Next Article in Journal
Hyperhomocysteinemia: Metabolic Role and Animal Studies with a Focus on Cognitive Performance and Decline—A Review
Previous Article in Journal
Coffee Bioactive N-Methylpyridinium Attenuates Tumor Necrosis Factor (TNF)-α-Mediated Insulin Resistance and Inflammation in Human Adipocytes
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Higher RET Gene Expression Levels Do Not Represent anAlternative RET Activation Mechanism in Medullary Thyroid Carcinoma

1
Endocrine Unit, Department of Clinical and Experimental Medicine, University of Pisa, 56124 Pisa, Italy
2
Department of Surgical, Medical, Molecular Pathology, University of Pisa, 56124 Pisa, Italy
*
Author to whom correspondence should be addressed.
Biomolecules 2021, 11(10), 1542; https://doi.org/10.3390/biom11101542
Submission received: 2 September 2021 / Revised: 7 October 2021 / Accepted: 14 October 2021 / Published: 19 October 2021

Abstract

This study was designed to investigate whether RET (rearranged during transfection) mRNA over-expression could be considered an alternative driver event for the development of medullary thyroid carcinoma (MTC), and if different RET isoforms could play a role in MTC tumorigenesis. Eighty-three MTC patients, whose mutational profile was previously identified by next-generation sequencing (NGS) IONS5, were included in this study. Expression analysis was performed by the quantitative reverse transcription-polymerase chain reaction technique. RET expression levels were found to be significantly higher in cases with RET somatic mutations than in cases that were negative for RET somatic mutations (p = 0.003) as well as in cases with a somatic mutation, either in RET or RAS than in cases negative for both these mutations (p = 0.01). All cases were positive for the RET51 isoform expression while only 72/83 (86.7%) were positive for RET9 isoform expression. A statistically significant higher expression of the RET51 isoform was found in cases positive for RET somatic mutation than in cases either positive for RAS mutation (p = 0.0006) or negative for both mutations (p = 0.001). According to our data, RET gene over-expression does not play a role in MTC tumorigenesis, neither as an entire gene or as an isoform. At variance, the RET gene, and in particular the RET51 isoform, is expressed higher in RET mutated cases. On the basis of these results we can hypothesize that the overexpression of RET, and in particular of RET51, could potentiate the transforming activity of mutated RET, making these cases more aggressive.

1. Introduction

The rearranged during transfection (RET) proto-oncogene is localized on chromosome 10q11.2 and was first identified in 1985 based on its ability to transform NIH3T3 cells [1]. The RET proto-oncogene encodes for a transmembrane tyrosine kinase receptor involved in the control of cell differentiation and proliferation [2]. As well as other growth factor receptors, the RET gene may be involved in the development of human cancers through different activating mechanisms [3]. Activating gain of function mutations are specifically related to medullary thyroid carcinoma (MTC) [4], while RET gene rearrangements have been reported in papillary thyroid carcinoma (PTC) [4], in lung cancer [5], and chronic myelomonocytic leukemia [6]. Finally, overexpression of the RET gene has been demonstrated in the most aggressive estrogen receptor-positive breast cancer [7] and in the more advanced forms of pancreatic [8] and prostate cancer [9].
The RET proto-oncogene is subjected to alternative splicing that gives origin to three functional isoforms: RET51, RET9, and RET43 [10,11]. Studies on animal models showed that RET9 is expressed in several human tissues while RET51 is only expressed in some of them [12]. Moreover, when compared, RET9 expression has been found to be higher than RET51 expression [13]. Conversely, RET51 isoform expression has been reported to be higher in MTC than in PTC [14], in more aggressive forms of pancreatic cancer [15], and in pheochromocytoma [16], suggesting a specific role of this isoform in determining the aggressiveness of a tumor. As a matter of fact, the two isoforms are characterized by different biochemical and biological properties, and, consequently, they play distinct roles in tumorigenesis and/or development [17].
MTC arises from thyroid parafollicular C cells. Its overall incidence is about 0.2–0.8/100,000 people [18] and accounts for about 5% of all thyroid carcinomas. MTC can be inherited (25%) as part of the multiple endocrine neoplasia type 2, or sporadic (75%). The pathogenesis of this tumor is related to activating RET mutations that are germline in hereditary cases (approximately 98% of cases) and somatic in sporadic cases (approximately 45% of cases) [19,20]. The genetic landscape of sporadic MTC has been deeply studied, and somatic mutations in the RET gene are the major events in its tumorigenesis accounting for up to 80% of cases [21,22,23]. H-RAS (Harvey rat sarcoma virus) and K-RAS (Kirsten rat sarcoma virus) mutations are indeed present in about 10–20% of cases and are almost invariably mutually exclusive with RET mutations [21,24]. Only other rare genetic alterations have been reported, thus 20–40% of MTC cases are still orphans of a driver mutation [21,22,23].
The primary objective of the present study was to investigate whether RET gene over-expression, a mechanism of RET activation different from activating mutation, could be considered an alternative driver event for the development of MTC. As a secondary objective, we also evaluated the expression levels of the two RET isoforms (RET9 and RET51) according to the mutational profile.

