The Effect of Resveratrol on Mitochondrial Function in Myoblasts of Patients with the Common m.3243A>G Mutation
Abstract
1. Introduction
2. Materials and Methods
2.1. Human Myoblasts
Myoblast Culture Conditions
2.2. The Seahorse XF96 Analysis of Metabolic Function
2.3. Gene Expression by Quantitative Real-Time (qRT)-PCR
2.4. Statistical Analysis
2.5. Ethical Statement
3. Results
3.1. The Seahorse XF96 Analysis of Metabolic Function
3.1.1. The Effect of Restricted Conditions
3.1.2. Differences between Patients Harboring the m.3243A>G Mutation and Controls
Mito Stress Test in the Absence of Resveratrol
Mito Stress Test in RSV-treated Groups
3.1.3. The Effect of RSV on OXPHOS Factors
The Effect of RSV on OXPHOS Factors under Normal Conditions
The Effect of RSV on OXPHOS Factors under Restricted Conditions
3.2. Gene Expression by qRT-PCR
3.2.1. The Effect of Restrictions
3.2.2. The Difference between Patients and Controls
3.2.3. The Effect of RSV
4. Discussion
Limitations
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Wallace, D.C. A mitochondrial paradigm of metabolic and degenerative diseases, aging, and cancer: A dawn for evolutionary medicine. Annu. Rev. Genet. 2005, 39, 359–407. [Google Scholar] [CrossRef] [PubMed]
- Schon, E.A.; DiMauro, S.; Hirano, M. Human mitochondrial DNA: Roles of inherited and somatic mutations. Nat. Rev. Genet. 2012, 13, 878–890. [Google Scholar] [CrossRef] [PubMed]
- Scholle, L.M.; Zierz, S.; Mawrin, C.; Wickenhauser, C.; Urban, D.L. Heteroplasmy and Copy Number in the Common m.3243A>G Mutation-A Post-Mortem Genotype-Phenotype Analysis. Genes 2020, 11, 212. [Google Scholar] [CrossRef] [PubMed]
- Lehmann, D.; Schubert, K.; Joshi, P.R.; Baty, K.; Blakely, E.L.; Zierz, S.; Taylor, R.W.; Deschauer, M. A novel m.7539C>T point mutation in the mt-tRNA(Asp) gene associated with multisystemic mitochondrial disease. Neuromuscul. Disord. 2015, 25, 81–84. [Google Scholar] [CrossRef] [PubMed]
- Majamaa, K.; Moilanen, J.S.; Uimonen, S.; Remes, A.M.; Salmela, P.I.; Karppa, M.; Majamaa-Voltti, K.A.; Rusanen, H.; Sorri, M.; Peuhkurinen, K.J.; et al. Epidemiology of A3243G, the mutation for mitochondrial encephalomyopathy, lactic acidosis, and strokelike episodes: Prevalence of the mutation in an adult population. Am. J. Hum. Genet. 1998, 63, 447–454. [Google Scholar] [CrossRef] [PubMed]
- Rahman, S.; Poulton, J.; Marchington, D.; Suomalainen, A. Decrease of 3243 A-->G mtDNA mutation from blood in MELAS syndrome: A longitudinal study. Am. J. Hum. Genet. 2001, 68, 238–240. [Google Scholar] [CrossRef]
- Kobayashi, Y.; Ichihashi, K.; Ohta, S.; Nihei, K.; Kagawa, Y.; Yanagisawa, M.; Momoi, M.Y. The mutant mitochondrial genes in mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) were selectively amplified through generations. J. Inherit. Metab. Dis. 1992, 15, 803–808. [Google Scholar] [CrossRef]
