Persistent Inflammation, Maladaptive Remodeling, and Fibrosis in the Kidney Following Long COVID-like MHV-1 Mouse Model
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Model and Housing Conditions
2.2. MHV-1 Infection and SPIKENET Administration
2.3. Immunofluorescence
2.4. RNA Isolation and Quality Assessment
2.5. Library Preparation and Sequencing
2.6. RNA Sequence Analysis
2.7. Real-Time PCR
2.8. Statistical Analysis
3. Results
3.1. Immunofluorescence
3.2. mRNA Sequencing
3.2.1. Acute Infection
3.2.2. Long-COVID Infection
3.2.3. Long-COVID with SPIKENET
3.3. Altered Expressions of SLC Genes
3.4. qRT-PCR
4. Discussion
4.1. Cytokine Levels, Virus, and Viral Particles
4.2. Gene Alterations in Acute and Long-Term Kidney Injury
4.3. Changes in Solute Carrier (SLC) Genes
| SLC Gene | Subtype | Description | Associated Diseases | References |
|---|---|---|---|---|
| SLC2 | SLC2A6/GLUT6 | Glucose Transporters | Metabolic shift in macrophages | [44] |
| SLC4 | SLC4A7/NBCn1 | Sodium Bicarbonate Cotransporter | Phagosome acidification, pathogen clearance | [45] |
| SLC7 | SLC7A5/LAT1 SLC7A6/y+LAT1 SLC7A11/xCT | Amino acid Transporter | Renal damage /CKD/ Ferroptosis | [46,47] |
| SLC8 | SLC8A3/NCX3 | Na+/Ca2+ Exchanger | Fibrosis | [48] |
| SLC9 | SLC9A9 | Na+/H+ Exchanger | Disturbance in pH homeostasis | [49] |
| SLC10 | SLC10A7 | Orphan solute carrier | Reduced calcium influx | [50] |
| SLC16 | SLC16A1/MCT1 SLC16A3/MCT4 SLC16A14/MCT14 | Monocarboxylate transporter | Renal cancer | [51] |
| SLC25 | SLC25A24 | Mitochondrial solute transporter | Acute kidney injury | [52] |
| SLC38 | SLC38A1/SNAT1 | Neutral amino acid transporter | Ferroptosis-mediated CKD | [53] |
| SLC39 | SLC39A6/ZIP6 | Zinc transporter | Zinc accumulation | [54] |
| Gene | Subtype | Description | Pathology | References |
|---|---|---|---|---|
| SLC2 | SLC2A5/GLUT5 | Fructose Transporters | Fructose-induced hypertension | [55] |
| SLC5 | SLC5A6/SMVT SLC5A8/SMCT1 | Vitamin Transporter Lactate and monocarboxylate transporters | Kidney injury Loss of lactate Reabsorption | [56,57] |
| SLC12 | SLC12A1/NKCC2 | Na+-K+-Cl− cotransporter | Hypotension | [58] |
| SLC17 | SLC17A3/NPT4 | Urate transporter | Hyperurecemia | [59] |
| SLC22 | SLC22A2, SLC22A4,
SLC22A8/OAT3, SLC22A13/OAT10, SLC22A13B, SLC22A22, SLC22A28 | Cation/anion transporter | Elevated blood pressure and CKD | [60,61,62,63] |
| SLC23 | SLC23A1/SVCT1 | Vitamin C transporter | Renal leak of vitamin C, low hemoglobin | [64] |
| SLC34 | SLC34A3/NPT2c | Sodium/Phosphate Cotransporter | Hypophosphatemia | [65] |
| SLC38 | SLC38A3/SNAT3 | Neutral amino acid (Glutamine) transporter | Deficiency in renal ammonia and urea excretion | [66,67] |
| SLC47 | SLC47A1/MATE1 | Multidrug/toxin extrusion protein 1 | Drug toxicity | [68] |
| SLC51 | SLC51A/OSTα | Organic solute transporter α | Bile acid accumulation in the kidney | [69] |
4.4. Strength of the MHV-1 Model
4.5. Limitations
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| AKI | Acute kidney injury |
| Azgp1 | Zinc-binding glycoprotein |
| CAT | Cationic amino acid transporters |
| CKD | Chronic kidney disease |
| COVID-19 | Coronavirus Disease-2019 |
| DEGs | Differentially expressed genes |
| ESRD | End-stage renal disease |
| FDR | False discovery rate |
