SIRT1 Mediates Melatonin’s Effects on Microglial Activation in Hypoxia: In Vitro and In Vivo Evidence
Abstract
:1. Introduction
2. Materials and Methods
2.1. Drugs and Reagents
2.2. Cell Cultures
2.3. Animals
2.4. Model for Common Carotid Artery Occlusion (CCAO) and Treatment
2.5. Viability 3-(4, 5-Dimethylthiazolyl-2)-2, 5-Diphenyltetrazolium Bromide (MTT) Assay
2.6. Trypan Blue Exclusion Assay
2.7. Real-Time Polymerase Chain Reaction
2.8. Western Blot
2.9. Immunocytochemistry
2.10. Immunohistochemistry and Cell Count
2.11. Statistical Analysis
3. Results
3.1. In Vitro Experiments
3.1.1. Microglia Potentiate Neuronal Damage during Chemical Hypoxia with CoCl2
3.1.2. Melatonin Protects Microglia after Hypoxia via SIRT1 Activation
3.1.3. Melatonin Modulates Microglial Hypoxic and Inflammatory Markers Indirectly Affecting Neurons during Hypoxia
3.2. In Vivo Experiments
3.2.1. Melatonin Differently Affects Microglia in the Cortex and Hippocampus of Hypoxic Rats
3.2.2. Expression of SIRT1 Is Selectively Modified in Amoeboid Microglia of the Corpus Callosum in Hypoxic Rats
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Hardeland, R.; Pandi-Perumal, S.; Cardinali, D. Melatonin. Int. J. Biochem. Cell Boil. 2006, 38, 313–316. [Google Scholar] [CrossRef]
- Mahmood, D. Pleiotropic Effects of Melatonin. Drug Res. 2018, 69, 65–74. [Google Scholar] [CrossRef]
- Pandi-Perumal, S.R.; Srinivasan, V.; Maestroni, G.J.M.; Cardinali, D.P.; Poeggeler, B.; Hardeland, R. Melatonin. FEBS J. 2006, 273, 2813–2838. [Google Scholar] [CrossRef]
- Tarocco, A.; Caroccia, N.; Morciano, G.; Wieckowski, M.; Ancora, G.; Garani, G.; Pinton, P. Melatonin as a master regulator of cell death and inflammation: Molecular mechanisms and clinical implications for newborn care. Cell Death Dis. 2019, 10, 317. [Google Scholar] [CrossRef] [Green Version]
- Balduini, W.; Carloni, S.; Perrone, S.; Bertrando, S.; Tataranno, M.; Negro, S.; Proietti, F.; Longini, M.; Buonocore, G. The use of melatonin in hypoxic-ischemic brain damage: An experimental study. J. Matern. Neonatal Med. 2012, 25, 119–124. [Google Scholar] [CrossRef] [PubMed]
- Paprocka, J.; Kijonka, M.; Rzepka, B.; Sokół, M. Melatonin in Hypoxic-Ischemic Brain Injury in Term and Preterm Babies. Int. J. Endocrinol. 2019, 2019, 9626715. [Google Scholar] [CrossRef] [PubMed]
- Yawno, T.; Mahen, M.; Li, J.; Fahey, M.C.; Jenkin, G.; Miller, S. The Beneficial Effects of Melatonin Administration Following Hypoxia-Ischemia in Preterm Fetal Sheep. Front. Cell. Neurosci. 2017, 11, 296. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vincent, B. Protective roles of melatonin against the amyloid-dependent development of Alzheimer’s disease: A critical review. Pharmacol. Res. 2018, 134, 223–237. [Google Scholar] [CrossRef] [PubMed]
- Mack, J.M.; Schamne, M.G.; Sampaio, T.B.; Pertile, R.; Fernandes, P.A.C.M.; Markus, R.P.; Prediger, R.D. Melatoninergic System in Parkinson’s Disease: From Neuroprotection to the Management of Motor and Nonmotor Symptoms. Oxidative Med. Cell. Longev. 2016, 2016, 1–31. [Google Scholar] [CrossRef] [Green Version]