2. Materials and Methods

2.1. Patients

Eighty-three MTC patients were included in this study. Tissues were collected at surgery, immediately frozen in liquid nitrogen, and stored at −80 °C. All samples were previously analyzed by next-generation sequencing (NGS) IONS5, as previously described [21], and the mutational profile of our 83 cases was used to define the groups to be analyzed in the present study. In particular, we distinguished the 3 groups: cases with a somatic RET mutation (RET+), cases with a somatic RAS mutation (RAS+), and cases that were negative for RET and RAS mutations (RET− and RAS−).
All patients gave their consent to the study that was also approved by the Internal Reviewing Board.

2.2. Expression Analysis

RNA was extracted from fresh tissues using the TRIzol reagent lysis buffer (Invitrogen, Carlsbad, CA, USA) according to the protocol suggested by the manufacturer. Total RNA was quantified using the Qubit RNA HS Assay. cDNA was obtained by reverse transcription using the SuperScript IV VILO and 100 ng of total RNA in a final volume of 20 μL. The amplification of a house-keeping gene (Glucose-6-Phospate-dehydrogenase, G6PD) was used to verify the quality of cDNA.
To analyze the RET gene and RET gene isoform expression levels, we used the quantitative reverse transcription-polymerase chain reaction (qRT-PCR) technique with SsoAdvanced SYBR Green Supermix (Bio-Rad, Hercules, CA, USA). All reactions were performed with the BioRad CFX96 instrument.
Primers for the quantitative amplification of the RET tyrosine kinase domain were designed using the Primer3 software: (forward 5′ -> 3′ AACATCCTGGTAGCTGAGGG and reverse 5′ -> 3′ CAGCAGGACACCAAAAGACC) and were respectively located on exons 15 and 17. The efficiency and reproducibility of the primers were tested by a standard curve using a serial dilution of TT cDNA. The efficiency of the RET TK assay was E = 97.3%, R2 was 0.996, and the slope was −3.38. RET9 and RET51 isoforms were amplified using primers and conditions previously reported [14]. qRT-PCR reactions were performed in duplicate. Ct values of the replicates were similar (difference ≤ 0.5).
The G6PD housekeeping gene was used to normalize the RET gene expression level and its isoforms. It is not easy to find a reference tissue for MTC because normal thyroid tissue is not a counterpart of MTC, so 2-ΔΔCt is not applicable. This is the reason for which we decided to use the ΔCt analysis, a well recognized method for the analysis of the relative expression of genes. Gene expression level was calculated with the ΔCt method (ΔCt = Ct RET − Ct G6PD), where Ct is the threshold cycle for qRT-PCR. The lowest is the ΔCt value, and the highest is the mRNA expression level.

2.3. Statistical Analysis

Statistical analyses were performed with the Statview 5.0 Program using the Chi-squared test, 1-way ANOVA, and unpaired Student’s t-test. Differences were considered statistically significant when the p-value was less than 0.05.

