Effects of Different Photoperiods on Peripheral 5-Hydroxytryptamine Metabolism, Breast Muscle Glucose Metabolism, and Myopathies in Broilers
Abstract
:1. Introduction
2. Materials and Methods
2.1. Birds and Housing
2.2. Diets and Feeding Program
2.3. Sample Collection
2.4. Growth Performance
2.5. White Striping and Wooden Breast Score
2.6. Peripheral 5-HT Concentrations Analysis of the Serum, Cecal Mucosa, and Breast Muscle
2.7. Glucose Metabolism Analysis of the Breast Muscle
2.8. Total RNA Extraction and Reverse Transcription Analysis and Quantitative Real-Time PCR
2.9. Statistical Analysis
3. Results
3.1. Effects of Different Photoperiods on Growth Performance in Broilers
3.2. Effects of Different Photoperiods on White Striping and Wooden Breast Score in the Breast Muscle of Broilers
3.3. Effects of Different Photoperiods on Glucose Metabolism in the Breast Muscle of Broilers
3.4. Effects of Different Photoperiods on Peripheral 5-HT Metabolism of Broilers
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tijare, V.V.; Yang, F.L.; Kuttappan, V.A.; Alvarado, C.Z.; Coon, C.N.; Owens, C.M. Meat quality of broiler breast fillets with white striping and woody breast muscle myopathies. Poult. Sci. 2016, 95, 2167–2173. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.J.; Son, J.; Jeon, J.J.; Kim, H.S.; Yun, Y.S.; Kang, H.K.; Hong, E.C.; Kim, J.H. Effects of Photoperiod on the Performance, Blood Profile, Welfare Parameters, and Carcass Characteristics in Broiler Chickens. Animals 2022, 12, 2290. [Google Scholar] [CrossRef] [PubMed]
- Olanrewaju, H.A.; Purswell, J.L.; Collier, S.D.; Branton, S.L. Interactive effects of photoperiod and light intensity on blood physiological and biochemical reactions of broilers grown to heavy weights. Poult. Sci. 2013, 92, 1029–1039. [Google Scholar] [CrossRef] [PubMed]
- Jiang, S.; Fu, Y.; Cheng, H.W. Daylight exposure and circadian clocks in broilers: Part I-photoperiod effect on broiler behavior, skeletal health, and fear response. Poult. Sci. 2023, 102, 103162. [Google Scholar] [CrossRef]
- Malila, Y.; Juthawut, U.; Srimarut, Y.; Chaiwiwattrakul, P.; Uengwetwanit, T.; Arayamethakorn, S.; Punyapornwithaya, V.; Sansamur, C.; Kirschke, C.P.; Huang, L.; et al. Monitoring of white striping and wooden breast cases and impacts on quality of breast meat collected from commercial broilers (Gallus gallus). Asian-Australas J. Anim. Sci. 2018, 31, 1807–1817. [Google Scholar] [CrossRef]
- Bowker, B.; Zhuang, H.; Yoon, S.C.; Tasoniero, G.; Lawrence, K. Relationships Between Attributes of Woody Breast and White Striping Myopathies in Commercially Processed Broiler Breast Meat1. J. Appl. Poult. Res. 2019, 28, 490–496. [Google Scholar] [CrossRef]