- Shen, Z.; Zhou, Z.; Gao, S.; Guo, Y.; Gao, K.; Wang, H.; Dang, X. Melatonin Inhibits Neural Cell Apoptosis and Promotes Locomotor Recovery via Activation of the Wnt/β-Catenin Signaling Pathway After Spinal Cord Injury. Neurochem. Res. 2017, 42, 2336–2343. [Google Scholar] [CrossRef]
- Cardinali, D.P. Melatonin: Clinical Perspectives in Neurodegeneration. Front. Endocrinol. 2019, 10, 480. [Google Scholar] [CrossRef] [PubMed]
- Comai, S.; Lopez-Canul, M.; De Gregorio, D.; Posner, A.; Ettaoussi, M.; Guarnieri, F.C.; Gobbi, G. Melatonin MT1 receptor as a novel target in neuropsychopharmacology: MT1 ligands, pathophysiological and therapeutic implications, and perspectives. Pharmacol. Res. 2019, 144, 343–356. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Clough, S.J.; Hutchinson, A.J.; Adamah-Biassi, E.B.; Popovska-Gorevski, M.; Dubocovich, M.L. MT1 and MT2 Melatonin Receptors: A Therapeutic Perspective. Annu. Rev. Pharmacol. Toxicol. 2015, 56, 361–383. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dubocovich, M.L.; Markowska, M. Functional MT1 and MT2 Melatonin Receptors in Mammals. Endocr. 2005, 27, 101–110. [Google Scholar] [CrossRef]
- Klosen, P.; Lapmanee, S.; Schuster, C.; Guardiola, B.; Hicks, D.; Pévet, P.; Felder-Schmittbuhl, M.P.; Sawarut, L. MT1 and MT2 melatonin receptors are expressed in nonoverlapping neuronal populations. J. Pineal Res. 2019, 67, e12575. [Google Scholar] [CrossRef]
- Kaneko, Y.; Hayashi, T.; Yu, S.; Tajiri, N.; Bae, E.; Solomita, M.A.; Chheda, S.H.; Weinbren, N.L.; Parolini, O.; Borlongan, C.V. Human amniotic epithelial cells express melatonin receptor MT1, but not melatonin receptor MT2: a new perspective to neuroprotection. J. Pineal Res. 2011, 50, 272–280. [Google Scholar] [CrossRef]
- Sinha, B.; Wu, Q.; Li, W.; Tu, Y.; Sirianni, A.C.; Chen, Y.; Jiang, J.; Zhang, X.; Chen, W.; Zhou, S.; et al. Protection of melatonin in experimental models of newborn hypoxic-ischemic brain injury through MT1 receptor. J. Pineal Res. 2017, 64, e12443. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Sirianni, A.; Pei, Z.; Cormier, K.; Smith, K.; Jiang, J.; Zhou, S.; Wang, H.; Zhao, R.; Yano, H.; et al. The melatonin MT1 receptor axis modulates mutant Huntingtin-mediated toxicity. J. Neurosci. 2011, 31, 14496–14507. [Google Scholar] [CrossRef] [Green Version]
- Guo, P.; Pi, H.; Xu, S.; Zhang, L.; Li, Y.; Li, M.; Cao, Z.; Tian, L.; Xie, J.; Li, R.; et al. Melatonin Improves mitochondrial function by promoting MT1/SIRT1/PGC-1 alpha-dependent mitochondrial biogenesis in cadmium-induced hepatotoxicity in vitro. Toxicol. Sci. 2014, 142, 182–195. [Google Scholar] [CrossRef] [Green Version]
- Hardeland, R. Aging, Melatonin, and the Pro- and Anti-Inflammatory Networks. Int. J. Mol. Sci. 2019, 20, 1223. [Google Scholar] [CrossRef] [Green Version]