- Goto, Y.; Nonaka, I.; Horai, S. A mutation in the tRNA(Leu)(UUR) gene associated with the MELAS subgroup of mitochondrial encephalomyopathies. Nature 1990, 348, 651–653. [Google Scholar] [CrossRef]
- Wahab, A.; Gao, K.; Jia, C.; Zhang, F.; Tian, G.; Murtaza, G.; Chen, J. Significance of Resveratrol in Clinical Management of Chronic Diseases. Molecules 2017, 22, 1329. [Google Scholar] [CrossRef]
- Fong, D.; Chan, M.M. Dietary phytochemicals target cancer stem cells for cancer chemoprevention. In Mitochondria as Targets for Phytochemicals in Cancer Prevention and Therapy; Springer: Berlin/Heidelberg, Germany, 2013; pp. 85–125. [Google Scholar]
- Civitarese, A.E.; Carling, S.; Heilbronn, L.K.; Hulver, M.H.; Ukropcova, B.; Deutsch, W.A.; Smith, S.R.; Ravussin, E. Calorie restriction increases muscle mitochondrial biogenesis in healthy humans. PLoS Med. 2007, 4, e76. [Google Scholar]
- Brenmoehl, J.; Hoeflich, A. Dual control of mitochondrial biogenesis by sirtuin 1 and sirtuin 3. Mitochondrion 2013, 13, 755–761. [Google Scholar] [CrossRef]
- Austin, S.; St-Pierre, J. PGC1alpha and mitochondrial metabolism--emerging concepts and relevance in ageing and neurodegenerative disorders. J. Cell Sci. 2012, 125, 4963–4971. [Google Scholar] [CrossRef] [PubMed]
- Tang, B.L. Sirt1 and the Mitochondria. Mol. Cells 2016, 39, 87–95. [Google Scholar] [CrossRef]
- Lagouge, M.; Argmann, C.; Gerhart-Hines, Z.; Meziane, H.; Lerin, C.; Daussin, F.; Messadeq, N.; Milne, J.; Lambert, P.; Elliott, P.; et al. Resveratrol improves mitochondrial function and protects against metabolic disease by activating SIRT1 and PGC-1alpha. Cell 2006, 127, 1109–1122. [Google Scholar] [CrossRef]
- Gurd, B.J.; Yoshida, Y.; Lally, J.; Holloway, G.P.; Bonen, A. The deacetylase enzyme SIRT1 is not associated with oxidative capacity in rat heart and skeletal muscle and its overexpression reduces mitochondrial biogenesis. J. Physiol. 2009, 587, 1817–1828. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Wang, N.; Li, J.; Zhang, J.; Feng, P. Effects of resveratrol on NO secretion stimulated by insulin and its dependence on SIRT1 in high glucose cultured endothelial cells. Endocrine 2010, 37, 365–372. [Google Scholar] [CrossRef] [PubMed]
- Price, N.L.; Gomes, A.P.; Ling, A.J.; Duarte, F.V.; Martin-Montalvo, A.; North, B.J.; Agarwal, B.; Ye, L.; Ramadori, G.; Teodoro, J.S. SIRT1 is required for AMPK activation and the beneficial effects of resveratrol on mitochondrial function. Cell Metab. 2012, 15, 675–690. [Google Scholar] [CrossRef] [PubMed]