| FGB | Fibrinogen beta chain |
| GSH | Glutathione |
| LAT | L-type amino acid transporters |
| MCT | Monocarboxylate transporters |
| MHV-1 | Murine hepatitis virus-1 |
| NC | Nucleocapsid |
| NCX | Sodium-calcium exchanger |
| NGS | Next-generation sequencing |
| OAs | Organic anions |
| OATs | Organic anion transporters |
| OCs | Organic cations |
| OCT | Organic cation transporter |
| QC | Quality control |
| S1 protein | Spike 1 protein |
| SARS-CoV-2 | Severe acute respiratory syndrome coronavirus 2 |
| Serpina3k | Serine protease inhibitor |
| SLC | Solute carrier |
| SPK | Spikenet |
| TPM | Transcripts per million |
References
- Schiff, H.; Boudreau, E.A.; Smith, J.M.; Nguyen, T.; Alavi, A.; Patel, Y.; Brown, E.M.; Langlois, J.P. Long-term symptoms following COVID-19: A 12-month follow-up study. J. Clin. Investig. 2023, 133, e154987. [Google Scholar]
- Fabrizi, F.; Martin, P.; Messa, P. SARS-CoV-2 and the kidney: Pathogenetic mechanisms and clinical implications. Nephrol. Dial. Transplant. 2024, 39, 12–21. [Google Scholar]
- Long, J.D.; Price, A.; Singh, N.; Wu, H.; Lakkireddy, D.; Kotha, S.; Ghosh, A.K. Mechanisms of kidney damage in COVID-19: The role of tubular and glomerular injury. Kidney Int. Rep. 2022, 7, 1023–1034. [Google Scholar]
- Ronco, C.; Reis, T.; Husain-Syed, F. Kidney involvement in COVID-19 and rationale for extracorporeal therapies. Nat. Rev. Nephrol. 2020, 16, 308–310. [Google Scholar] [CrossRef] [Scilit]
- De Albuquerque, N.; Baig, E.; Ma, X.; Zhang, J.; He, W.; Rowe, A.; Habal, M.; Liu, M.; Shalev, I.; Downey, G.P.; et al. Murine hepatitis virus strain 1 produces a clinically relevant model of severe acute respiratory syndrome in A/J mice. J. Virol. 2006, 80, 10382–10394. [Google Scholar] [CrossRef] [Scilit]
- Caldera-Crespo, L.A.; Paidas, M.J.; Roy, S.; Schulman, C.I.; Kenyon, N.S.; Daunert, S.; Jayakumar, A.R. Experimental Models of COVID-19. Front. Cell Infect. Microbiol. 2022, 11, 792584. [Google Scholar] [CrossRef] [Scilit]
- Paidas, M.J.; Cosio, D.S.; Ali, S.; Kenyon, N.S.; Jayakumar, A.R. Long-Term Sequelae of COVID-19 in Experimental Mice. Mol. Neurobiol. 2022, 59, 5970–5986. [Google Scholar] [CrossRef] [Scilit]
- Paidas, M.J.; Sampath, N.; Schindler, E.A.; Cosio, D.S.; Ndubizu, C.O.; Shamaladevi, N.; Kwal, J.; Rodriguez, S.; Ahmad, A.; Kenyon, N.S.; et al. Mechanism of Multi-Organ Injury in Experimental COVID-19 and Its Inhibition by a Small Molecule Peptide. Front. Pharmacol. 2022, 30, 864798. [Google Scholar] [CrossRef] [Scilit]
- Paidas, M.J.; Mohamed, A.B.; Norenberg, M.D.; Saad, A.; Barry, A.F.; Colon, C.; Kenyon, N.S.; Jayakumar, A.R. Multi-Organ Histopathological Changes in a Mouse Hepatitis Virus Model of COVID-19. Viruses 2021, 13, 1703. [Google Scholar] [CrossRef] [Scilit]
- Ramamoorthy, R.; Hussain, H.; Ravelo, N.; Sriramajayam, K.; Di Gregorio, D.M.; Paulrasu, K.; Chen, P.; Young, K.; Masciarella, A.D.; Jayakumar, A.R.; et al. Kidney Damage in Long COVID: Studies in Experimental Mice. Biology 2023, 12, 1070. [Google Scholar] [CrossRef] [Scilit]
- Masciarella, A.D.; Di Gregorio, D.M.; Ramamoorthy, R.; Hussain, H.; Jayakumar, A.R.; Paidas, M.J. A Mouse Model of MHV-1 Virus Infection for Study of Acute and Long COVID Infection. Curr. Protoc. 2023, 3, e896. [Google Scholar] [CrossRef] [Scilit]