- Meloche, K.J.; Fancher, B.I.; Emmerson, D.A.; Bilgili, S.F.; Dozier, W.A. Effects of quantitative nutrient allocation on myopathies of the Pectoralis major muscles in broiler chickens at 32, 43, and 50 days of age1 1Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by Auburn University. Poult. Sci. 2018, 97, 1786–1793. [Google Scholar] [CrossRef]
- Malila, Y.; Thanatsang, K.; Arayamethakorn, S.; Uengwetwanit, T.; Srimarut, Y.; Petracci, M.; Strasburg, G.M.; Rungrassamee, W.; Visessanguan, W. Absolute expressions of hypoxia-inducible factor-1 alpha (HIF1A) transcript and the associated genes in chicken skeletal muscle with white striping and wooden breast myopathies. PLoS ONE 2019, 14, e0220904. [Google Scholar] [CrossRef]
- Papah, M.B.; Brannick, E.M.; Schmidt, C.J.; Abasht, B. Gene expression profiling of the early pathogenesis of wooden breast disease in commercial broiler chickens using RNA-sequencing. PLoS ONE 2018, 13, e0207346. [Google Scholar] [CrossRef]
- Gratta, F.; Bošković Cabrol, M.; Xiccato, G.; Birolo, M.; Bordignon, F.; Trocino, A. Effect of light restriction on productive results and behavior of broiler chickens. Poult. Sci. 2023, 102, 103084. [Google Scholar] [CrossRef]
- Song, L.; He, M.; Sun, Q.; Wang, Y.; Zhang, J.; Fang, Y.; Liu, S.; Duan, L. Roseburia hominis Increases Intestinal Melatonin Level by Activating p-CREB-AANAT Pathway. Nutrients 2021, 14, 117. [Google Scholar] [CrossRef] [PubMed]
- Bubenik, G.A. Localization, physiological significance and possible clinical implication of gastrointestinal melatonin. Biol. Signals Recept. 2001, 10, 350–366. [Google Scholar] [CrossRef] [PubMed]
- do Amaral, F.G.; Cipolla-Neto, J. A brief review about melatonin, a pineal hormone. Arch. Endocrinol. Metab. 2018, 62, 472–479. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Li, X.; Wang, K.; Li, Y.; Nagaoka, K.; Li, C. Gut microbiota intervention attenuates thermogenesis in broilers exposed to high temperature through modulation of the hypothalamic 5-HT pathway. J. Anim. Sci. Biotechnol. 2023, 14, 159. [Google Scholar] [CrossRef]
- Kostal, L.; Savory, C.J. Behavioral responses of restricted-fed fowls to pharmacological manipulation of 5-HT and GABA receptor subtypes. Pharmacol. Biochem. Behav. 1996, 53, 995–1004. [Google Scholar] [CrossRef]
- Lee, B.; Choi, Y.M. Association of Serum Glucose, Serotonin, Aspartate Aminotransferase, and Calcium Levels with Meat Quality and Palatability Characteristics of Broiler Pectoralis Major Muscle. Animals 2022, 12, 1567. [Google Scholar] [CrossRef]
- Ayo, J.O.; Makeri, H.K.; Minka, N.S.; Aluwong, T. Circadian rhythms of biomarkers of oxidative stress and their characteristics in broiler chickens reared under natural light/dark cycle. Biol. Rhythm Res. 2018, 49, 119–127. [Google Scholar] [CrossRef]
- Das, H.; Lacin, E. The Effect of Different Photoperiods and Stocking Densities on Fattening Performance, Carcass and Some Stress Parameters in Broilers. Isr. J. Vet. Med. 2014, 69, 211–220. [Google Scholar]