- Carloni, S.; Riparini, G.; Buonocore, G.; Balduini, W. Rapid modulation of the silent information regulator 1 (SIRT1) by melatonin after hypoxia-ischemia in the neonatal rat brain. J. Pineal Res. 2017, 63, e12434. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Wang, S.; Gan, L.; Vosler, P.S.; Gao, Y.; Zigmond, M.J.; Chen, J. Protective effects and mechanisms of sirtuins in the nervous system. Prog. Neurobiol. 2011, 95, 373–395. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, S.-H.; Lee, J.-H.; Lee, H.-Y.; Min, K.-J. Sirtuin signaling in cellular senescence and aging. BMB Rep. 2019, 52, 24–34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aly, H.; Elmahdy, H.; El-Dib, M.; Rowisha, M.; Awny, M.; El-Gohary, T.; Elbatch, M.; Hamisa, M.; El-Mashad, A.-R. Melatonin use for neuroprotection in perinatal asphyxia: a randomized controlled pilot study. J. Perinatol. 2014, 35, 186–191. [Google Scholar] [CrossRef] [PubMed]
- Balduini, W.; Weiss, M.; Carloni, S.; Rocchi, M.; Sura, L.; Rossignol, C.; Longini, M.; Bazzini, F.; Perrone, S.; Ott, D.; et al. Melatonin pharmacokinetics and dose extrapolation after enteral infusion in neonates subjected to hypothermia. J. Pineal Res. 2019, 66, e12565. [Google Scholar] [CrossRef] [PubMed]
- Yıldız, E.P.; Ekici, B.; Tatlı, B. Neonatal hypoxic ischemic encephalopathy: an update on disease pathogenesis and treatment. Expert Rev. Neurother. 2016, 17, 449–459. [Google Scholar] [CrossRef]
- Bhalala, U.S.; Koehler, R.C.; Kannan, S. Neuroinflammation and Neuroimmune Dysregulation after Acute Hypoxic-Ischemic Injury of Developing Brain. Front. Pediatr. 2015, 2, 144. [Google Scholar] [CrossRef]
- Patel, A.R.; Ritzel, R.; McCullough, L.D.; Liu, F. Microglia and ischemic stroke: a double-edged sword. Int. J. Physiol. Pathophysiol. Pharmacol. 2013, 5, 73–90. [Google Scholar] [PubMed]
- Parakalan, R.; Jiang, B.; Baby, N.; Janani, M.; Jayapal, M.; Lu, J.; Tay, S.S.; Ling, E.-A.; Dheen, S. Transcriptome analysis of amoeboid and ramified microglia isolated from the corpus callosum of rat brain. BMC Neurosci. 2012, 13, 64. [Google Scholar] [CrossRef] [Green Version]
- Hristova, M.; Cuthill, D.; Zbarsky, V.; Acosta-Saltos, A.; Wallace, A.; Blight, K.; Buckley, S.M.; Peebles, N.; Heuer, H.; Waddington, S.N.; et al. Activation and deactivation of periventricular white matter phagocytes during postnatal mouse development. Glia 2010, 58, 11–28. [Google Scholar] [CrossRef]
- Epelman, M.; Daneman, A.; Halliday, W.; Whyte, H.; Blaser, S.I. Abnormal corpus callosum in neonates after hypoxic-ischemic injury. Pediatr. Radiol. 2011, 42, 321–330. [Google Scholar] [CrossRef] [PubMed]
- Caraci, F.; Merlo, S.; Drago, F.; Caruso, G.; Parenti, C.; Sortino, M.A. Rescue of Noradrenergic System as a Novel Pharmacological Strategy in the Treatment of Chronic Pain: Focus on Microglia Activation. Front. Pharmacol. 2019, 10, 1024. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Merlo, S.; Spampinato, S.F.; Beneventano, M.; Sortino, M.A. The contribution of microglia to early synaptic compensatory responses that precede β-amyloid-induced neuronal death. Sci. Rep. 2018, 8, 7297. [Google Scholar] [CrossRef] [PubMed]
- Merlo, S.; Spampinato, S.F.; Sortino, M.A. Early compensatory responses against neuronal injury: A new therapeutic window of opportunity for Alzheimer’s Disease? CNS Neurosci. Ther. 2018, 25, 5–13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ziemka-Nalecz, M.; Jaworska, J.; Zalewska, T. Insights Into the Neuroinflammatory Responses After Neonatal Hypoxia-Ischemia. J. Neuropathol. Exp. Neurol. 2017, 76, 644–654. [Google Scholar] [CrossRef] [Green Version]