- Elumalai, N.; Hussain, H.; Sampath, N.; Shamaladevi, N.; Hajjar, R.; Druyan, B.Z.; Rashed, A.B.; Ramamoorthy, R.; Kenyon, N.S.; Jayakumar, A.R.; et al. SPIKENET: An Evidence-Based Therapy for Long COVID. Viruses 2024, 16, 838. [Google Scholar] [CrossRef] [Scilit]
- Gong, H.H.; Worley, M.J.; Carver, K.A.; Goldstein, D.R.; Deng, J.C. Neutrophils drive pulmonary vascular leakage in MHV-1 infection of susceptible A/J mice. Front. Immunol. 2023, 13, 1089064. [Google Scholar] [CrossRef] [Scilit]
- Gain, C.; Song, S.; Angtuaco, T.; Satta, S.; Kelesidis, T. The role of oxidative stress in the pathogenesis of infections with coronaviruses. Front. Microbiol. 2023, 13, 1111930. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ciceri, P.; Bono, V.; Magagnoli, L.; Sala, M.; d’Arminio Monforte, A.; Galassi, A.; Barassi, A.; Marchetti, G.; Cozzolino, M. Cytokine and Chemokine Retention Profile in COVID-19 Patients with Chronic Kidney Disease. Toxins 2022, 14, 673. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benny, M.; Bandstra, E.S.; Saad, A.G.; Lopez-Alberola, R.; Saigal, G.; Paidas, M.J.; Jayakumar, A.R.; Duara, S. Maternal SARS-CoV-2, Placental Changes and Brain Injury in 2 Neonates. Pediatrics 2023, 151, e2022058271. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hussain, H.; Paidas, M.J.; Rajalakshmi, R.; Fadel, A.; Ali, M.; Chen, P.; Jayakumar, A.R. Dermatologic Changes in Experimental Model of Long COVID. Microorganisms 2024, 12, 272. [Google Scholar] [CrossRef] [Scilit]
- Luo, X.; Luo, B.; Fei, L.; Zhang, Q.; Liang, X.; Chen, Y.; Zhou, X. MS4A superfamily molecules in tumors, Alzheimer’s and autoimmune diseases. Front. Immunol. 2024, 15, 1481494. [Google Scholar] [CrossRef] [Scilit]
- Wagner, A.K.; Kadri, N.; Snäll, J.; Brodin, P.; Gilfillan, S.; Colonna, M.; Bernhardt, G.; Höglund, P.; Kärre, K.; Chambers, B.J. Expression of CD226 is associated to but not required for NK cell education. Nat. Commun. 2017, 8, 15627. [Google Scholar] [CrossRef] [Scilit]
- Chalmers, S.A.; Ayilam Ramachandran, R.; Garcia, S.J.; Der, E.; Herlitz, L.; Ampudia, J.; Chu, D.; Jordan, N.; Zhang, T.; Parodis, I.; et al. The CD6/ALCAM pathway promotes lupus nephritis via T cell-mediated responses. J. Clin. Investig. 2022, 132, e147334. [Google Scholar] [CrossRef] [Scilit]
- Vilar, R.; Fish, R.J.; Casini, A.; Neerman-Arbez, M. Fibrin(ogen) in human disease: Both friend and foe. Haematologica 2020, 105, 284–296. [Google Scholar] [CrossRef] [Scilit]
- González-Soria, I.; Soto-Valadez, A.D.; Martínez-Rojas, M.A.; Ortega-Trejo, J.A.; Pérez-Villalva, R.; Gamba, G.; Sánchez-Navarro, A.; Bobadilla, N.A. SerpinA3K Deficiency Reduces Oxidative Stress in Acute Kidney Injury. Int. J. Mol. Sci. 2023, 24, 7815. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Z.Q.; Zhang, T.; Chang, S.; Ren, Z.H.; Zhang, Q. AZGP1 as a potential biomarker of IgA vasculitis with nephritis in a children-based urinary proteomics study by diaPASEF. Mol. Med. Rep. 2023, 28, 157. [Google Scholar] [CrossRef] [Scilit]
