A Fairy Chemical Suppresses Retinal Angiogenesis as a HIF Inhibitor
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal
2.2. Cell Culture
2.3. Compounds from Mushroom-Forming Fungi
2.4. Luciferase Assay
2.5. Quantitative PCR
2.6. Western Blotting
2.7. Oxygen-Induced Retinopathy Model and Administration of a Compound from Mushrooms
2.8. Statistical Analysis
3. Results
3.1. AHX Showed an Inhibitory Effect on HIF Activity
3.2. Hypoxia-Responsive Gene Expressions Were Suppressed by AHX Treatment under CoCl2-Induced Hypoxic Condition
3.3. Neovascularization in a Murine OIR Model Was Suppressed by AHX Administration
4. Discussion
5. Conclusions
6. Patents
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Appendix A
References
- Ding, J.; Wong, T.Y. Current Epidemiology of Diabetic Retinopathy and Diabetic Macular Edema. Curr. Diabetes Rep. 2012, 12, 346–354. [Google Scholar] [CrossRef] [PubMed]
- Resnikoff, S.; Pascolini, D.; Etya’ale, D.; Kocur, I.; Pararajasegaram, R.; Pokharel, G.P.; Mariotti, S.P. Global data on visual impairment in the year 2002. Bull. World Health Organ. 2004, 82, 844–851. [Google Scholar] [PubMed]
- Ozaki, H.; Seo, M.S.; Ozaki, K.; Yamada, H.; Yamada, E.; Okamoto, N.; Hofmann, F.; Wood, J.M.; Campochiaro, P.A. Blockade of vascular endothelial cell growth factor receptor signaling is sufficient to completely prevent retinal neovascularization. Am. J. Pathol. 2000, 156, 697–707. [Google Scholar] [CrossRef] [Green Version]
- Cabral, T.; Mello, L.G.M.; Lima, L.H.; Polido, J.; Regatieri, C.V.; Belfort, R.; Mahajan, V.B. Retinal and choroidal angiogenesis: A review of new targets. Int. J. Retin. Vitr. 2017, 3, 31. [Google Scholar] [CrossRef]
- Fogli, S.; Del Re, M.; Rofi, E.; Posarelli, C.; Figus, M.; Danesi, R. Clinical pharmacology of intravitreal anti-VEGF drugs. Eye 2018, 32, 1010–1020. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaelin, W.G.; Ratcliffe, P.J. Oxygen Sensing by Metazoans: The Central Role of the HIF Hydroxylase Pathway. Mol. Cell 2008, 30, 393–402. [Google Scholar] [CrossRef]
- Mole, D.R.; Blancher, C.; Copley, R.R.; Pollard, P.J.; Gleadle, J.M.; Ragoussis, J.; Ratcliffe, P.J. Genome-wide association of hypoxia-inducible factor (HIF)-1alpha and HIF-2alpha DNA binding with expression profiling of hypoxia-inducible transcripts. J. Biol. Chem. 2009, 284, 16767–16775. [Google Scholar] [CrossRef] [Green Version]
- Majmundar, A.J.; Wong, W.J.; Simon, M.C. Hypoxia-Inducible Factors and the Response to Hypoxic Stress. Mol. Cell 2010, 40, 294–309. [Google Scholar] [CrossRef] [Green Version]
- Ibuki, M.; Shoda, C.; Miwa, Y.; Ishida, A.; Tsubota, K.; Kurihara, T. Therapeutic Effect of Garcinia cambogia Extract and Hydroxycitric Acid Inhibiting Hypoxia-Inducible Factor in a Murine Model of Age-Related Macular Degeneration. Int. J. Mol. Sci. 2019, 20, 5049. [Google Scholar] [CrossRef] [Green Version]