- Reiter, R.J.; Calvo, J.; Karbownik-Lewinska, M.; Qi, W.; Tan, D.X. Melatonin and its relation to the immune system and inflammation. Ann. N. Y. Acad. Sci. 2000, 917, 376–386. [Google Scholar] [CrossRef] [PubMed]
- Hu, L.; Zhang, S.; Wen, H.; Liu, T.; Cai, J.; Du, D.; Zhu, D.; Chen, F.; Xia, C. Melatonin decreases M1 polarization via attenuating mitochondrial oxidative damage depending on UCP2 pathway in prorenin-treated microglia. PLoS ONE 2019, 14, e0212138. [Google Scholar] [CrossRef]
- López-Aguilera, F.; Plateo-Pignatari, M.; Biaggio, V.; Ayala, C.; Seltzer, A. Hypoxic preconditioning induces an AT2-R/VEGFR-2(Flk-1) interaction in the neonatal brain microvasculature for neuroprotection. Neuroscience 2012, 216, 1–9. [Google Scholar] [CrossRef]
- Romero, J.I.; Hanschmann, E.-M.; Gellert, M.; Eitner, S.; Holubiec, M.I.; Calvo, E.B.; Lillig, C.H.; Capani, F. Thioredoxin 1 and glutaredoxin 2 contribute to maintain the phenotype and integrity of neurons following perinatal asphyxia. Biochim. Biophys. Acta (BBA) Gen. Subj. 2015, 1850, 1274–1285. [Google Scholar] [CrossRef]
- Saraceno, G.; Caceres, L.G.; Guelman, L.R.; Castilla, R.; Udovin, L.; Ellisman, M.; Brocco, M.; Capani, F. Consequences of excessive plasticity in the hippocampus induced by perinatal asphyxia. Exp. Neurol. 2016, 286, 116–123. [Google Scholar] [CrossRef]
- Cuzzocrea, S.; Costantino, G.; Gitto, E.; Mazzon, E.; Fulia, F.; Serraino, I.; Cordaro, S.; Barberi, I.; De Sarro, A.; Caputi, A.P. Protective effects of melatonin in ischemic brain injury. J. Pineal Res. 2000, 29, 217–227. [Google Scholar] [CrossRef] [PubMed]
- Parada, E.; Buendia, I.; Leon, R.; Negredo, P.; Romero, A.; Cuadrado, A.; Lopez, M.G.; Egea, J. Neuroprotective effect of melatonin against ischemia is partially mediated by alpha-7 nicotinic receptor modulation and HO-1 overexpression. J. Pineal Res. 2014, 56, 204–212. [Google Scholar] [CrossRef] [PubMed]
- Cornette, L. Therapeutic hypothermia in neonatal asphyxia. Facts Views Vis. Obgyn. 2012, 4, 133–139. [Google Scholar] [PubMed]
- Gunn, A.J.; Laptook, A.R.; Robertson, N.J.; Barks, J.; Thoresen, M.; Wassink, G.; Bennet, L. Therapeutic hypothermia translates from ancient history in to practice. Pediatr. Res. 2016, 81, 202–209. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wassink, G.; Davidson, J.O.; Dhillon, S.K.; Zhou, K.Q.; Bennet, L.; Thoresen, M.; Gunn, A.J. Therapeutic Hypothermia in Neonatal Hypoxic-Ischemic Encephalopathy. Curr. Neurol. Neurosci. Rep. 2019, 19, 2. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carloni, S.; Facchinetti, F.; Pelizzi, N.; Buonocore, G.; Balduini, W. Melatonin Acts in Synergy with Hypothermia to Reduce Oxygen-Glucose Deprivation-Induced Cell Death in Rat Hippocampus Organotypic Slice Cultures. Neonatology 2018, 114, 364–371. [Google Scholar] [CrossRef] [PubMed]
- Robertson, N.J.; Faulkner, S.; Fleiss, B.; Bainbridge, A.; Andorka, C.; Price, D.; Powell, E.; Lecky-Thompson, L.; Thei, L.; Chandrasekaran, M.; et al. Melatonin augments hypothermic neuroprotection in a perinatal asphyxia model. Brain 2012, 136, 90–105. [Google Scholar] [CrossRef]