- Jia, P.; Wu, X.; Pan, T.; Xu, S.; Hu, J.; Ding, X. Uncoupling protein 1 inhibits mitochondrial reactive oxygen species generation and alleviates acute kidney injury. EBioMedicine 2019, 49, 331–340. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carpenter, A.R.; Becknell, M.B.; Ching, C.B.; Cuaresma, E.J.; Chen, X.; Hains, D.S.; McHugh, K.M. Uroplakin 1b is critical in urinary tract development and urothelial differentiation and homeostasis. Kidney Int. 2016, 89, 612–624. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Siddiqui, M.K.; Veluchamy, A.; Maroteau, C.; Tavendale, R.; Carr, F.; Pearson, E.; Colhoun, H.; Morris, A.D.; George, J.; Doney, A.; et al. CKM Glu83Gly Is Associated With Blunted Creatine Kinase Variation, but Not with Myalgia. Circ. Cardiovasc. Genet. 2017, 10, e001737. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Long, A.M.; Kwon, J.M.; Lee, G.; Reiser, N.L.; Vaught, L.A.; O’Brien, J.G.; Page, P.G.T.; Hadhazy, M.; Reynolds, J.C.; Crosbie, R.H. The extracellular matrix differentially directs myoblast motility and differentiation in distinct forms of muscular dystrophy: Dystrophic matrices alter myoblast motility. Matrix Biol. 2024, 129, 44–58. [Google Scholar] [CrossRef] [Scilit]
- Stern-Straeter, J.; Bonaterra, G.A.; Hörmann, K.; Kinscherf, R.; Goessler, U.R. Identification of valid reference genes during the differentiation of human myoblasts. BMC Mol. Biol. 2009, 10, 66. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.; Jin, J.; Xu, Z.; Zuo, B. Functions and Regulatory Mechanisms of lncRNAs in Skeletal Myogenesis, Muscle Disease and Meat Production. Cells 2019, 8, 1107. [Google Scholar] [CrossRef] [Scilit]
- Israeli, D.; Cosette, J.; Corre, G.; Amor, F.; Poupiot, J.; Stockholm, D.; Montus, M.; Gjata, B.; Richard, I. An AAV-SGCG Dose-Response Study in a γ-Sarcoglycanopathy Mouse Model in the Context of Mechanical Stress. Mol. Ther. Methods Clin. Dev. 2019, 13, 494–502. [Google Scholar] [CrossRef] [Scilit]
- Fox, M.D.; Carson, V.J.; Feng, H.Z.; Lawlor, M.W.; Gray, J.T.; Brigatti, K.W.; Jin, J.-P.; A Strauss, K. TNNT1 nemaline myopathy: Natural history and therapeutic frontier. Hum. Mol. Genet. 2018, 27, 3272–3282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grimley, E.; Dressler, G.R. Are Pax proteins potential therapeutic targets in kidney disease and cancer? Kidney Int. 2018, 94, 259–267. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wardle, F.C. Master control: Transcriptional regulation of mammalian Myod. J. Muscle Res. Cell Motil. 2019, 40, 211–226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tran, A.; Walsh, C.J.; Batt, J.; Dos Santos, C.C.; Hu, P. A machine learning-based clinical tool for diagnosing myopathy using multi-cohort microarray expression profiles. J. Transl. Med. 2020, 18, 454. [Google Scholar] [CrossRef] [Scilit]
- Vogt, J.; Harrison, B.J.; Spearman, H.; Cossins, J.; Vermeer, S.; ten Cate, L.N.; Morgan, N.V.; Beeson, D.; Maher, E.R. Mutation analysis of CHRNA1, CHRNB1, CHRND, and RAPSN genes in multiple pterygium syndrome/fetal akinesia patients. Am. J. Hum. Genet. 2008, 82, 222–227. [Google Scholar] [CrossRef] [Scilit]
- Loganathan, K.; Salem Said, E.; Winterrowd, E.; Orebrand, M.; He, L.; Vanlandewijck, M.; Betsholtz, C.; Quaggin, S.E.; Jeansson, M. Angiopoietin-1 deficiency increases renal capillary rarefaction and tubulointerstitial fibrosis in mice. PLoS ONE. 2018, 13, e0189433. [Google Scholar] [CrossRef] [Scilit]