3. Results

3.1. RET Gene Expression

Eighty-three samples previously analyzed by NGS for their mutation profile [21] were analyzed by qRT-PCR for RET gene expression. According to those data, cases with a RET somatic mutation (RET+, n = 39), cases with a RAS somatic mutation (RAS+, n = 20) and cases with no RET or RAS mutation (RET− or RAS−, n = 24). RET gene expression was detected in all cases regardless of the presence or absence of the mutations, although at different levels. As shown in Figure 1, a statistically significant higher expression of the RET gene was found in RET+ cases than in RET− and RAS− cases (p = 0.005). Although not statistically significant, RET gene expression was found to be higher in RET+ cases with respect to RAS+ cases. Similarly, RAS+ cases had a higher level of RET gene expression with respect to RET− and RAS− cases.
RET gene expression levels were found to be significantly higher in RET+ cases with respect to all other cases (i.e., RET− and RAS+) (p = 0.003) (Figure 2A). Similarly, cases positive for RET or RAS (RET+ or RAS+) showed a higher level of RET gene expression with respect to cases negative for both mutations (RET− and RAS−) (p = 0.01) (Figure 2B).
Expression levels are reported as ΔCt (ΔCt = Ct RET − Ct G6PD) where Ct is the threshold cycle for qRT-PCR. The lowest is the ΔCt value, and the highest is the gene expression level.

3.2. RET51 and RET9 Expression

As shown in Table 1, all cases (83/83, 100%) showed a RET51 isoform expression while only 72/83 (86.7%) showed a RET9 isoform expression. In the whole series, RET51 expression levels were significantly higher (p < 0.0001) than RET9 expression levels.
As shown in Figure 3, a statistically significant higher expression of the RET51 isoform was found in RET+ cases than in RAS+ cases (p = 0.0006) and RET− and RAS− cases (p = 0.001). No difference in the RET51 isoform expression levels was found when comparing RAS+ cases and RET− and RAS− cases.
As shown in Figure 4A, a statistically significant higher expression of the RET51 isoform was found in RET+ cases than in RET− and RAS+ cases (p = 0.0001). RET51 expression levels were found to be significantly higher in RET+ and RAS+ positive cases with respect to RET− and RAS− cases (p = 0.006) (Figure 4B). The RET9 isoform expression levels were not different in RET+, RAS+, and RET− and RAS− MTC cases.

4. Discussion

The RET proto-oncogene encodes for a tyrosine kinase receptor involved in the control of cell proliferation and differentiation [4]. Oncogenic mutations that constitutively activate the ret receptor have been reported in human tumors. RET mutations involved in the tumorigenesis processes can be classified as activating gain of function mutations, mainly in sporadic and hereditary MTC [25,26], and as gene rearrangements in PTC [26,27]. In addition to these alterations, increased expression of the wildtype RET is involved in the tumorigenesis and progression of some human tumors such as breast [7], pancreas [8], and prostate [9]. Recently, a higher RET gene expression has been observed also in MTC with respect to normal subjects [28]. In this study, we evaluated if an alternative mechanism of RET activation, such as overexpression, could be involved in MTC tumorigenesis, particularly in those cases that are still orphans of a driver mutation.
Using a qRT-PCR approach we demonstrated that RET gene expression levels are higher in MTC cases harboring a RET somatic mutation than in cases with a RAS somatic mutation or MTC cases without any of these mutations. These findings indicate that the increased rate of RET transcription and its higher expression cannot be considered as causative in RET− and RAS− cases. We recently demonstrated [29] that the prevalence of RET somatic mutations is higher in MTC of a larger tumor size, suggesting that the presence of this genetic alteration can induce a higher cell proliferation rate. According to these data, RET-mutated MTC cells could have a more active metabolic condition, thus also justifying higher levels of transcription. We could hypothesize that the over expression of RET mRNA can potentiate the transforming acitivity of RET mutations, thus concurring to the worse outcome of RET-mutated cases with respect to RET-negative cases and RAS-positive cases. RET-mutated tumors (both germline and somatic) show higher transcript levels of many epigenetic regulators than both RET wildtype and RAS-mutated MTC [30], and we can hypothesize that the higher RET gene expression could be due to the same mechanism.
Alternative splicing of the RET gene at the 3′ end has been described to produce two major isoforms: RET9 and RET51 [10,11]. A RET43 isoform has also been reported, although no evidence of its translational protein product has been provided so far [11]. The two isoforms are characterized by different biochemical and biological properties, and, consequently, they play distinct roles in tumorigenesis and/or development [17]. In particular, RET51 more effectively enhances cell proliferation and motility as well as maintains a more mesenchymal phenotype than RET9 [12,13] and is characterized by greater transforming potential [17,18]. In addition, previous studies using RET gene overexpression models have shown that RET51 has a greater transforming potential compared to RET9 [31,32,33]. In keeping with these observations, RET51 isoform expression is higher in MTC than in PTC [14] and in the more aggressive forms of pancreatic cancer [15], suggesting a specific role of this isoform in determining the aggressiveness of a tumor. In the present series, we evaluated the expression of the two RET isoforms, and we correlated the expression levels with the mutation profile. Interestingly, we found that all investigated cases were positive for RET51 expression while RET9 expression was found in 72/83 MTC cases, thus suggesting a predominant role of the longer isoform in MTC tumorigenesis. This predominant role has been confirmed by the observation that RET51 expression levels are higher than that of RET9.
We previously observed that overall RET51 isoform is more expressed than RET9 in MTC [14]. In the present study we demonstrated that RET51 isoform expression is higher in MTC cases harboring a RET somatic mutation with respect to cases with either a RAS somatic mutation (i.e., RAS+) or any somatic mutation (i.e., RET− and RAS−). At variance, no different levels of expression were found when analysing RET9 isoform expression. As reported by Le Hiret al. [16] it is likely that, in tumors caused by RET mutations, the presence of higher amounts of the long isoform can confer a selective growth advantage as demonstrated by the evidence that, in PC12 cells, the RET51 isoform displays a more prominent potential as compared to the corresponding RET9 isoforms [31,34]. This is in line with our previous evidence that sporadic MTC cases with a RET somatic mutation show a more rapid growth rate with respect to not-mutated cases in which RET51 isoform is less expressed [29].