- Hassell, K.J.; Ezzati, M.; Alonso-Alconada, D.; Hausenloy, D.J.; Robertson, N.J. New horizons for newborn brain protection: Enhancing endogenous neuroprotection. Arch. Dis. Child. Fetal Neonatal Ed. 2015, 100, F541–F552. [Google Scholar] [CrossRef]
- Yao, L.; Lu, P.; Ling, E.-A. Melatonin Suppresses Toll Like Receptor 4-Dependent Caspase-3 Signaling Activation Coupled with Reduced Production of Proinflammatory Mediators in Hypoxic Microglia. PLoS ONE 2016, 11, e0166010. [Google Scholar] [CrossRef]
- Ock, J.; Cho, H.-J.; Hong, S.; Kim, I.; Suk, K. Hypoxia as an Initiator of Neuroinflammation: Microglial Connections. Curr. Neuropharmacol. 2005, 3, 183–191. [Google Scholar] [CrossRef]
- Reiter, R.J.; Rosales-Corral, S.; Tan, D.X.; Jou, M.J.; Galano, A.; Xu, B. Melatonin as a mitochondria-targeted antioxidant: one of evolution’s best ideas. Cell. Mol. Life Sci. 2017, 74, 3863–3881. [Google Scholar] [CrossRef] [PubMed]
- Reiter, R.J.; Mayo, J.C.; Tan, D.-X.; Sainz, R.M.; Alatorre-Jimenez, M.; Qin, L. Melatonin as an antioxidant: under promises but over delivers. J. Pineal Res. 2016, 61, 253–278. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, C.; Mayo, J.C.; Sainz, R.M.; Antolín, I.; Herrera, F.; Martín, V.; Reiter, R.J. Regulation of antioxidant enzymes: a significant role for melatonin. J. Pineal Res. 2004, 36, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Benitez-King, G.; Huerto-Delgadillo, L.; Antón-Tay, F. Binding of 3H-melatonin to calmodulin. Life Sci. 1993, 53, 201–207. [Google Scholar] [CrossRef]
- Rehman, S.U.; Ikram, M.; Ullah, N.; Alam, S.I.; Park, H.Y.; Badshah, H.; Choe, K.; Kim, M.O. Neurological Enhancement Effects of Melatonin against Brain Injury-Induced Oxidative Stress, Neuroinflammation, and Neurodegeneration via AMPK/CREB Signaling. Cells 2019, 8, 760. [Google Scholar] [CrossRef] [Green Version]
- Xing, J.; Xu, H.; Liu, C.; Wei, Z.; Wang, Z.; Zhao, L.; Ren, L. Melatonin ameliorates endoplasmic reticulum stress in N2a neuroblastoma cell hypoxia-reoxygenation injury by activating the AMPK-Pak2 pathway. Cell Stress Chaperones 2019, 24, 621–633. [Google Scholar] [CrossRef]
- Zhang, L.; Zhang, Z.; Wang, J.; Lv, D.; Zhu, T.; Wang, F.; Tian, X.; Yao, Y.; Ji, P.; Liu, G. Melatonin regulates the activities of ovary and delays the fertility decline in female animals via MT1/AMPK pathway. J. Pineal Res. 2019, 66, e12550. [Google Scholar] [CrossRef]
- Stacchiotti, A.; Nardo, L.; Rizzoni, D.; Rezzani, R.; Reiter, R.J. Melatonin drives beneficial Sirtuin 1 expression in leptin-deficient mice liver through MT1 receptor. Ital. J. Anat. Embryol. 2015. [Google Scholar] [CrossRef]
- Yuan, Y.; Hilliard, G.; Ferguson, T.; Millhorn, D.E. Cobalt Inhibits the Interaction between Hypoxia-inducible Factor-α and von Hippel-Lindau Protein by Direct Binding to Hypoxia-inducible Factor-α. J. Boil. Chem. 2003, 278, 15911–15916. [Google Scholar] [CrossRef] [Green Version]
- Muñoz-Sánchez, J.; Chánez-Cárdenas, M.E. The use of cobalt chloride as a chemical hypoxia model. J. Appl. Toxicol. 2018, 39, 556–570. [Google Scholar] [CrossRef]