- Pacholec, M.; Bleasdale, J.E.; Chrunyk, B.; Cunningham, D.; Flynn, D.; Garofalo, R.S.; Griffith, D.; Griffor, M.; Loulakis, P.; Pabst, B. SRT1720, SRT2183, SRT1460, and resveratrol are not direct activators of SIRT1. J. Biol. Chem. 2010, 285, 8340–8351. [Google Scholar] [CrossRef]
- Schirmer, H.; Pereira, T.C.B.; Rico, E.P.; Rosemberg, D.B.; Bonan, C.D.; Bogo, M.R.; Souto, A.A. Modulatory effect of resveratrol on SIRT1, SIRT3, SIRT4, PGC1α and NAMPT gene expression profiles in wild-type adult zebrafish liver. Mol. Biol. Rep. 2012, 39, 3281–3289. [Google Scholar] [CrossRef]
- Milton-Laskibar, I.; Aguirre, L.; Etxeberria, U.; Milagro, F.I.; Martínez, J.A.; Portillo, M.P. Do the effects of resveratrol on thermogenic and oxidative capacities in IBAT and skeletal muscle depend on feeding conditions? Nutrients 2018, 10, 1446. [Google Scholar] [CrossRef]
- Baur, J.A. Resveratrol, sirtuins, and the promise of a DR mimetic. Mech. Ageing Dev. 2010, 131, 261–269. [Google Scholar] [CrossRef] [PubMed]
- Palacios, O.M.; Carmona, J.J.; Michan, S.; Chen, K.Y.; Manabe, Y.; Ward III, J.L.; Goodyear, L.J.; Tong, Q. Diet and exercise signals regulate SIRT3 and activate AMPK and PGC-1α in skeletal muscle. Aging 2009, 1, 771. [Google Scholar] [CrossRef] [PubMed]
- Widlund, A.L.; Baral, K.; Dalgaard, L.T.; Vang, O. Functional Mitochondria Are Important for the Effect of Resveratrol. Molecules 2017, 22, 847. [Google Scholar] [CrossRef] [PubMed]
- Lin, D.-S.; Kao, S.-H.; Ho, C.-S.; Wei, Y.-H.; Hung, P.-L.; Hsu, M.-H.; Wu, T.-Y.; Wang, T.-J.; Jian, Y.-R.; Lee, T.-H. Inflexibility of AMPK-mediated metabolic reprogramming in mitochondrial disease. Oncotarget 2017, 8, 73627. [Google Scholar] [CrossRef] [PubMed]
- Elkalaf, M.; Anděl, M.; Trnka, J. Low glucose but not galactose enhances oxidative mitochondrial metabolism in C2C12 myoblasts and myotubes. PLoS ONE 2013, 8, e70772. [Google Scholar] [CrossRef] [PubMed]
- Barazzoni, R.; Zanetti, M.; Bosutti, A.; Biolo, G.; Vitali-Serdoz, L.; Stebel, M.; Guarnieri, G. Moderate caloric restriction, but not physiological hyperleptinemia per se, enhances mitochondrial oxidative capacity in rat liver and skeletal muscle—tissue-specific impact on tissue triglyceride content and AKT activation. Endocrinology 2005, 146, 2098–2106. [Google Scholar] [CrossRef]
- Cerletti, M.; Jang, Y.C.; Finley, L.W.; Haigis, M.C.; Wagers, A.J. Short-term calorie restriction enhances skeletal muscle stem cell function. Cell Stem Cell 2012, 10, 515–519. [Google Scholar] [CrossRef]
- Lopes Costa, A.; Le Bachelier, C.; Mathieu, L.; Rotig, A.; Boneh, A.; De Lonlay, P.; Tarnopolsky, M.A.; Thorburn, D.R.; Bastin, J.; Djouadi, F. Beneficial effects of resveratrol on respiratory chain defects in patients’ fibroblasts involve estrogen receptor and estrogen-related receptor alpha signaling. Hum. Mol. Genet. 2014, 23, 2106–2119. [Google Scholar] [CrossRef]