5. Conclusions

In conclusion, according to our data, RET gene over-expression does not play a role in MTC tumorigenesis, neither as an entire gene or as isoforms. At variance, RET gene, and in particular the RET51 isoform, is expressed higher in RET-mutated cases. Taking into consideration that the RET51 isoform seems to be able to confer a selective growth advantage, our previous results, showing that RET mutated cases have a high percentage of the mutated allele and that the corresponding tumors are usually bigger than not-mutated cases, are further supported. Moreover, the overexpression of RET could potentiate the transforming activity of mutated RET, making these cases more aggressive.

Author Contributions

Conceptualization, C.M. and C.R.; Data curation, A.P., A.M. and V.C.; Methodology, R.C. and T.R.; Resources, L.T. and F.B.; Supervision, R.E. All authors have read and agreed to the published version of the manuscript.

Funding

This study has been supported by grants to R.E. from Associazione Italiana per la Ricerca sul Cancro (AIRC, Investigator grant 2018, project code 21790), Agenzia Italiana del Farmaco (AIFA, project code AIFA-2016-02365049).

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Institutional Review Board (Comitato Etico Regionale per la Sperimentazione Clinica della Regione Toscana) protocol code 6714, 05/02/2019.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Data available on request due to restrictions, e.g., privacy or ethical.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Takahashi, M.; Ritz, J.; Cooper, G.M. Activation of a novel human transforming gene, ret, by DNA rearrangement. Cell 1985, 42, 581–588. [Google Scholar] [CrossRef] [Scilit]
  2. De Groot, J.W.B.; Links, T.P.; Plukker, J.T.M.; Lips, C.J.M.; Hofstra, R. RET as a Diagnostic and Therapeutic Target in Sporadic and Hereditary Endocrine Tumors. Endocr. Rev. 2006, 27, 535–560. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Mulligan, L.M. GDNF and the RET Receptor in Cancer: New Insights and Therapeutic Potential. Front. Physiol. 2019, 9, 1873. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Romei, C.; Ciampi, R.; Elisei, R. A comprehensive overview of the role of the RET proto-oncogene in thyroid carcinoma. Nat. Rev. Endocrinol. 2016, 12, 192–202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Kohno, T.; Ichikawa, H.; Totoki, Y.; Yasuda, K.; Hiramoto, M.; Nammo, T.; Sakamoto, H.; Tsuta, K.; Furuta, K.; Shimada, Y.; et al. KIF5B-RET fusions in lung adenocarcinoma. Nat. Med. 2012, 18, 375–377. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Ballerini, P.; Struski, S.; Cresson, C.; Prade, N.; Toujani, S.; Deswarte, C.; Dobbelstein, S.; Petit, A.; Lapillonne, H.; Gautier, E.-F.; et al. RET fusion genes are associated with chronic myelomonocytic leukemia and enhance monocytic differentiation. Leukemia 2012, 26, 2384–2389. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Griseri, P.; Garrone, O.; Sardo, A.L.; Monteverde, M.; Rusmini, M.; Tonissi, F.; Merlano, M.; Bruzzi, P.; Nigro, C.L.; Ceccherini, I. Genetic and epigenetic factors affect RET gene expression in breast cancer cell lines and influence survival in patients. Oncotarget 2016, 7, 26465–26479. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Zeng, Q.; Cheng, Y.; Zhu, Q.; Yu, Z.; Wu, X.; Huang, K.; Zhou, M.; Han, S.; Zhang, Q. The Relationship between Over-expression of Glial Cell-derived Neurotrophic Factor and Its RET Receptor with Progression and Prognosis of Human Pancreatic Cancer. J. Int. Med. Res. 2008, 36, 656–664. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Ban, K.; Feng, S.; Shao, L.; Ittmann, M. RET Signaling in Prostate Cancer. Clin. Cancer Res. 2017, 23, 4885–4896. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Tahira, T.; Ishizaka, Y.; Itoh, F.; Sugimura, T.; Nagao, M. Characterization of ret proto-oncogene mRNAs encoding two isoforms of the protein product in a human neuroblastoma cell line. Oncogene 1990, 5, 97–102. [Google Scholar]