- Chiang, W.C.; Huang, Y.C.; Fu, T.I.; Chen, P.-M.; Chang, F.-C.; Lai, C.-F.; Wu, V.-C.; Lin, S.-L.; Chen, Y.-M. Angiopoietin 1 influences ischemic reperfusion renal injury via modulating endothelium survival and regeneration. Mol. Med. 2019, 25, 5. [Google Scholar] [CrossRef] [Scilit]
- Chi, H.H.; Hua, K.F.; Lin, Y.C.; Chu, C.L.; Hsieh, C.Y.; Hsu, Y.J.; Ka, S.M.; Tsai, Y.L.; Liu, F.C.; Chen, A. IL-36 Signaling Facilitates Activation of the NLRP3 Inflammasome and IL-23/IL-17 Axis in Renal Inflammation and Fibrosis. J. Am. Soc. Nephrol. 2017, 28, 2022–2037. [Google Scholar] [CrossRef] [Scilit]
- Pon, J.R.; Wong, J.; Saberi, S.; Alder, O.; Moksa, M.; Cheng, S.-W.G.; Morin, G.B.; Hoodless, P.A.; Hirst, M.; Marra, M.A. MEF2B mutations in non-Hodgkin lymphoma dysregulate cell migration by decreasing MEF2B target gene activation. Nat. Commun. 2015, 6, 7953. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Han, Y.; Zhang, C. Noval insights and therapeutic strategies for tumor-induced kidney pathologies. J. Exp. Clin. Cancer Res. 2024, 43, 289. [Google Scholar] [CrossRef] [Scilit]
- Pinto, F.M.; Almeida, T.A.; Hernandez, M.; Devillier, P.; Advenier, C.; Candenas, M. mRNA expression of tachykinins and tachykinin receptors in different human tissues. Eur. J. Pharmacol. 2004, 494, 233–239. [Google Scholar] [CrossRef] [Scilit]
- Tan, H.; Wang, W.; Zhou, C.; Wang, Y.; Zhang, S.; Yang, P.; Guo, R.; Chen, W.; Zhang, J.; Ye, L.; et al. Single-cell RNA-seq uncovers dynamic processes orchestrated by RNA-binding protein DDX43 in chromatin remodeling during spermiogenesis. Nat. Commun. 2023, 14, 2499. [Google Scholar] [CrossRef] [Scilit]
- Lewis, S.; Chen, L.; Raghuram, V.; Khundmiri, S.J.; Chou, C.-L.; Yang, C.-R.; Knepper, M.A. “SLC-omics” of the kidney: Solute transporters along the nephron. Am. J. Physiol. Cell Physiol. 2021, 321, C507–C518. [Google Scholar] [CrossRef] [Scilit]
- Maedera, S.; Mizuno, T.; Ishiguro, H.; Ito, T.; Soga, T.; Kusuhara, H. GLUT6 is a lysosomal transporter that is regulated by inflammatory stimuli and modulates glycolysis in macrophages. FEBS Lett. 2019, 593, 195–208. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sedlyarov, V.; Eichner, R.; Girardi, E.; Essletzbichler, P.; Goldmann, U.; Nunes-Hasler, P.; Srndic, I.; Moskovskich, A.; Heinz, L.X.; Kartnig, F.; et al. The Bicarbonate Transporter SLC4A7 Plays a Key Role in Macrophage Phagosome Acidification. Cell Host Microbe 2018, 23, 766–774.e5. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jungnickel, K.E.; Parker, J.L.; Newstead, S. Structural basis for amino acid transport by the CAT family of SLC7 transporters. Nat. Commun. 2018, 9, 550. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Verrey, F.; Closs, E.I.; Wagner, C.A.; Palacin, M.; Endou, H.; Kanai, Y. CATs and HATs: The SLC7 family of amino acid transporters. Pflug. Arch. 2004, 447, 532–542. [Google Scholar] [CrossRef] [Scilit]
- Khananshvili, D. The SLC8 gene family of sodium–calcium exchangers (NCX)–Structure, function, and regulation in health and disease. Mol. Asp. Med. 2013, 34, 220–235. [Google Scholar] [CrossRef] [Scilit]
- Prasad, H.; Bv, H.; Subbalakshmi, A.R.; Mandal, S.; Jolly, M.K.; Visweswariah, S.S. Endosomal pH is an evolutionarily conserved driver of phenotypic plasticity in colorectal cancer. NPJ Syst. Biol. Appl. 2024, 10, 149. [Google Scholar] [CrossRef] [Scilit]