- Cantó, C.; Gerhart-Hines, Z.; Feige, J.N.; Lagouge, M.; Noriega, L.; Milne, J.C.; Elliott, P.J.; Puigserver, P.; Auwerx, J.; Noriega, L. AMPK regulates energy expenditure by modulating NAD+ metabolism and SIRT1 activity. Nature 2009, 458, 1056–1060. [Google Scholar] [CrossRef] [PubMed]
- Davis, C.K.; Jain, S.A.; Bae, O.-N.; Majid, A.; Rajanikant, G. Hypoxia Mimetic Agents for Ischemic Stroke. Front. Cell Dev. Boil. 2019, 6, 175. [Google Scholar] [CrossRef] [PubMed]
- Hou, Y.; Wang, J.; Feng, J. The neuroprotective effects of curcumin are associated with the regulation of the reciprocal function between autophagy and HIF-1α in cerebral ischemia-reperfusion injury. Drug Des. Dev. Ther. 2019, 13, 1135–1144. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Niu, G.; Zhu, D.; Zhang, X.; Wang, J.; Zhao, Y.; Wang, X. Role of Hypoxia-Inducible Factors 1α (HIF1α) in SH-SY5Y Cell Autophagy Induced by Oxygen-Glucose Deprivation. Med Sci. Monit. 2018, 24, 2758–2766. [Google Scholar] [CrossRef] [Green Version]
- Koh, H.S.; Chang, C.Y.; Jeon, S.-B.; Yoon, H.J.; Ahn, Y.-H.; Kim, H.-S.; Kim, I.-H.; Jeon, S.H.; Johnson, R.S.; Park, E.-J. The HIF-1/glial TIM-3 axis controls inflammation-associated brain damage under hypoxia. Nat. Commun. 2015, 6, 6340. [Google Scholar] [CrossRef] [Green Version]
- Vangeison, G.; Carr, D.; Federoff, H.J.; Rempe, D.A. The Good, the Bad, and the Cell Type-Specific Roles of Hypoxia Inducible Factor-1α in Neurons and Astrocytes. J. Neurosci. 2008, 28, 1988–1993. [Google Scholar] [CrossRef]
- Barteczek, P.; Li, L.; Ernst, A.-S.; Böhler, L.-I.; Marti, H.H.; Kunze, R. Neuronal HIF-1α and HIF-2α deficiency improves neuronal survival and sensorimotor function in the early acute phase after ischemic stroke. Br. J. Pharmacol. 2016, 37, 291–306. [Google Scholar] [CrossRef] [Green Version]
- Yang, J.; Liu, C.; Du, X.; Liu, M.; Ji, X.; Du, H.; Zhao, H. Hypoxia Inducible Factor 1α Plays a Key Role in Remote Ischemic Preconditioning Against Stroke by Modulating Inflammatory Responses in Rats. J. Am. Hear. Assoc. 2018, 7, e007589. [Google Scholar] [CrossRef] [PubMed]
- Fan, X.; Heijnen, C.J.; Van Der Kooij, M.; Groenendaal, F.; Van Bel, F. The role and regulation of hypoxia-inducible factor-1α expression in brain development and neonatal hypoxic–ischemic brain injury. Brain Res. Rev. 2009, 62, 99–108. [Google Scholar] [CrossRef]
- Kuehn, S.; Hurst, J.; Rensinghoff, F.; Tsai, T.; Grauthoff, S.; Satgunarajah, Y.; Dick, H.; Schnichels, S.; Joachim, S.C. Degenerative effects of cobalt-chloride treatment on neurons and microglia in a porcine retina organ culture model. Exp. Eye Res. 2017, 155, 107–120. [Google Scholar] [CrossRef]