  11. Myers, S.M.; Eng, C.; A Ponder, B.; Mulligan, L.M. Characterization of RET proto-oncogene 3′ splicing variants and polyadenylation sites: A novel C-terminus for RET. Oncogene 1995, 11, 2039–2045. [Google Scholar]
  12. Lee, K.-Y.; Samy, E.T.; Sham, M.-H.; Tam, P.K.-H.; Lui, V.C.-H. 3′ Splicing variants of ret receptor tyrosine kinase are differentially expressed in mouse embryos and in adult mice. Biochim. Biophys. Acta BBA Gene Struct. Expr. 2003, 1627, 26–38. [Google Scholar] [CrossRef] [Scilit]
  13. Ivanchuk, S.M.; Myers, S.M.; Mulligan, L.M. Expression of RET 3′ splicing variants during human kidney development. Oncogene 1998, 16, 991–996. [Google Scholar] [CrossRef] [Scilit]
  14. Ramone, T.; Romei, C.; Ciampi, R.; Tacito, A.; Piaggi, P.; Torregrossa, L.; Ugolini, C.; Elisei, R. Differential expression of RET isoforms in normal thyroid tissues, papillary and medullary thyroid carcinomas. Endocrine 2019, 65, 623–629. [Google Scholar] [CrossRef] [Scilit]
  15. Lian, E.Y.; Hyndman, B.D.; Moodley, S.; Maritan, S.M.; Mulligan, L.M. RET isoforms contribute differentially to invasive processes in pancreatic ductal adenocarcinoma. Oncogene 2020, 39, 6493–6510. [Google Scholar] [CrossRef] [Scilit]
  16. Le Hir, H.; Charlet, N.; Gimenez-Roqueplo, A.-P.; Mannelli, M.; Plouin, P.-F.; De Franciscis, V.; Thermes, C. Relative Expression of the RET9 and RET51 Isoforms in Human Pheochromocytomas. Oncology 2000, 58, 311–318. [Google Scholar] [CrossRef] [Scilit]
  17. Richardson, D.; Rodrigues, D.M.; Hyndman, B.D.; Crupi, M.J.F.; Nicolescu, A.; Mulligan, L.M. Alternative splicing results in RET isoforms with distinct trafficking properties. Mol. Biol. Cell 2012, 23, 3838–3850. [Google Scholar] [CrossRef] [Scilit]
  18. Miranda-Filho, A.; Lortet-Tieulent, J.; Bray, F.; Cao, B.; Franceschi, S.; Vaccarella, S.; Maso, L.D. Thyroid cancer incidence trends by histology in 25 countries: A population-based study. Lancet Diabetes Endocrinol. 2021, 9, 225–234. [Google Scholar] [CrossRef] [Scilit]
  19. Marsh, D.J.; Learoyd, D.L.; Andrew, S.D.; Krishnan, L.; Pojer, R.; Richardson, A.-L.; Delbridge, L.; Eng, C.; Robinson, B.G. Somatic mutations in the RET proto-oncogene in sporadic medullary thyroid carcinoma. Clin. Endocrinol. 1996, 44, 249–257. [Google Scholar] [CrossRef] [Scilit]
  20. Wells, S.A.; Pacini, F.; Robinson, B.G.; Santoro, M. Multiple Endocrine Neoplasia Type 2 and Familial Medullary Thyroid Carcinoma: An Update. J. Clin. Endocrinol. Metab. 2013, 98, 3149–3164. [Google Scholar] [CrossRef] [Scilit]
  21. Ciampi, R.; Romei, C.; Ramone, T.; Prete, A.; Tacito, A.; Cappagli, V.; Bottici, V.; Viola, D.; Torregrossa, L.; Ugolini, C.; et al. Genetic Landscape of Somatic Mutations in a Large Cohort of Sporadic Medullary Thyroid Carcinomas Studied by Next-Generation Targeted Sequencing. iScience 2019, 20, 324–336. [Google Scholar] [CrossRef] [Scilit]
  22. Agrawal, N.; Jiao, Y.; Sausen, M.; Leary, R.; Bettegowda, C.; Roberts, N.; Bhan, S.; Ho, A.S.; Khan, Z.; Bishop, J.; et al. Exomic Sequencing of Medullary Thyroid Cancer Reveals Dominant and Mutually Exclusive Oncogenic Mutations in RET and RAS. J. Clin. Endocrinol. Metab. 2013, 98, E364–E369. [Google Scholar] [CrossRef] [Scilit]
  23. Simbolo, M.; Mian, C.; Barollo, S.; Fassan, M.; Mafficini, A.; Neves, D.; Scardoni, M.; Pennelli, G.; Rugge, M.; Pelizzo, M.R.; et al. High-throughput mutation profiling improves diagnostic stratification of sporadic medullary thyroid carcinomas. Virchows Archiv 2014, 465, 73–78. [Google Scholar] [CrossRef] [Scilit]
  24. Moura, M.M.; Cavaco, B.M.; Leite, V. RAS proto-oncogene in medullary thyroid carcinoma. Endocr. Relat. Cancer 2015, 22, R235–R252. [Google Scholar] [CrossRef] [Scilit]