- Shoda, C.; Miwa, Y.; Nimura, K.; Okamoto, K.; Yamagami, S.; Tsubota, K.; Kurihara, T. Hypoxia-Inducible Factor Inhibitors Derived from Marine Products Suppress a Murine Model of Neovascular Retinopathy. Nutrients 2020, 12, 1055. [Google Scholar]
- Miwa, Y.; Hoshino, Y.; Shoda, C.; Jiang, X.; Tsubota, K.; Kurihara, T. Pharmacological HIF inhibition prevents retinal neovascularization with improved visual function in a murine oxygen-induced retinopathy model. Neurochem. Int. 2019, 128, 21–31. [Google Scholar] [CrossRef] [PubMed]
- Kunimi, H.; Miwa, Y.; Inoue, H.; Tsubota, K.; Kurihara, T. A Novel HIF Inhibitor Halofuginone Prevents Neurodegeneration in a Murine Model of Retinal Ischemia-Reperfusion. Int. J. Mol. Sci. 2019, 20, 3171. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Valverde, M.E.; Hernández-Pérez, T.; Paredes-López, O. Edible mushrooms: Improving human health and promoting quality life. Int. J. Microbiol. 2015, 2015, 376387. [Google Scholar] [CrossRef] [PubMed]
- Jiang, S.; Wang, Y.; Zhang, X. Comparative studies on extracts from Hericium erinaceus by different polarity reagents to gain higher antioxidant activities. Exp. Ther. Med. 2016, 12, 513–517. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, G.; Yu, K.; Li, F.; Xu, K.; Li, J.; He, S.; Cao, S.; Tan, G. Anticancer potential of Hericium erinaceus extracts against human gastrointestinal cancers. J. Ethnopharmacol. 2014, 153, 521–530. [Google Scholar] [CrossRef]
- Nagai, K.; Chiba, A.; Nishino, T.; Kubota, T.; Kawagishi, H. Dilinoleoyl-phosphatidylethanolamine from Hericium erinaceum protects against ER stress-dependent Neuro2a cell death via protein kinase C pathway. J. Nutr. Biochem. 2006, 17, 525–530. [Google Scholar] [CrossRef]
- Kawagishi, H. Chapter 11—Biologically Functional Compounds from Mushroom-Forming Fungi. In Natural Products and Drug Discovery; Mandal, S.C., Mandal, V., Konishi, T., Eds.; Elsevier: Amsterdam, Netherlands, 2018. [Google Scholar]
- Zhao, H.-B.; Lin, S.-Q.; Liu, J.-H.; Lin, Z.-B. Polysaccharide Extract Isolated from Ganoderma lucidum Protects Rat Cerebral Cortical Neurons from Hypoxia/Reoxygenation Injury. J. Pharmacol. Sci. 2004, 95, 294–298. [Google Scholar] [CrossRef] [Green Version]
- Choi, J.H.; Kikuchi, A.; Pumkaeo, P.; Hirai, H.; Tokuyama, S.; Kawagishi, H. Bioconversion of AHX to AOH by resting cells of Burkholderia contaminans CH-1. Biosci. Biotechnol. Biochem. 2016, 80, 2045–2050. [Google Scholar] [CrossRef] [Green Version]
- Kawagishi, H.; Shimada, A.; Shirai, R.; Okamoto, K.; Ojima, F.; Sakamoto, H.; Ishiguro, Y.; Furukawa, S. Erinacines A, B and C, strong stimulators of nerve growth factor (NGF)-synthesis, from the mycelia of Hericium erinaceum. Tetrahedron Lett. 1994, 35, 1569–1572. [Google Scholar] [CrossRef]
- Kawagishi, H.; Ando, M.; Sakamoto, H.; Yoshida, S.; Ojima, F.; Ishiguro, Y.; Ukai, N.; Furukawa, S. Hericenones C, D and E, stimulators of nerve growth factor (NGF)-synthesis, from the mushroom Hericium erinaceum. Tetrahedron Lett. 1991, 32, 4561–4564. [Google Scholar] [CrossRef]