- Lu, Y.; Gu, Y.; Ding, X.; Wang, J.; Chen, J.-W.; Miao, C. Intracellular Ca2+ homeostasis and JAK1/STAT3 pathway are involved in the protective effect of propofol on BV2 microglia against hypoxia-induced inflammation and apoptosis. PLoS ONE 2017, 12, e0178098. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bok, S.; Kim, Y.-E.; Woo, Y.; Kim, S.; Kang, S.-J.; Lee, Y.; Park, S.K.; Weissman, I.L.; Ahn, G.-O. Hypoxia-inducible factor-1α regulates microglial functions affecting neuronal survival in the acute phase of ischemic stroke in mice. Oncotarget 2017, 8, 111508–111521. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, C.-C.; Lin, J.-T.; Cheng, Y.-F.; Kuo, C.-Y.; Huang, C.-F.; Kao, S.-H.; Liang, Y.-J.; Cheng, C.-Y.; Chen, H.-M. Amelioration of LPS-Induced Inflammation Response in Microglia by AMPK Activation. BioMed Res. Int. 2014, 2014, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Meares, G.P.; Qin, H.; Liu, Y.; Holdbrooks, A.T.; Benveniste, E.N. AMP-activated protein kinase restricts IFN-γ signaling. J. Immunol. 2012, 190, 372–380. [Google Scholar] [CrossRef]
- Velagapudi, R.; El-Bakoush, A.; Lepiarz, I.; Ogunrinade, F.; Olajide, O.A. AMPK and SIRT1 activation contribute to inhibition of neuroinflammation by thymoquinone in BV2 microglia. Mol. Cell. Biochem. 2017, 435, 149–162. [Google Scholar] [CrossRef]
- Mendes, K.L.; Lelis, D.D.F.; Santos, S.H.S. Nuclear sirtuins and inflammatory signaling pathways. Cytokine Growth Factor Rev. 2017, 38, 98–105. [Google Scholar] [CrossRef]
- Byles, V. Aberrant Cytoplasm Localization and Protein Stability of SIRT1 is Regulated by PI3K/IGF-1R Signaling in Human Cancer Cells. Int. J. Boil. Sci. 2010, 6, 599–612. [Google Scholar] [CrossRef] [Green Version]
- Jin, Q.; Yan, T.; Ge, X.; Sun, C.; Shi, X.; Zhai, Q. Cytoplasm-localized SIRT1 enhances apoptosis. J. Cell. Physiol. 2007, 213, 88–97. [Google Scholar] [CrossRef]
- Carloni, S.; Albertini, M.; Galluzzi, L.; Buonocore, G.; Proietti, F.; Balduini, W. Melatonin reduces endoplasmic reticulum stress and preserves sirtuin 1 expression in neuronal cells of newborn rats after hypoxia-ischemia. J. Pineal Res. 2014, 57, 192–199. [Google Scholar] [CrossRef]
- Yang, Y.; Jiang, S.; Dong, Y.; Fan, C.; Zhao, L.; Yang, X.; Li, J.; Di, S.; Yue, L.; Liang, G.; et al. Melatonin prevents cell death and mitochondrial dysfunction via a SIRT1-dependent mechanism during ischemic-stroke in mice. J. Pineal Res. 2014, 58, 61–70. [Google Scholar] [CrossRef]
- Shih, R.-H.; Wang, C.-Y.; Yang, C.-M. NF-kappaB Signaling Pathways in Neurological Inflammation: A Mini Review. Front. Mol. Neurosci. 2015, 8, 3244. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lim, J.-H.; Lee, Y.-M.; Chun, Y.-S.; Chen, J.; Kim, J.-E.; Park, J.-W. Sirtuin 1 Modulates Cellular Responses to Hypoxia by Deacetylating Hypoxia-Inducible Factor 1α. Mol. Cell 2010, 38, 864–878. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Zhang, W.; Pan, H.; Feldser, H.G.; Lainez, E.; Miller, C.; Leung, S.; Zhong, Z.; Zhao, H.; Sweitzer, S.; et al. SIRT1 Activators Suppress Inflammatory Responses through Promotion of p65 Deacetylation and Inhibition of NF-κB Activity. PLoS ONE 2012, 7, e46364. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kauppinen, A.; Suuronen, T.; Ojala, J.; Kaarniranta, K.; Salminen, A. Antagonistic crosstalk between NF-κB and SIRT1 in the regulation of inflammation and metabolic disorders. Cell. Signal. 2013, 25, 1939–1948. [Google Scholar] [CrossRef]