- Karakus, E.; Wannowius, M.; Müller, S.F.; Leiting, S.; Leidolf, R.; Noppes, S.; Oswald, S.; Diener, M.; Geyer, J. The orphan solute carrier SLC10A7 is a novel negative regulator of intracellular calcium signaling. Sci. Rep. 2020, 10, 7248. [Google Scholar] [CrossRef] [Scilit]
- Felmlee, M.A.; Jones, R.S.; Rodriguez-Cruz, V.; Follman, K.E.; Morris, M.E.; Daws, L.C. Monocarboxylate transporters (SLC16): Function, regulation, and role in health and disease. Pharmacol. Rev. 2020, 72, 466–485. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Song, Z.S.; Wang, Z.S.; Guo, Y.L.; Xu, C.G.; Shen, H. High Expression of SLC16A1 as a Biomarker to Predict Poor Prognosis of Urological Cancers. Front. Oncol. 2021, 11, 706883. [Google Scholar] [CrossRef] [Scilit]
- Shao, L.; Fang, Q.; Ba, C.; Zhang, Y.; Shi, C.; Zhang, Y.; Wang, J. Identification of ferroptosis-associated genes in chronic kidney disease. Exp. Ther. Med. 2022, 25, 60. [Google Scholar] [CrossRef] [Scilit]
- Bellomo, E.A.; Meur, G.; Rutter, G.A. Glucose regulates free cytosolic Zn2+ concentration, Slc39 (ZiP), and metallothionein gene expression in primary pancreatic islet β-cells. J. Biol. Chem. 2011, 286, 25778–25789. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singh, A.K.; Amlal, H.; Haas, P.J.; Dringenberg, U.; Fussell, S.; Barone, S.L.; Engelhardt, R.; Zuo, J.; Seidler, U.; Soleimani, M. Fructose-induced hypertension: Essential role of chloride and fructose absorbing transporters PAT1 and Glut. Kidney Int. 2008, 74, 438–447. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frank, H.; Gröger, N.; Diener, M.; Becker, C.; Braun, T.; Boettger, T. Lactaturia and loss of sodium-dependent lactate uptake in the colon of SLC5A8-deficient mice. J. Biol. Chem. 2008, 283, 24729–24737. [Google Scholar] [CrossRef] [Scilit]
- Subramanian, V.S.; Constantinescu, A.R.; Benke, P.J.; Said, H.M. Mutations in SLC5A6 associated with brain, immune, bone, and intestinal dysfunction in a young child. Hum. Genet. 2017, 136, 253–261. [Google Scholar] [CrossRef] [Scilit]
- Cai, L.; Wang, D.; Gui, T.; Wang, X.; Zhao, L.; Boron, W.F.; Chen, L.M.; Liu, Y. Dietary sodium enhances the expression of SLC4 family transporters, IRBIT, L-IRBIT, and PP1 in rat kidney: Insights into the molecular mechanism for renal sodium handling. Front. Physiol. 2023, 14, 1154694. [Google Scholar] [CrossRef] [Scilit]
- Jutabha, P.; Anzai, N.; Kitamura, K.; Taniguchi, A.; Kaneko, S.; Yan, K.; Yamada, H.; Shimada, H.; Kimura, T.; Katada, T.; et al. Human sodium phosphate transporter 4 (hNPT4/SLC17A3) as a common renal secretory pathway for drugs and urate. J. Biol. Chem. 2010, 285, 35123–35132. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Zhang, Y.; Sun, K.; Meng, Z.; Chen, L. The SLC transporter in nutrient and metabolic sensing, regulation, and drug development. J. Mol. Cell Biol. 2019, 11, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Nigam, S.K. The SLC22 transporter family: A paradigm for the impact of drug transporters on metabolic pathways, signaling, and disease. Annu. Rev. Pharmacol. Toxicol. 2018, 58, 663–687. [Google Scholar] [CrossRef] [Scilit]