- Mizuguchi, Y.; Hatakeyama, H.; Sueoka, K.; Tanaka, M.; Goto, Y.-i. Low dose resveratrol ameliorates mitochondrial respiratory dysfunction and enhances cellular reprogramming. Mitochondrion 2017, 34, 43–48. [Google Scholar] [CrossRef]
- Douiev, L.; Soiferman, D.; Alban, C.; Saada, A. The effects of ascorbate, N-acetylcysteine, and resveratrol on fibroblasts from patients with mitochondrial disorders. J. Clin. Med. 2017, 6, 1. [Google Scholar] [CrossRef]
- De Paepe, B.; Van Coster, R. A critical assessment of the therapeutic potential of resveratrol supplements for treating mitochondrial disorders. Nutrients 2017, 9, 1017. [Google Scholar] [CrossRef] [PubMed]
- Higashida, K.; Kim, S.H.; Jung, S.R.; Asaka, M.; Holloszy, J.O.; Han, D.-H. Effects of resveratrol and SIRT1 on PGC-1α activity and mitochondrial biogenesis: A reevaluation. PLoS Biol. 2013, 11, e1001603. [Google Scholar] [CrossRef] [PubMed]
- Zheng, J.; Ramirez, V.D. Inhibition of mitochondrial proton F0F1-ATPase/ATP synthase by polyphenolic phytochemicals. Br. J. Pharmacol. 2000, 130, 1115–1123. [Google Scholar] [CrossRef] [PubMed]
- Zini, R.; Morin, C.; Bertelli, A.; Bertelli, A.A.; Tillement, J. Effects of resveratrol on the rat brain respiratory chain. Drugs Exp. Clin. Res. 1999, 25, 87–97. [Google Scholar] [PubMed]
- Joseph, A.-M.; Rungi, A.A.; Robinson, B.H.; Hood, D.A. Compensatory responses of protein import and transcription factor expression in mitochondrial DNA defects. Am. J. Physiol. Cell Physiol. 2004, 286, C867–C875. [Google Scholar] [CrossRef]
- Gerhart-Hines, Z.; Rodgers, J.T.; Bare, O.; Lerin, C.; Kim, S.H.; Mostoslavsky, R.; Alt, F.W.; Wu, Z.; Puigserver, P. Metabolic control of muscle mitochondrial function and fatty acid oxidation through SIRT1/PGC-1alpha. EMBO J. 2007, 26, 1913–1923. [Google Scholar] [CrossRef]
- Tauriainen, E.; Luostarinen, M.; Martonen, E.; Finckenberg, P.; Kovalainen, M.; Huotari, A.; Herzig, K.-H.; Lecklin, A.; Mervaala, E. Distinct effects of calorie restriction and resveratrol on diet-induced obesity and fatty liver formation. J. Nutr. Metab. 2011, 2011, 525094. [Google Scholar] [CrossRef]
- Hill, B.G.; Benavides, G.A.; Lancaster, J.R., Jr.; Ballinger, S.; Dell’Italia, L.; Jianhua, Z.; Darley-Usmar, V.M. Integration of cellular bioenergetics with mitochondrial quality control and autophagy. Biol. Chem. 2012, 393, 1485–1512. [Google Scholar] [CrossRef]
- Abeliovich, H.; Dengjel, J. Mitophagy as a stress response in mammalian cells and in respiring S. cerevisiae. Biochem. Soc. Trans. 2016, 44, 541–545. [Google Scholar] [CrossRef][Green Version]
Gender | Age at Biopsy | Location of Muscle Biopsy | |
---|---|---|---|
Patients | |||
P 1 | M | 43 | biceps brachii muscle |