- Hirata, Y.; Nakanishi, K. Grifolin, an antibiotic from a basidiomycete. J. Biol. Chem. 1950, 184, 135–143. [Google Scholar] [PubMed]
- Sugiyama, K.; Tanaka, A.; Kawagishi, H.; Ojima, F.; Sakamoto, H.; Ishiguro, Y. Hypocholesterolemic Action of Dietary Grifolin on Rats Fed with a High-cholesterol Diet. Biosci. Biotechnol. Biochem. 1994, 58, 211–212. [Google Scholar] [CrossRef] [PubMed]
- Connor, K.M.; Krah, N.M.; Dennison, R.J.; Aderman, C.M.; Chen, J.; Guerin, K.I.; Sapieha, P.; Stahl, A.; Willett, K.L.; Smith, L.E.H. Quantification of oxygen-induced retinopathy in the mouse: A model of vessel loss, vessel regrowth and pathological angiogenesis. Nat. Protoc. 2009, 4, 1565–1573. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Robinson, A.; Keely, S.; Karhausen, J.; Gerich, M.E.; Furuta, G.T.; Colgan, S.P. Mucosal protection by hypoxia-inducible factor prolyl hydroxylase inhibition. Gastroenterology 2008, 134, 145–155. [Google Scholar] [CrossRef] [Green Version]
- Malek, G.; Busik, J.; Grant, M.B.; Choudhary, M. Models of retinal diseases and their applicability in drug discovery. Expert Opin. Drug Discov. 2018, 13, 359–377. [Google Scholar] [CrossRef]
- Hellinen, L.; Hagström, M.; Knuutila, H.; Ruponen, M.; Urtti, A.; Reinisalo, M. Characterization of artificially re-pigmented ARPE-19 retinal pigment epithelial cell model. Sci. Rep. 2019, 9, 13761. [Google Scholar] [CrossRef]
- Sayyad, Z.; Sirohi, K.; Radha, V.; Swarup, G. 661W is a retinal ganglion precursor-like cell line in which glaucoma-associated optineurin mutants induce cell death selectively. Sci. Rep. 2017, 7, 16855. [Google Scholar] [CrossRef] [Green Version]
- Ibuki, M.; Shoda, C.; Miwa, Y.; Ishida, A.; Tsubota, K.; Kurihara, T. Lactoferrin Has a Therapeutic Effect via HIF Inhibition in a Murine Model of Choroidal Neovascularization. Front. Pharmacol. 2020, 11. [Google Scholar] [CrossRef] [Green Version]
- Mitchinson, A. Fairy chemicals. Nature 2014, 505, 298. [Google Scholar] [CrossRef]
- Kawagishi, H. Are fairy chemicals a new family of plant hormones? Proc. Jpn Acad. Ser. B Phys. Biol. Sci. 2019, 95, 29–38. [Google Scholar] [CrossRef] [Green Version]
- Shantz, H.L. Plant Succession on Abandoned Roads in Eastern Colorado. J. Ecol. 1917, 5, 19–42. [Google Scholar] [CrossRef] [Green Version]
- Kawagishi, H. Fairy chemicals —A candidate for a new family of plant hormones and possibility of practical use in agriculture. Biosci. Biotechnol. Biochem. 2018, 82, 752–758. [Google Scholar] [CrossRef] [PubMed]
- Asai, T.; Choi, J.-H.; Ikka, T.; Fushimi, K.; Abe, N.; Tanaka, H.; Yamakawa, Y.; Kobori, H.; Kiriiwa, Y.; Motohashi, R.; et al. Effect of 2-Azahypoxanthine (AHX) Produced by the Fairy-Ring-Forming Fungus on the Growth and the Grain Yield of Rice. Jpn. Agric. Res. Q. Jarq 2015, 49, 45–49. [Google Scholar] [CrossRef] [Green Version]