- Vannucci, R.; Connor, J.; Mauger, D.; Palmer, C.; Smith, M.; Towfighi, J.; Vannucci, S. Rat model of perinatal hypoxic-ischemic brain damage. J. Neurosci. Res. 1999, 55, 158–163. [Google Scholar] [CrossRef]
- Rupalla, K.; Allegrini, P.R.; Sauer, D.; Wiessner, C. Time course of microglia activation and apoptosis in various brain regions after permanent focal cerebral ischemia in mice. Acta Neuropathol. 1998, 96, 172–178. [Google Scholar] [CrossRef]
- Volpe, J.J. Neurobiology of Periventricular Leukomalacia in the Premature Infant. Pediatr. Res. 2001, 50, 553–562. [Google Scholar] [CrossRef] [Green Version]
- Kaur, C.; Rathnasamy, G.; Ling, E.-A. Biology of Microglia in the Developing Brain. J. Neuropathol. Exp. Neurol. 2017, 76, 736–753. [Google Scholar] [CrossRef] [Green Version]
- Deng, Y.; Lu, J.; Sivakumar, V.; Ling, E.A.; Kaur, C. Amoeboid Microglia in the Periventricular White Matter Induce Oligodendrocyte Damage through Expression of Proinflammatory Cytokines via MAP Kinase Signaling Pathway in Hypoxic Neonatal Rats. Brain Pathol. 2008, 18, 387–400. [Google Scholar] [CrossRef]
- Kaur, C.; Ling, E. Periventricular white matter damage in the hypoxic neonatal brain: Role of microglial cells. Prog. Neurobiol. 2009, 87, 264–280. [Google Scholar] [CrossRef]
- Yao, L.; Kan, E.M.; Lu, J.; Hao, A.; Dheen, S.; Kaur, C.; Ling, E.-A. Toll-like receptor 4 mediates microglial activation and production of inflammatory mediators in neonatal rat brain following hypoxia: role of TLR4 in hypoxic microglia. J. Neuroinflammation 2013, 10, 23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, B.; Dasgupta, C.; Huang, L.; Meng, X.; Zhang, L. MiRNA-210 induces microglial activation and regulates microglia-mediated neuroinflammation in neonatal hypoxic-ischemic encephalopathy. Cell. Mol. Immunol. 2019. [Google Scholar] [CrossRef] [PubMed]
PRIMERS | Manufacturer |
---|---|
Mm_Il6_1_SG QuantiTect Primer Assay (mouse)–(IL-6)_QT00098875 | Qiagen |
Mm_Tnf_1_SG QuantiTect Primer Assay (mouse)–(TNF-α)_QT00104006 | Qiagen |
Mm_Il1b_2_SG QuantiTect Primer Assay (mouse)–(IL-1β)_QT01048355 | Qiagen |
Ribosomal Protein S18-Forward (GTTCCGACCATAAACGATGCC) Ribosomal Protein S18-Reverse (TGGTGGTGCCCCCGTCAAT) | Eurofin |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Merlo, S.; Luaces, J.P.; Spampinato, S.F.; Toro-Urrego, N.; Caruso, G.I.; D’Amico, F.; Capani, F.; Sortino, M.A. SIRT1 Mediates Melatonin’s Effects on Microglial Activation in Hypoxia: In Vitro and In Vivo Evidence. Biomolecules 2020, 10, 364. https://doi.org/10.3390/biom10030364
Merlo S, Luaces JP, Spampinato SF, Toro-Urrego N, Caruso GI, D’Amico F, Capani F, Sortino MA. SIRT1 Mediates Melatonin’s Effects on Microglial Activation in Hypoxia: In Vitro and In Vivo Evidence. Biomolecules. 2020; 10(3):364. https://doi.org/10.3390/biom10030364
Chicago/Turabian StyleMerlo, Sara, Juan Pablo Luaces, Simona Federica Spampinato, Nicolas Toro-Urrego, Grazia Ilaria Caruso, Fabio D’Amico, Francisco Capani, and Maria Angela Sortino. 2020. "SIRT1 Mediates Melatonin’s Effects on Microglial Activation in Hypoxia: In Vitro and In Vivo Evidence" Biomolecules 10, no. 3: 364. https://doi.org/10.3390/biom10030364