P 2 | M | 42 | biceps brachii muscle |
P 3 | F | 70 | quadriceps muscle |
P 4 | M | 34 | deltoideus muscle |
P 5 | F | 40 | biceps brachii muscle |
Controls | |||
C1 | F | 50 | biceps brachii muscle |
C 2 | M | 53 | quadriceps muscle |
C 3 | F | 40 | quadriceps muscle |
C 4 | M | 35 | biceps brachii muscle |
C 5 | F | 49 | biceps brachii muscle |
Target Gene | Forward Primer | Reverse Primer |
---|---|---|
SIRT1 | AGAAGAACCCATGGAGGATG | TCATCTCCATCAGTCCCAAA |
SIRT3 | CAGCAGTACGATCTCCCGTA | GAAGCAGCCGGAGAAAGTAG |
PGC-1α | GTCCAGGCAGGAGCTTTTAGA | AGCTTTGATTTGCTCAAGCCAT |
Nrf1 | AGGAACACGGAGTGACCCAA | TATGCTCGGTGTAAGTAGCCA |
Tfam | ATGGCGTTTCTCCGAAGCAT | TCCGCCCTATAAGCATCTTGA |
HPRT1 | ACCAGTCAACAGGGGACATAA | CTTCGTGGGGTCCTTTTCACC |
β-Actin | GCGCCGTTCCGAAAGTTG | CGCGCCGCTGGGTTTTATAG |
N conditions | |||||||||
−RSV | 10 µM RSV | 20 µM RSV | |||||||
Controls (mean) | Patients (mean) | p value | Controls (mean) | Patients (mean) | p value | Controls (mean) | Patients (mean) | p value | |
Basal | 59.24 | 41.71 | 0.0005 | 56.11 | 39.19 | <0.0001 | 45.44 | 35.44 | 0.05 |
MR | 212.3 | 153.3 | 0.05 | 191.3 | 169.2 | 190.4 | 164 | ||
SRC | 156.4 | 144.1 | 135.2 | 115.8 | 137.3 | 116.8 | |||
ATP | 45.64 | 33.51 | 0.01 | 40.39 | 28.82 | 0.001 | 37.24 | 29.4 | 0.03 |
R conditions | |||||||||
−RSV | 10 µM RSV | 20 µM RSV | |||||||
Controls (mean) | Patients (mean) | p value | Controls (mean) | Patients (mean) | p value | Controls (mean) | Patients (mean) | p value | |
Basal | 14.19 | 16.52 | 18.91 | 23.8 | 24.84 | 21 | |||
MR | 78.04 | 66.87 | 87.21 | 81.92 | 103.8 | 71.5 | |||
SRC | 57.88 | 50.34 | 68.79 | 62.84 | 79.22 | 48.38 | |||
ATP | 10.67 | 12.45 | 18.9 | 23.8 | 24.84 | 21 |
Controls | ||||||||||
N | R | |||||||||
−RSV | 10 | p (10) | 20 | p (20) | −RSV | 10 | p (10) | 20 | p (20) | |
Basal | 59.24 | 56.11 | 45.44 | 0.02 | 14.19 | 18.91 | 24.84 | 0.008 | ||
MR | 212.3 | 191.3 | 190.4 | 78.04 | 87.21 | 103.8 | ||||
SRC | 156.4 | 135.2 | 137.3 | 57.88 | 68.79 | 79.22 | ||||
ATP | 45.64 | 40.39 | 37.24 | 10.67 | 18.9 | 0.03 | 24.84 | <0.0001 | ||
Patients | ||||||||||
N | R | |||||||||
−RSV | 10 | p (10) | 20 | p (20) | −RSV | 10 | p (10) | 20 | p (20) | |
Basal | 41.71 | 39.19 | 35.44 | 16.52 | 23.8 | 0.05 | 21 | |||
MR | 153.3 | 169.2 | 164 | 66.87 | 81.92 | 71.5 | ||||
SRC | 144.1 | 115.8 | 116.8 | 50.34 | 62.84 | 48.38 | ||||
ATP | 33.51 | 28.82 | 29.4 | 12.45 | 23.8 | <0.0001 | 21 | 0.005 |
Controls | |||||||||
−RSV | 10 µM RSV | 20 µM RSV | |||||||
N (mean) | R (mean) | p value | N (mean) | R (mean) | p value | N (mean) | R(mean) | p value | |
SIRT1 | 0.56 | 2.04 | 2.65 | 0.82 | 0.84 | 7.1 | <0.0001 | ||
SIRT3 | 0.4 | 2.1 | 0.02 | 1.77 | 1.47 | 1.07 | 3.46 | 0.0003 | |