  25. Mulligan, L.M.; Kwok, J.; Healey, C.S.; Elsdon, M.J.; Eng, C.; Gardner, E.; Love, D.; Mole, S.; Moore, J.K.; Papi, L.; et al. Germ-line mutations of the RET proto-oncogene in multiple endocrine neoplasia type 2A. Nat. Cell Biol. 1993, 363, 458–460. [Google Scholar] [CrossRef] [Scilit]
  26. Salvatore, D.; Santoro, M.; Schlumberger, M. The importance of the RET gene in thyroid cancer and therapeutic implications. Nat. Rev. Endocrinol. 2021, 17, 296–306. [Google Scholar] [CrossRef] [Scilit]
  27. Fusco, A.; Grieco, M.; Santoro, M.; Berlingieri, M.T.; Pilotti, S.; Pierotti, M.A.; Della Porta, G.; Vecchio, G. A new oncogene in human thyroid papillary carcinomas and their lymph-nodal metastases. Nat. Cell Biol. 1987, 328, 170–172. [Google Scholar] [CrossRef] [Scilit]
  28. Shakiba, E.; Movahedi, M.; Majd, A.; Hedayati, M. Investigating the expression and promoter methylation of RET gene in patients with medullary thyroid cancer with unmutated RET. J. Cell. Physiol. 2019, 234, 16304–16311. [Google Scholar] [CrossRef] [Scilit]
  29. Romei, C.; Ramone, T.; Mulè, C.; Prete, A.; Cappagli, V.; Lorusso, L.; Torregrossa, L.; Basolo, F.; Ciampi, R.; Elisei, R. RET mutated C-cells proliferate more rapidly than non-mutated neoplastic cells. Endocr. Connect. 2021, 10, 124–130. [Google Scholar] [CrossRef] [Scilit]
  30. Sponziello, M.; Durante, C.; Boichard, A.; Dima, M.; Puppin, C.; Verrienti, A.; Tamburrano, G.; Di Rocco, G.; Redler, A.; Lacroix, L.; et al. Epigenetic-related gene expression profile in medullary thyroid cancer revealed the overexpression of the histone methyltransferases EZH2 and SMYD3 in aggressive tumours. Mol. Cell. Endocrinol. 2014, 392, 8–13. [Google Scholar] [CrossRef] [Scilit]
  31. Rossel, M.; Pasini, A.; Chappius, S.; Geneste, O.; Fournier, L.; Schuffenecker, I.; Takahishi, M.; Van Grunsven, L.A.; Urdiales, J.L.; Rudkin, B.B.; et al. Distinct biological properties of two RET isoforms activated by MEN 2A and MEN 2B mutations. Oncogene 1997, 14, 265–275. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Ishiguro, Y.; Iwashita, T.; Murakami, H.; Asai, N.; Iida, K.-I.; Goto, H.; Hayakawa, T.; Takahashi, M. The Role of Amino Acids Surrounding Tyrosine 1062 in Ret in Specific Binding of the Shc Phosphotyrosine-Binding Domain1. Endocrinology 1999, 140, 3992–3998. [Google Scholar] [CrossRef] [PubMed]
  33. Iwashita, T.; Kato, M.; Murakami, H.; Asai, N.; Ishiguro, Y.; Ito, S.; Iwata, Y.; Kawai, K.; Asai, M.; Kurokawa, K.; et al. Biological and biochemical properties of Ret with kinase domain mutations identified in multiple endocrine neoplasia type 2B and familial medullary thyroid carcinoma. Oncogene 1999, 18, 3919–3922. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Pasini, A.; Geneste, O.; Legrand, P.; Schlumberger, M.; Rossel, M.; Fournier, L.; Rudkin, B.B.; Schuffenecker, I.; Lenoir, G.M.; Billaud, M. Oncogenic activation of RET by two distinct FMTC mutations affecting the tyrosine kinase domain. Oncogene 1997, 15, 393–402. [Google Scholar] [CrossRef] [Scilit]
Figure 1. RET gene expression levels according to the somatic mutation profile. A statistically significant higher expression level was observed in RET+. Gene expression levels are reported as ΔCt (ΔCt = Ct RET − Ct G6PD) where Ct is the threshold cycle for qRT-PCR. The lowest is the ΔCt value, and the highest is the mRNA expression level.
Figure 1. RET gene expression levels according to the somatic mutation profile. A statistically significant higher expression level was observed in RET+. Gene expression levels are reported as ΔCt (ΔCt = Ct RET − Ct G6PD) where Ct is the threshold cycle for qRT-PCR. The lowest is the ΔCt value, and the highest is the mRNA expression level.
Biomolecules 11 01542 g001