- Zhang, P.; Azad, P.; Engelhart, D.C.; Haddad, G.G.; Nigam, S.K. SLC22 Transporters in the Fly Renal System Regulate Response to Oxidative Stress In Vivo. Int. J. Mol. Sci. 2021, 22, 13407. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Sweet, D.H. Renal organic anion transporters (SLC22 family): Expression, regulation, roles in toxicity, and impact on injury and disease. AAPS J. 2013, 15, 53–69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ebenuwa, I.; Violet, P.C.; Padayatty, S.J.; Wang, Y.; Tu, H.; Wilkins, K.J.; Moore, D.F.; Eck, P.; Schiffmann, R.; Levine, M. Vitamin C Urinary Loss in Fabry Disease: Clinical and Genomic Characteristics of Vitamin C Renal Leak. J. Nutr. 2023, 153, 1994–2003. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, Z.; Bergwitz, C. Phenotypic variability in phosphate transport disorders highlights need for individualized treatment strategies. Kidney Int. 2025, 107, 12–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chan, K.; Busque, S.M.; Sailer, M.; Stoeger, C.; Bröer, S.; Daniel, H.; Rubio-Aliaga, I.; Wagner, C.A. Loss of function mutation of the Slc38a3 glutamine transporter reveals its critical role for amino acid metabolism in the liver, brain, and kidney. Pflug. Arch. 2016, 468, 213–227. [Google Scholar] [CrossRef] [Scilit]
- Rubio-Aliaga, I.; Wagner, C.A. Regulation and function of the SLC38A3/SNAT3 glutamine transporter. Channels 2016, 10, 440–452. [Google Scholar] [CrossRef] [Scilit]
- Motohashi, H.; Inui, K. Multidrug and toxin extrusion family SLC47: Physiological, pharmacokinetic and toxicokinetic importance of MATE1 and MATE2-K. Mol. Asp. Med. 2013, 34, 661–668. [Google Scholar] [CrossRef] [Scilit]
- Beaudoin, J.J.; Brouwer, K.L.R.; Malinen, M.M. Novel insights into the organic solute transporter alpha/beta, OSTα/β: From the bench to the bedside. Pharmacol. Ther. 2020, 211, 107542. [Google Scholar] [CrossRef] [Scilit]
- Aalkjaer, C.; Frische, S.; Leipziger, J.; Nielsen, S.; Praetorius, J. Sodium coupled bicarbonate transporters in the kidney, an update. Acta Physiol. Scand. 2004, 81, 505–512. [Google Scholar] [CrossRef] [Scilit]
- Boedtkjer, E.; Praetorius, J.; Matchkov, V.V.; Stankevicius, E.; Mogensen, S.; Füchtbauer, A.C.; Simonsen, U.; Füchtbauer, E.M.; Aalkjaer, C. Disruption of Na+, HCO3− cotransporter NBCn1 (slc4a7) inhibits NO-mediated vasorelaxation, smooth muscle Ca2+ sensitivity, and hypertension development in mice. Circulation 2011, 124, 1819–1829. [Google Scholar] [CrossRef] [Scilit]
- Makrides, V.; Camargo, S.M.; Verrey, F. Transport of amino acids in the kidney. Compr. Physiol. 2014, 4, 367–403. [Google Scholar] [CrossRef] [Scilit]
- Wang, B.; Wang, Y.; Wen, Y.; Zhang, Y.-L.; Ni, W.-J.; Tang, T.-T.; Cao, J.-Y.; Yin, Q.; Jiang, W.; Yin, D.; et al. Tubular-specific CDK12 knockout causes a defect in urine concentration due to premature cleavage of the slc12a1 gene. Mol. Ther. 2022, 30, 3300–3312. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Che, T.; Wang, L.; Sun, W.; Zhao, J.; Chen, J.; Liu, Y.; Pu, Q.; Zhang, Y.; Li, J.; et al. Proteomics coupled transcriptomics reveals Slc34a1 and Slc34a3 downregulation as potential features of nephrotoxin-induced acute kidney injury. J. Proteom. 2024, 302, 105203. [Google Scholar] [CrossRef] [Scilit]