- Lyte, J.M.; Martinez, D.A.; Robinson, K.; Donoghue, A.M.; Daniels, K.M.; Lyte, M. A neurochemical biogeography of the broiler chicken intestinal tract. Poult. Sci. 2022, 101, 101671. [Google Scholar] [CrossRef]
- Lyte, J.M.; Eckenberger, J.; Keane, J.; Robinson, K.; Bacon, T.; Assumpcao, A.L.F.; Donoghue, A.M.; Liyanage, R.; Daniels, K.M.; Caputi, V.; et al. Cold stress initiates catecholaminergic and serotonergic responses in the chicken gut that are associated with functional shifts in the microbiome. Poult. Sci. 2024, 103, 103393. [Google Scholar] [CrossRef]
- Agus, A.; Planchais, J.; Sokol, H. Gut Microbiota Regulation of Tryptophan Metabolism in Health and Disease. Cell Host Microbe 2018, 23, 716–724. [Google Scholar] [CrossRef] [PubMed]
- Hannon, J.; Hoyer, D. Molecular biology of 5-HT receptors. Behav. Brain Res. 2008, 195, 198–213. [Google Scholar] [CrossRef]
- Abasht, B.; Mutryn, M.F.; Michalek, R.D.; Lee, W.R. Oxidative Stress and Metabolic Perturbations in Wooden Breast Disorder in Chickens. PLoS ONE 2016, 11, e0153750. [Google Scholar] [CrossRef] [PubMed]
- Abasht, B.; Zhou, N.; Lee, W.R.; Zhuo, Z.; Peripolli, E. The metabolic characteristics of susceptibility to wooden breast disease in chickens with high feed efficiency. Poult. Sci. 2019, 98, 3246–3256. [Google Scholar] [CrossRef] [PubMed]
- Hajduch, E.; Rencurel, F.; Balendran, A.; Batty, I.H.; Downes, C.P.; Hundal, H.S. Serotonin (5-Hydroxytryptamine), a novel regulator of glucose transport in rat skeletal muscle. J. Biol. Chem. 1999, 274, 13563–13568. [Google Scholar] [CrossRef]
- Coelho, W.S.; Costa, K.C.; Sola-Penna, M. Serotonin stimulates mouse skeletal muscle 6-phosphofructo-1-kinase through tyrosine-phosphorylation of the enzyme altering its intracellular localization. Mol. Genet. Metab. 2007, 92, 364–370. [Google Scholar] [CrossRef]
- Watanabe, H.; Nakano, T.; Saito, R.; Akasaka, D.; Saito, K.; Ogasawara, H.; Minashima, T.; Miyazawa, K.; Kanaya, T.; Takakura, I.; et al. Serotonin Improves High Fat Diet Induced Obesity in Mice. PLoS ONE 2016, 11, e0147143. [Google Scholar] [CrossRef]
- Acres, A. Broiler Management Handbook; Aviagen: Huntsville, AL, USA, 2018. [Google Scholar]
- Xu, M.; Zhao, X.; Yu, M.; Wang, G.; Feng, J.; Zhang, M. The amino acid pattern and dynamics of body protein, body fat deposition in male and female broilers under different temperatures. Poult. Sci. 2024, 103, 103525. [Google Scholar] [CrossRef]
- Aviagen. Arbor Acres Broiler Nutrition Specifications 2019; Aviagen: Huntsville, AL, USA, 2019; pp. 3–5. [Google Scholar]
- Baykalir, Y.; Simsek, U.G.; Erisir, M.; Otlu, O.; Gungoren, G.; Gungoren, A.; Aslan, S. Photoperiod effects on carcass traits, meat quality, and stress response in heart and lung of broilers. South Afr. J. Anim. Sci. 2020, 50, 138–149. [Google Scholar] [CrossRef]