Figure 2. (A): RET gene expression levels according to the somatic mutation profile. A statistically significant higher RET gene expression level was observed in RET+ cases with respect to RET− and RAS+ cases. (B): gene expression levels according to the somatic mutation profile. A statistically significant higher RET gene expression level was observed in RET+ or RAS+ cases with respect to cases negative for both gene alterations (RET− and RAS−).
Figure 2. (A): RET gene expression levels according to the somatic mutation profile. A statistically significant higher RET gene expression level was observed in RET+ cases with respect to RET− and RAS+ cases. (B): gene expression levels according to the somatic mutation profile. A statistically significant higher RET gene expression level was observed in RET+ or RAS+ cases with respect to cases negative for both gene alterations (RET− and RAS−).
Biomolecules 11 01542 g002
Figure 3. RET51 isoform expression levels according to the somatic mutation profile. A statistically significant higher expression level was observed in RET+ cases than in RAS+ cases and RET− and RAS− cases. Gene expression levels are reported as ΔCt (ΔCt = Ct RET – Ct G6PD) where Ct is the threshold cycle for qRT-PCR. The lowest is the ΔCt value, and the highest is the mRNA expression level.
Figure 3. RET51 isoform expression levels according to the somatic mutation profile. A statistically significant higher expression level was observed in RET+ cases than in RAS+ cases and RET− and RAS− cases. Gene expression levels are reported as ΔCt (ΔCt = Ct RET – Ct G6PD) where Ct is the threshold cycle for qRT-PCR. The lowest is the ΔCt value, and the highest is the mRNA expression level.
Biomolecules 11 01542 g003
Figure 4. (A): RET51 isoform expression levels according to the somatic mutation profile. A statistically significant higher RET51 expression level was observed in RET-positive cases with respect to cases negative for a RET mutation. (B): RET51 isoform expression levels according to the somatic mutation profile. A statistically significant higher RET gene expression level was observed in positive cases with respect to cases negative for both genes. Expression levels are reported as ΔCt (ΔCt = Ct RET – Ct G6PD) where Ct is the threshold cycle for qRT-PCR. The lowest is the ΔCt value, and the highest are the gene expression levels.
Figure 4. (A): RET51 isoform expression levels according to the somatic mutation profile. A statistically significant higher RET51 expression level was observed in RET-positive cases with respect to cases negative for a RET mutation. (B): RET51 isoform expression levels according to the somatic mutation profile. A statistically significant higher RET gene expression level was observed in positive cases with respect to cases negative for both genes. Expression levels are reported as ΔCt (ΔCt = Ct RET – Ct G6PD) where Ct is the threshold cycle for qRT-PCR. The lowest is the ΔCt value, and the highest are the gene expression levels.
Biomolecules 11 01542 g004
Table 1. RET9 and RET51 isoforms expression in our series of 83 MTC cases.
Table 1. RET9 and RET51 isoforms expression in our series of 83 MTC cases.
RET Gene ExpressionRET9 n(%)RET51 n(%)p
Pos expression72 (86.7)83 (100)Not applicable
Neg expression110
ΔCt *4.91.8<0.0001
* Expression levels are reported as ΔCt (ΔCt = Ct RET – Ct G6PD) where Ct is the threshold cycle for qRT-PCR. The lowest is the ΔCt value, and the highest is the mRNA expression level.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Mulè, C.; Ciampi, R.; Ramone, T.; Prete, A.; Matrone, A.; Cappagli, V.; Torregrossa, L.; Basolo, F.; Elisei, R.; Romei, C. Higher RET Gene Expression Levels Do Not Represent anAlternative RET Activation Mechanism in Medullary Thyroid Carcinoma. Biomolecules 2021, 11, 1542. https://doi.org/10.3390/biom11101542