- Choi, J.-H.; Fushimi, K.; Abe, N.; Tanaka, H.; Maeda, S.; Morita, A.; Hara, M.; Motohashi, R.; Matsunaga, J.; Eguchi, Y.; et al. Disclosure of the “Fairy” of Fairy-Ring-Forming Fungus Lepista sordida. Chem. Bio. Chem. 2010, 11, 1373–1377. [Google Scholar] [CrossRef]
- Vaughan, K.; Wilman, D.E.V.; Wheelhouse, R.T.; Stevens, M.F.G. A 15N NMR investigation of a series of benzotriazinones and related antitumour heterocycles. Magn. Reson. Chem. 2002, 40, 300–302. [Google Scholar] [CrossRef]
- Lee Bennett, L.; Smithers, D.; Rose, L.M.; Adamson, D.J.; Shaddix, S.C.; Thomas, H.J. Metabolism and metabolic effects of 2-azahypoxanthine and 2-azaadenosine. Biochem. Pharmacol. 1985, 34, 1293–1304. [Google Scholar] [CrossRef]
- Lee Bennett, L.; Allan, P.W.; Carpenter, J.W.; Hill, D.L. Nucleosides of 2-aza-purines—Cytotoxicities and activities as substrates for enzymes metabolizing purine nucleosides. Biochem. Pharmacol. 1976, 25, 517–521. [Google Scholar] [CrossRef]
- Krock, B.L.; Skuli, N.; Simon, M.C. Hypoxia-induced angiogenesis: Good and evil. Genes Cancer 2011, 2, 1117–1133. [Google Scholar] [CrossRef] [Green Version]
- Yoshida, T.; Zhang, H.; Iwase, T.; Shen, J.; Semenza, G.L.; Campochiaro, P.A. Digoxin inhibits retinal ischemia-induced HIF-1alpha expression and ocular neovascularization. FASEB J. 2010, 24, 1759–1767. [Google Scholar] [CrossRef] [Green Version]
- Wu, J.; Ke, X.; Wang, W.; Zhang, H.; Ma, N.; Fu, W.; Zhao, M.; Gao, X.; Hao, X.; Zhang, Z. Aloe-emodin suppresses hypoxia-induced retinal angiogenesis via inhibition of HIF-1α/VEGF pathway. Int. J. Biol. Sci. 2016, 12, 1363–1371. [Google Scholar] [CrossRef] [Green Version]
- Zeng, M.; Shen, J.; Liu, Y.; Lu, L.Y.; Ding, K.; Fortmann, S.D.; Khan, M.; Wang, J.; Hackett, S.F.; Semenza, G.L.; et al. The HIF-1 antagonist acriflavine: Visualization in retina and suppression of ocular neovascularization. J. Mol. Med. (Berl.) 2017, 95, 417–429. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Scott, A.; Fruttiger, M. Oxygen-induced retinopathy: A model for vascular pathology in the retina. Eye 2010, 24, 416–421. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hawkins, B.T.; Davis, T.P. The Blood-Brain Barrier/Neurovascular Unit in Health and Disease. Pharmacol. Rev. 2005, 57, 173. [Google Scholar] [CrossRef] [PubMed]
- Yu, X.; Ji, C.; Shao, A. Neurovascular Unit Dysfunction and Neurodegenerative Disorders. Front. Neurosci. 2020, 14. [Google Scholar] [CrossRef]
- Rattner, A.; Williams, J.; Nathans, J. Roles of HIFs and VEGF in angiogenesis in the retina and brain. J. Clin. Investig. 2019, 129, 3807–3820. [Google Scholar] [CrossRef]
- Weidemann, A.; Krohne, T.U.; Aguilar, E.; Kurihara, T.; Takeda, N.; Dorrell, M.I.; Simon, M.C.; Haase, V.H.; Friedlander, M.; Johnson, R.S. Astrocyte hypoxic response is essential for pathological but not developmental angiogenesis of the retina. Glia 2010, 58, 1177–1185. [Google Scholar] [CrossRef] [Green Version]
- Korovina, I.; Neuwirth, A.; Sprott, D.; Weber, S.; Sardar Pasha, S.P.B.; Gercken, B.; Breier, G.; El-Armouche, A.; Deussen, A.; Karl, M.O.; et al. Hematopoietic hypoxia-inducible factor 2α deficiency ameliorates pathological retinal neovascularization via modulation of endothelial cell apoptosis. FASEB J. 2019, 33, 1758–1770. [Google Scholar] [CrossRef]
- Chen, G.; Ray, R.; Dubik, D.; Shi, L.; Cizeau, J.; Bleackley, R.C.; Saxena, S.; Gietz, R.D.; Greenberg, A.H. The E1B 19K/Bcl-2-binding protein Nip3 is a dimeric mitochondrial protein that activates apoptosis. J. Exp. Med. 1997, 186, 1975–1983. [Google Scholar] [CrossRef] [Green Version]
- Bruick, R.K. Expression of the gene encoding the proapoptotic Nip3 protein is induced by hypoxia. Proc. Natl. Acad. Sci. 2000, 97, 9082. [Google Scholar] [CrossRef] [Green Version]
- Richard, D.E.; Berra, E.; Gothié, E.; Roux, D.; Pouysségur, J. p42/p44 mitogen-activated protein kinases phosphorylate hypoxia-inducible factor 1alpha (HIF-1alpha) and enhance the transcriptional activity of HIF-1. J. Biol. Chem. 1999, 274, 32631–32637. [Google Scholar] [CrossRef] [Green Version]
- Metukuri, M.R.; Beer-Stolz, D.; Namas, R.A.; Dhupar, R.; Torres, A.; Loughran, P.A.; Jefferson, B.S.; Tsung, A.; Billiar, T.R.; Vodovotz, Y.; et al. Expression and subcellular localization of BNIP3 in hypoxic hepatocytes and liver stress. Am. J. Physiol. -Gastrointest. Liver Physiol. 2009, 296, G499–G509. [Google Scholar] [CrossRef] [PubMed]
- Namas, R.A.; Metukuri, M.R.; Dhupar, R.; Velosa, C.; Jefferson, B.S.; Myer, E.; Constantine, G.M.; Billiar, T.R.; Vodovotz, Y.; Zamora, R. Hypoxia-induced overexpression of BNIP3 is not dependent on hypoxia-inducible factor 1α in mouse hepatocytes. Shock 2011, 36, 196–202. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grunwald, J.E.; Daniel, E.; Huang, J.; Ying, G.-S.; Maguire, M.G.; Toth, C.A.; Jaffe, G.J.; Fine, S.L.; Blodi, B.; Klein, M.L.; et al. Risk of geographic atrophy in the comparison of age-related macular degeneration treatments trials. Ophthalmology 2014, 121, 150–161. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saint-Geniez, M.; Maharaj, A.S.R.; Walshe, T.E.; Tucker, B.A.; Sekiyama, E.; Kurihara, T.; Darland, D.C.; Young, M.J.; D’Amore, P.A. Endogenous VEGF Is Required for Visual Function: Evidence for a Survival Role on Müller Cells and Photoreceptors. PLoS ONE 2008, 3, e3554. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ikeuchi, K.; Fujii, R.; Sugiyama, S.; Asakawa, T.; Inai, M.; Hamashima, Y.; Choi, J.H.; Suzuki, T.; Kawagishi, H.; Kan, T. Practical synthesis of natural plant-growth regulator 2-azahypoxanthine, its derivatives, and biotin-labeled probes. Org. Biomol. Chem. 2014, 12, 3813–3815. [Google Scholar] [CrossRef] [Green Version]
- Choi, J.H.; Ohnishi, T.; Yamakawa, Y.; Takeda, S.; Sekiguchi, S.; Maruyama, W.; Yamashita, K.; Suzuki, T.; Morita, A.; Ikka, T.; et al. The source of “fairy rings”: 2-azahypoxanthine and its metabolite found in a novel purine metabolic pathway in plants. Angew. Chem. (Int. Ed. Engl.) 2014, 53, 1552–1555. [Google Scholar] [CrossRef]
- Takemura, H.; Choi, J.-H.; Matsuzaki, N.; Taniguchi, Y.; Wu, J.; Hirai, H.; Motohashi, R.; Asakawa, T.; Ikeuchi, K.; Inai, M.; et al. A Fairy Chemical, Imidazole-4-carboxamide, is Produced on a Novel Purine Metabolic Pathway in Rice. Sci. Rep. 2019, 9, 9899. [Google Scholar] [CrossRef]
- Giovannitti, J.A.; Trapp, L.D. Adult sedation: Oral, rectal, IM, IV. Anesth. Prog. 1991, 38, 154–171. [Google Scholar]
Name | Direction | Sequence (5′ → 3′) | Accession Number |
---|---|---|---|
Hprt | Forward | TCAGTCAACGGGGGACATAAA | NM_013556.2 |
Reverse | GGGGCTGTACTGCTTAACCAG | ||
Hif-1α | Forward | GGTTCCAGCAGACCCAGTTA | NM_001313919.1 |
Reverse | AGGCTCCTTGGATGAGCTTT | ||
Hif-2α | Forward | CTGAGGAAGGAGAAATCCCGT | NM_010137.3 |
Reverse | TGTGTCCGAAGGAAGCTGATG | ||
Vegf | Forward | CCTGGTGGACATCTTCCAGGAGTACC | AY707864.1 |
Reverse | GAAGCTCATCTCTCCTATGTGCTGGC | ||
Bnip3 | Forward | GCTCCCAGACACCACAAGAT | NM_009760.4 |
Reverse | TGAGAGTAGCTGTGCGCTTC | ||
Pdk1 | Forward | GGCGGCTTTGTGATTTGTAT | NM_172665.5 |
Reverse | ACCTGAATCGGGGGATAAAC |
Name | 1st Trial in 3T3 | 2nd Trial in ARPE-19 | 3rd Trial in 661W | |||
---|---|---|---|---|---|---|
Fold Change ± SD | p-Value | Fold Change ± SD | p-Value | Fold Change ± SD | p-Value | |
Topotecan | 0.96 ± 0.26 | 0.855 | 0.84 ± 0.01 | 0.002 ** | 0.81 ± 0.11 | 0.074 |
Doxorubicin | 0.30 ± 0.06 | 0.014 * | 1.10 ± 0.09 | 0.135 | 0.71 ± 0.05 | 0.006 ** |
AHX | 0.39 ± 0.06 | 0.021 * | 0.39 ± 0.03 | <0.001 *** | 0.42 ± 0.07 | 0.001 ** |
AOH | 0.35 ± 0.03 | 0.016 * | 0.93 ± 0.04 | 0.091 | 0.85 ± 0.08 | 0.086 |
ICA | 1.02 ± 0.32 | 0.939 | ||||
Erinacine A | 1.50 ± 0.16 | 0.054 | ||||
Hericenone C | 1.25 ± 0.11 | 0.224 | ||||
Hericenone D | 0.79 ± 0.04 | 0.276 | ||||
Hericenone E | 0.67 ± 0.04 | 0.115 | ||||
Grifolin | 0.76 ± 0.06 | 0.223 | ||||
Negrifolin | 0.82 ± 0.03 | 0.338 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, D.; Miwa, Y.; Wu, J.; Shoda, C.; Jeong, H.; Kawagishi, H.; Tsubota, K.; Kurihara, T. A Fairy Chemical Suppresses Retinal Angiogenesis as a HIF Inhibitor. Biomolecules 2020, 10, 1405. https://doi.org/10.3390/biom10101405
Lee D, Miwa Y, Wu J, Shoda C, Jeong H, Kawagishi H, Tsubota K, Kurihara T. A Fairy Chemical Suppresses Retinal Angiogenesis as a HIF Inhibitor. Biomolecules. 2020; 10(10):1405. https://doi.org/10.3390/biom10101405
Chicago/Turabian StyleLee, Deokho, Yukihiro Miwa, Jing Wu, Chiho Shoda, Heonuk Jeong, Hirokazu Kawagishi, Kazuo Tsubota, and Toshihide Kurihara. 2020. "A Fairy Chemical Suppresses Retinal Angiogenesis as a HIF Inhibitor" Biomolecules 10, no. 10: 1405. https://doi.org/10.3390/biom10101405
APA StyleLee, D., Miwa, Y., Wu, J., Shoda, C., Jeong, H., Kawagishi, H., Tsubota, K., & Kurihara, T. (2020). A Fairy Chemical Suppresses Retinal Angiogenesis as a HIF Inhibitor. Biomolecules, 10(10), 1405. https://doi.org/10.3390/biom10101405