- Lewis, P.D.; Danisman, R.; Gous, R.M. Photoperiodic responses of broilers. I. Growth, feeding behaviour, breast meat yield, and testicular growth. Br. Poult. Sci. 2009, 50, 657–666. [Google Scholar] [CrossRef]
- Lien, R.J.; Hess, J.B.; McKee, S.R.; Bilgili, S.F.; Townsend, J.C. Effect of light intensity and photoperiod on live performance, heterophil-to-lymphocyte ratio, and processing yields of broilers. Poult. Sci. 2007, 86, 1287–1293. [Google Scholar] [CrossRef] [PubMed]
- Moraes, D.T.; Lara, L.J.C.; Baiao, N.C.; Cançado, S.V.; Gonzalez, M.L.; Aguilar, C.A.L.; Lana, A.M.Q. Effect of lighting programs on performance, carcass yield, and immunological response of broiler chickens. Arq. Bras. Med. Vet. E Zootec. 2008, 60, 201–208. [Google Scholar] [CrossRef]
- El-Sagheer, M.; Makled, M.N.; Mohamed, M.A. Effect of different lighting programmes on broiler performance. Egypt. Poult. Sci. J. 2004, 24, 737–750. [Google Scholar]
- Tuell, J.R.; Park, J.Y.; Wang, W.; Cooper, B.; Sobreira, T.; Cheng, H.W.; Kim, Y.H.B. Effects of Photoperiod Regime on Meat Quality, Oxidative Stability, and Metabolites of Postmortem Broiler Fillet (M. Pectoralis major) Muscles. Foods 2020, 9, 215. [Google Scholar] [CrossRef]
- Xirouchaki, C.E.; Mangiafico, S.P.; Bate, K.; Ruan, Z.; Huang, A.M.; Tedjosiswoyo, B.W.; Lamont, B.; Pong, W.; Favaloro, J.; Blair, A.R.; et al. Impaired glucose metabolism and exercise capacity with muscle-specific glycogen synthase 1 (gys1) deletion in adult mice. Mol. Metab. 2016, 5, 221–232. [Google Scholar] [CrossRef]
- Tashiro, A.; Shibata, S.; Takai, Y.; Uchiwa, T.; Furuse, M.; Yasuo, S. Changes in photoperiod alter Glut4 expression in skeletal muscle of C57BL/6J mice. Biochem. Biophys. Res. Commun. 2017, 485, 82–88. [Google Scholar] [CrossRef]
- Mariné-Casadó, R.; Domenech-Coca, C.; Del Bas, J.M.; Bladé, C.; Arola, L.; Caimari, A. Intake of an Obesogenic Cafeteria Diet Affects Body Weight, Feeding Behavior, and Glucose and Lipid Metabolism in a Photoperiod-Dependent Manner in F344 Rats. Front. Physiol. 2018, 9, 1639. [Google Scholar] [CrossRef]
- Mariné-Casadó, R.; Domenech-Coca, C.; Del Bas, J.M.; Bladé, C.; Arola, L.; Caimari, A. The Exposure to Different Photoperiods Strongly Modulates the Glucose and Lipid Metabolisms of Normoweight Fischer 344 Rats. Front. Physiol. 2018, 9, 416. [Google Scholar] [CrossRef]
- O’Brien, C.; Beaubien-Souligny, W.; Amsallem, M.; Denault, A.; Haddad, F. Cardiogenic Shock: Reflections at the Crossroad Between Perfusion, Tissue Hypoxia, and Mitochondrial Function. Can. J. Cardiol. 2020, 36, 184–196. [Google Scholar] [CrossRef]
- Soglia, F.; Petracci, M.; Davoli, R.; Zappaterra, M. A critical review of the mechanisms involved in the occurrence of growth-related abnormalities affecting broiler chicken breast muscles. Poult. Sci. 2021, 100, 101180. [Google Scholar] [CrossRef]
- Walk, C.L.; Mullenix, G.J.; Maynard, C.W.; Greene, E.S.; Maynard, C.; Ward, N.; Dridi, S. Novel 4th-generation phytase improves broiler growth performance and reduces woody breast severity through modulation of muscle glucose uptake and metabolism. Front. Physiol. 2024, 15, 1376628. [Google Scholar] [CrossRef]
- Przybylski, W.; Sałek, P.; Kozłowska, L.; Jaworska, D.; Stańczuk, J. Metabolomic analysis indicates that higher drip loss may be related to the production of methylglyoxal as a by-product of glycolysis. Poult. Sci. 2022, 101, 101608. [Google Scholar] [CrossRef] [PubMed]
- Cai, L.; Wang, X.; Zhu, X.; Xu, Y.; Qin, W.; Ren, J.; Jiang, Q.; Yan, X. Lactobacillus-derived protoporphyrin IX and SCFAs regulate the fiber size via glucose metabolism in the skeletal muscle of chickens. mSystems 2024, 9, e0021424. [Google Scholar] [CrossRef] [PubMed]
Items | 5–7 d | 8–22 d | 23–33 d |
---|---|---|---|
Ingredient | Content (%) | ||
Corn | 51.44 | 54.08 | 56.85 |
Soybean meal | 40.21 | 36.82 | 33.86 |
Soybean oil | 3.94 | 5.00 | 5.50 |
Limestone | 1.00 | 0.85 | 0.90 |
CaHPO4 | 1.89 | 1.80 | 1.50 |
NaCl | 0.30 | 0.30 | 0.30 |
DL-Methionine | 0.21 | 0. 19 | 0.19 |
L-Lysine | 0.36 | 0.32 | 0.30 |
L-Threonine | 0. 15 | 0. 14 | 0.10 |
Premix 1 | 0.50 | 0.50 | 0.50 |
Total | 100 | 100 | 100 |
Nutrient levels 2 | |||
ME/(MJ/Kg) | 2961 | 3038 | 3095 |
CP (%) | 22. 55 | 21.18 | 19.97 |
CF (%) | 10.54 | 10.38 | 11.35 |
Ca (%) | 0.94 | 0.85 | 0.79 |
AP (%) | 0.43 | 0.41 | 0.35 |
Lysine (%) | 1.46 | 1.34 | 1.25 |
Methionine (%) | 0.54 | 0.51 | 0.49 |
Methionine + cysteine (%) | 0.92 | 0.87 | 0.84 |
Gene | Primer Sequence (5′-3′) | Product Length (bp) | Gene Bank Number |
---|---|---|---|
GAPDH | F: ACTTTGGCATTGTGGAGGGTR: GGACGCTGGGATGATGTTCT | 188 | NM_204305.1 |
5-HTR2A | F: TGTCATGCCCGTGTCAATGTR: AGTGGAGAAAAGCACGTCCA | 127 | NM_001318420.2 |
TPH1 | F: ATGTCTATCGTAAGAGGCGAAAGTAR: TTGGTGAGCAAGGGCAAGTTT | 190 | NM_204956.2 |
SERT | F: TCTTCTACTACCTCGTGTCCTCCTTR: GCGGGTATAAAATTCTTCTGCA | 155 | NM_213572.1 |
MAOA | F: GCTGCCAAGTTGCTGTATGAGTATR: TCACTTTATAGGTCTCAATGCCCAG | 193 | NM_001030799.2 |
Item | 12L:12D | 18L:6D | 24L:0D | SEM | p Value |
---|---|---|---|---|---|
Week 0–2 | |||||
Average body weight/g | 679.56 b | 781.89 a | 794.21 a | 12.89 | <0.05 |
Breast muscle weight/g | 50.35 b | 62.81 a | 66.43 a | 1.89 | <0.05 |
Breast muscle ratio/% | 7.31 c | 7.89 b | 8.51 a | 0.15 | <0.05 |
Feed intake per broiler/g | 631.11 | 744.95 | 911.46 | 28.34 | <0.05 |
Week 2–4 | |||||
Average body weight gain/g | 1276.44 b | 1414.10 a | 1421.39 a | 18.48 | <0.05 |
Breast muscle weight gain/g | 153.85 b | 173.83 a | 182.60 a | 3.99 | <0.05 |
Breast muscle weight gain ratio/% | 12.13 | 12.43 | 12.72 | 0.22 | 0.576 |
Feed intake per broiler/g | 1589.74 | 1921.81 | 2129.4 | 55.17 | <0.05 |