AMA Style

Mulè C, Ciampi R, Ramone T, Prete A, Matrone A, Cappagli V, Torregrossa L, Basolo F, Elisei R, Romei C. Higher RET Gene Expression Levels Do Not Represent anAlternative RET Activation Mechanism in Medullary Thyroid Carcinoma. Biomolecules. 2021; 11(10):1542. https://doi.org/10.3390/biom11101542

Chicago/Turabian Style

Mulè, Chiara, Raffaele Ciampi, Teresa Ramone, Alessandro Prete, Antonio Matrone, Virginia Cappagli, Liborio Torregrossa, Fulvio Basolo, Rossella Elisei, and Cristina Romei. 2021. "Higher RET Gene Expression Levels Do Not Represent anAlternative RET Activation Mechanism in Medullary Thyroid Carcinoma" Biomolecules 11, no. 10: 1542. https://doi.org/10.3390/biom11101542

APA Style

Mulè, C., Ciampi, R., Ramone, T., Prete, A., Matrone, A., Cappagli, V., Torregrossa, L., Basolo, F., Elisei, R., & Romei, C. (2021). Higher RET Gene Expression Levels Do Not Represent anAlternative RET Activation Mechanism in Medullary Thyroid Carcinoma. Biomolecules, 11(10), 1542. https://doi.org/10.3390/biom11101542

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop