRNA had no effect on levels of this protein relative to the FLuc control (
Figure 2C). In the
A. stephensi midgut, levels of both PanK proteins were present at fairly constant levels prior to and throughout most of reproductive cycle (
Figure 1). However, for the 67.6 kDa protein, and to a lesser extent the 42.2 kDa protein, we observed an increase in protein expression at the end of the reproductive cycle following vitellogenesis and after oviposition. This may reflect an effort by the mosquito to replenish stores of free fatty acids following the provisioning of triglycerides into the developing oocytes [
35]. Increased PanK levels would facilitate the conversion of pantothenate to CoA and subsequently to acetyl-CoA for the synthesis of fatty acids [
36,
37]. A significant increase in
A. stephensi PanK transcript observed at 24 h post-blood meal in the midgut likely drives the increase in the 42.2 kDa protein at 24 h post-blood meal and an overall increase in PanK protein levels starting by 48 h post-blood meal.
We also utilized RNAi to verify the core biological function of A. stephensi PanK, which is to initiate the catalytic conversion of pantothenate to CoA. The significant reduction in midgut CoA levels following RNAi treatment prior to blood feeding and at 24 h post-blood feeding confirmed this to be the case. Interestingly, we did not observe a significant decrease in midgut CoA shortly after blood feeding. This could be due to a combination of modest PanK protein levels at this time point, biological variation among mosquito cohorts, unknown regulators of the CoA biosynthesis pathway in mosquitoes, and the complex events occurring during the initial stages of blood meal digestion. While A. stephensi PanK RNAi was effective and the outcome consistent with the reported biological function of PanK in other organisms, it would be difficult to translate genetic manipulation to a feasible anti-Plasmodium control strategy. Thus, we tested the utility of orally available small molecules to manipulate A. stephensi PanK signaling and associated biology.
We tested two well-characterized small molecules for modulation of
A. stephensi PanK activity. At modest concentrations, PZ-2891 interacts with one of the binding pockets of the human PanK3 dimer, which in turn locks the dimer into an active state and confers resistance to inhibition by acetyl-CoA, allowing it to function as a PanK activator [
17]. At higher concentrations, PZ-2891 may interact with both pockets of the PanK dimer, interfering with its activity. Although we did not directly verify the binding of PZ-2891 to recombinant
A. stephensi PanK due to the substantial technical challenges involved with such work, the high degree of sequence conservation between human PanK3 and
A. stephensi PanK and the threaded model of
A. stephensi PanK suggests that PZ-2891 would have similar biological effects in
A. stephensi (
Figure 3,
Supplementary Figure S1). The kinetic characteristics and the potential for acetyl-CoA inhibition of
A. stephensi PanK should, however, be confirmed to support this. Treatment with PZ-2891 at both 1.3 nM and 13 nM was associated with significantly increased midgut CoA levels (
Figure 4A), suggesting that this compound can act as a PanK activator over at least a ten-fold concentration range. Compound 7 has been shown to suppress human PanK3 activity and provisioning of 62 and 620 nM compound 7 to
A. stephensi reduced midgut CoA levels at 2 h and 24 h post-blood meal, respectively (
Figure 4B).
Based on the predicted biological effects of these two small molecules on midgut CoA levels in the mosquito, we examined the effects of these compounds on
Plasmodium spp. infection in
A. stephensi. Since pantothenate is essential for parasite development and cannot be synthesized de novo by
Plasmodium spp., we anticipated that these compounds would alter infection with diverse parasite species [
3]. A growth assay of cultured asexual
P. falciparum allowed us to verify that neither PZ-2891 nor compound 7 were directly toxic to these parasite stages, with the exception of 62 μM compound 7, which was 100 times the maximum concentration used in our infection assays. While these data do not rule out all possible effects of the small molecules on the parasite itself, they do suggest that these molecules do not interact effectively with the
P. falciparum PanK. This would be expected since
P. falciparum PanK proteins share less than 30% sequence identity with
A. stephensi PanK. As discussed above, the
P. yoelii genome encodes two PanK orthologs, neither of which share strong sequence identify to
A. stephensi PanK [
6]. Furthermore, the recent discovery that
P. falciparum PanK1 and PanK2 are complexed with a dimer of sporozoite-specific 14-3-3I suggests that while asexual stage parasite PanK has a much higher affinity for pantothenate than mammalian PanK [
38], activity of parasite PanK in the mosquito host may be substantially altered by its interaction with 14-3-3I [
39]. Notably, a large array of animal and plant 14-3-3 proteins alters the cellular localization of their bound proteins, the interaction of bound proteins with other proteins, as well as the biological activity of bound proteins [
40]. Accordingly, the upregulation of sporozoite-specific 14-3-3I in both oocyst-stage and salivary gland sporozoites of both
P. falciparum and
P. y. yoelii 17XNL could alters the biochemical activity of parasite PanK during these stages [
41], perhaps making the mosquito host a more amenable target for blocking parasite utilization of host pantothenate.
The long-term goal of this work is to develop a bait-station approach to deliver small molecules to mosquitoes to divert pantothenate stores into CoA, effectively depriving developing malaria parasites of this essential molecule. As described above, provisioning with PZ-2891 at both 1.3 and 13 nM significantly reduced infection with both
Plasmodium spp., demonstrating that manipulation of the
A. stephensi CoA biosynthesis pathway can effectively limit parasite development. Importantly, we believe this approach has the potential to be effective across a range of mosquito and
Plasmodium parasite combinations for several reasons. First, this approach is based on limiting pantothenate availability to the parasite, rather than directly targeting gene products in the parasite that may vary across species. This is supported by our results demonstrating the ability of PZ-2891 to suppress mosquito infection with two biologically distinct
Plasmodium species. Furthermore, by not directly targeting the parasite for killing, we reduce the likelihood of the parasite developing resistance against this approach [
42]. Second, the highly conserved nature of the CoA biosynthesis pathway across anopheline species suggests that optimized small molecule PanK regulators should behave similarly across a range of mosquito vectors (e.g., 99% amino acid identity between the catalytic domains of
A. stephensi and
A. gambiae PanK). Third, driving pantothenate through the CoA pathway in the mosquito, while deleterious to the
Plasmodium parasite, is unlikely to impact the fitness of adult mosquitoes since the overall availability of CoA to the mosquito host would not be affected. Nevertheless, future studies on the impact of provisioning optimized mosquito-targeted small molecules on mosquito fitness are needed prior to transitioning this approach to field studies.
In this work we demonstrated that PanK biology and its regulation of CoA biosynthesis is conserved in an important and highly invasive malaria vector mosquito. As in other organisms, multiple isoforms of PanK were predicted and at least two were confirmed to be expressed in the
A. stephensi midgut. Most importantly, we demonstrated that manipulation of
A. stephensi PanK activity can significantly impact the development of multiple
Plasmodium species in the insect host. As demonstrated by Schalkwijk et al. [
9], pantothenamides can be used to effectively kill parasites in the vertebrate host by interfering with
Plasmodium utilization of CoA. However, the risk of parasites developing resistance to these small molecules is a concern, as demonstrated by the ability to select for pantothenamide-resistant parasites [
9]. Our results suggest that small molecules capable of modifying CoA biosynthesis activity in the mosquito could be used in a multifaceted control strategy to limit
Plasmodium development in the mosquito vector, while simultaneously preserving the efficacy of pantothenamides as a novel therapeutic strategy in humans.