Week 0–4 | |||||
Average body weight/g | 1956.00 b | 2195.99 a | 2215.60 a | 27.91 | <0.05 |
Breast muscle mass/g | 204.20 b | 236.65 a | 249.03 a | 5.32 | <0.05 |
Breast muscle mass/body mass ratio/% | 10.44 b | 10.78 ab | 11.24 a | 0.16 | 0.109 |
Feed intake per broiler/g | 2188.11 | 2623.27 | 2841.93 | 67.18 | <0.05 |
Item | 12L:12D | 18L:6D | 24L:0D | SEM | p Value |
---|---|---|---|---|---|
Week 2 | |||||
White striping | 0.17 | 0.33 | 0.17 | 0.10 | 0.761 |
Wooden breast | 0.33 | 0.17 | 0.50 | 0.11 | 0.521 |
Week 4 | |||||
White striping | 0.50 | 0.50 | 0.33 | 0.15 | 0.827 |
Wooden breast | 0.33 b | 1.17 a | 1.50 a | 0.16 | <0.05 |
Item | 12L:12D | 18L:6D | 24L:0D | SEM | p Value |
---|---|---|---|---|---|
Week 0–2 | |||||
Muscle glycogen/mg/g | 5.59 a | 4.01 b | 2.88 c | 0.42 | <0.05 |
Lactic acid/mmol/g | 0.75 c | 1.02 ab | 1.31 a | 0.08 | <0.05 |
Pyruvate/μmol/mg | 0.19 c | 0.22 b | 0.27 a | 0.01 | <0.05 |
L/P | 4.01 b | 4.58 a | 4.76 a | 0.12 | <0.05 |
Week 0–4 | |||||
Muscle glycogen/mg/g | 5.31 c | 3.58 b | 2.49 a | 0.45 | <0.05 |
Lactic acid/mmol/g | 0.86 b | 1.38 a | 1.55 a | 0.11 | <0.05 |
Pyruvate/μmol/mg | 0.19 b | 0.27 a | 0.29 a | 0.02 | <0.05 |
L/P | 4.56 c | 5.13 b | 5.38 a | 0.14 | <0.05 |
Item | 12L:12D | 18L:6D | 24L:0D | SEM | p Value |
---|---|---|---|---|---|
Week 0–2 | |||||
Cecal mucosa/ng/mg | 3.03 c | 3.56 b | 4.58 a | 0.24 | <0.05 |
Serum/ng/mL | 19.03 b | 23.87 a | 26.58 a | 1.28 | <0.05 |
Breast muscle/ng/mg | 10.02 c | 14.19 b | 18.62 a | 1.31 | <0.05 |
Week 0–4 | |||||
Cecal mucosa/ng/mg | 2.87 c | 4.04 b | 4.83 a | 0.30 | <0.05 |
Serum/ng/mL | 21.35 b | 26.38 a | 28.92 a | 1.31 | <0.05 |
Breast muscle/ng/mg | 8.73 c | 16.73 b | 24.36 a | 1.49 | <0.05 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, M.; Xu, M.; Wang, G.; Feng, J.; Zhang, M. Effects of Different Photoperiods on Peripheral 5-Hydroxytryptamine Metabolism, Breast Muscle Glucose Metabolism, and Myopathies in Broilers. Metabolites 2024, 14, 567. https://doi.org/10.3390/metabo14100567
Yu M, Xu M, Wang G, Feng J, Zhang M. Effects of Different Photoperiods on Peripheral 5-Hydroxytryptamine Metabolism, Breast Muscle Glucose Metabolism, and Myopathies in Broilers. Metabolites. 2024; 14(10):567. https://doi.org/10.3390/metabo14100567
Chicago/Turabian StyleYu, Miao, Mengjie Xu, Guangju Wang, Jinghai Feng, and Minhong Zhang. 2024. "Effects of Different Photoperiods on Peripheral 5-Hydroxytryptamine Metabolism, Breast Muscle Glucose Metabolism, and Myopathies in Broilers" Metabolites 14, no. 10: 567. https://doi.org/10.3390/metabo14100567
APA StyleYu, M., Xu, M., Wang, G., Feng, J., & Zhang, M. (2024). Effects of Different Photoperiods on Peripheral 5-Hydroxytryptamine Metabolism, Breast Muscle Glucose Metabolism, and Myopathies in Broilers. Metabolites, 14(10), 567. https://doi.org/10.3390/metabo14100567