PGC-1α | 0.3 | 17.8 | <0.0001 | 1.41 | 8.3 | <0.0001 | 0.45 | 19.97 | <0.0001 |
Nrf1 | 0.57 | 1.87 | 2.68 | 0.77 | 0.007 | 1.16 | 3.51 | 0.0004 | |
Tfam | 2.99 | 4.45 | 12.44 | 2.67 | <0.0001 | 4.96 | 7.55 | ||
Patients | |||||||||
−RSV | 10 µM RSV | 20 µM RSV | |||||||
N (mean) | R (mean) | p value | N (mean) | R (mean) | p value | N (mean) | R (mean) | p value | |
SIRT1 | 1.26 | 3.19 | 2.463 | 0.95 | 0.67 | 5.82 | <0.0001 | ||
SIRT3 | 0.77 | 2.9 | 0.0009 | 1.49 | 1.36 | 0.57 | 1.45 | ||
PGC-1α | 0.27 | 4.7 | 0.006 | 0.94 | 3.78 | 0.54 | 4.43 | 0.02 | |
Nrf1 | 0.93 | 2.97 | 0.003 | 1.21 | 0.79 | 0.9 | 3.7 | <0.0001 | |
Tfam | 2.71 | 4.4 | 8.34 | 2.27 | 0.0003 | 1.53 | 2.7 |
Controls | ||||||||||
N | R | |||||||||
−RSV | 10 | p (10) | 20 | p (20) | −RSV | 10 | p (10) | 20 | p (20) | |
SIRT1 | 0.56 | 2.65 | 0.84 | 2.04 | 0.82 | 7.1 | <0.001 | |||
SIRT3 | 0.4 | 1.77 | 1.07 | 2.1 | 1.47 | 3.46 | ||||
PGC-1α | 0.3 | 1.41 | 0.45 | 17.8 | 8.3 | <0.0001 | 19.97 | |||
Nrf1 | 0.57 | 2.68 | 0.002 | 1.16 | 1.87 | 0.77 | 3.51 | 0.03 | ||
Tfam | 2.99 | 12.44 | <0.0001 | 4.96 | 4.45 | 2.67 | 7.55 | |||
Patients | ||||||||||
N | R | |||||||||
−RSV | 10 | p (10) | 20 | p (20) | −RSV | 10 | p (10) | 20 | p (20) | |
SIRT1 | 1.26 | 2.463 | 0.67 | 3.19 | 0.95 | 5.82 | 0.02 | |||
SIRT3 | 0.77 | 1.49 | 0.57 | 2.9 | 1.36 | 1.45 | ||||
PGC-1α | 0.27 | 0.94 | 0.54 | 4.7 | 3.78 | 4.43 | ||||
Nrf1 | 0.93 | 1.21 | 0.9 | 2.97 | 0.79 | 0.004 | 3.7 | |||
Tfam | 2.71 | 8.34 | 0.004 | 1.53 | 4.4 | 2.27 | 2.7 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Motlagh Scholle, L.; Schieffers, H.; Al-Robaiy, S.; Thaele, A.; Dehghani, F.; Lehmann Urban, D.; Zierz, S. The Effect of Resveratrol on Mitochondrial Function in Myoblasts of Patients with the Common m.3243A>G Mutation. Biomolecules 2020, 10, 1103. https://doi.org/10.3390/biom10081103
Motlagh Scholle L, Schieffers H, Al-Robaiy S, Thaele A, Dehghani F, Lehmann Urban D, Zierz S. The Effect of Resveratrol on Mitochondrial Function in Myoblasts of Patients with the Common m.3243A>G Mutation. Biomolecules. 2020; 10(8):1103. https://doi.org/10.3390/biom10081103
Chicago/Turabian StyleMotlagh Scholle, Leila, Helena Schieffers, Samiya Al-Robaiy, Annemarie Thaele, Faramarz Dehghani, Diana Lehmann Urban, and Stephan Zierz. 2020. "The Effect of Resveratrol on Mitochondrial Function in Myoblasts of Patients with the Common m.3243A>G Mutation" Biomolecules 10, no. 8: 1103. https://doi.org/10.3390/biom10081103
APA StyleMotlagh Scholle, L., Schieffers, H., Al-Robaiy, S., Thaele, A., Dehghani, F., Lehmann Urban, D., & Zierz, S. (2020). The Effect of Resveratrol on Mitochondrial Function in Myoblasts of Patients with the Common m.3243A>G Mutation. Biomolecules, 10(8), 1103. https://doi.org/10.3390/biom10081103