- Sapkota, D.; Wang, D.; Schreurs, O.; Vallenari, E.M.; Pandey Dhakal, S.; Küntziger, T.; Toközlü, B.S.; Utheim, T.P.; Chaudhry, F.A. Investigation of Roles of SLC38A1 in Proliferation and Differentiation of Mouse Tongue Epithelium and Expression in Human Oral Tongue Squamous Cell Carcinoma. Cancers 2024, 16, 405. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prieto, I.; Villarejo, A.B.; Segarra, A.; anegas, I.; Wangensteen, R.; Martinez-Cañamero, M.; de Gasparo, M.; Vives, F.; Ramírez-Sánchez, M. Brain, heart and kidney correlate for the control of blood pressure and water balance: Role of angiotensinases. Neuroendocrinology 2014, 100, 198–208. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Markousis-Mavrogenis, G.; Nurmohamed, M.T.; Koutsogeorgopoulou, L.; Dimitroulas, T.; Katsifis, G.; Vartela, V.; Mitsikostas, D.; Kolovou, G.; Tektonidou, M.; Voulgari, P.; et al. Current understanding and future perspectives of brain-heart-kidney axis in psoriatic arthritis. Rheumatol. Int. 2020, 40, 1361–1368. [Google Scholar] [CrossRef] [Scilit]
- Du, H.; Xiao, G.; Xue, Z.; Li, Z.; He, S.; Du, X.; Zhou, Z.; Cao, L.; Wang, Y.; Yang, J.; et al. QiShenYiQi ameliorates salt-induced hypertensive nephropathy by balancing ADRA1D and SIK1 expression in Dahl salt-sensitive rats. Biomed. Pharmacother. 2021, 141, 111941. [Google Scholar] [CrossRef] [Scilit]
- Sullivan, M.K.; Lees, J.S.; Drake, T.M.; Docherty, A.B.; Oates, G.; E Hardwick, H.; Russell, C.D.; Merson, L.; Dunning, J.; Nguyen-Van-Tam, J.S.; et al. ISARIC4C Investigators. Acute kidney injury in patients hospitalized with COVID-19 from the ISARIC WHO CCP-UK Study: A prospective, multicentre cohort study. Nephrol. Dial. Transplant. 2022, 37, 271–284. [Google Scholar] [CrossRef] [Scilit]
- Faour, W.H.; Choaib, A.; Issa, E.; Choueiry, F.E.; Shbaklo, K.; Alhajj, M.; Sawaya, R.T.; Harhous, Z.; Alefishat, E.; Nader, M. Mechanisms of COVID-19-induced kidney injury and current pharmacotherapies. Inflamm. Res. 2022, 71, 39–56. [Google Scholar] [CrossRef] [Scilit]
- Kudose, S.; Batal, I.; Santoriello, D.; Xu, K.; Barasch, J.; Peleg, Y.; Canetta, P.; Ratner, L.E.; Marasa, M.; Gharavi, A.G.; et al. Kidney Biopsy Findings in Patients with COVID-19. J. Am. Soc. Nephrol. 2020, 31, 1959–1968. [Google Scholar] [CrossRef] [Scilit]
- Nlandu, Y.; Tannor, E.K.; Bafemika, T.; Makulo, J.R. Kidney damage associated with COVID-19: From the acute to the chronic phase. Ren. Fail. 2024, 46, 2316885. [Google Scholar] [CrossRef] [Scilit]









| Gene Name | Gene Description | Primer Sequence |
|---|---|---|
| UCP1 | Uncoupling Protein 1 | AGGCTTCCAGTACCATTAGGT CTGAGTGAGGCAAAGCTGATTT |
| MS4A4B | membrane-spanning 4-domains, subfamily A, member 4B | TGACACTTCAACCATTGCTACC ACACATTTCCTGGAACATTGGTC |
| CD6 | Cluster of Differentiation 6 | GGAGGGCTACTGCAATGATCC GTGAGGGGACTCTTCTCAGAAT |
| CD96 | Cluster of Differentiation 6 | TGGGAAGAGCTATTCAATGTTGG AGAGGCCATATTGGGGATGATAA |
| Fgb | fibrinogen B beta (Bβ) chain | ACGATGAACCGACGGATAGC CCGTAGGACACAACACTCCC |
| SLC7a11 | cystine/glutamate antiporter | GGCACCGTCATCGGATCAG CTCCACAGGCAGACCAGAAAA |
| Gene Name | Gene Description | Primer Sequence |
|---|---|---|
| Myh3 | Myosin-3 | AAAAGGCCATCACTGACGC CAGCTCTCTGATCCGTGTCTC |
| UCP1 | Uncoupling Protein 1 | AGGCTTCCAGTACCATTAGGT CTGAGTGAGGCAAAGCTGATTT |
| Myod1 | Myogenic Differentiation 1 | CCACTCCGGGACATAGACTTG AAAAGCGCAGGTCTGGTGAG |
| Cav3 | Caveolin 3 | GGATCTGGAAGCTCGGATCAT TCCGCAATCACGTCTTCAAAAT |
| Egr3 | Early Growth Response 3 | CCGGTGACCATGAGCAGTTT TAATGGGCTACCGAGTCGCT |
| SLC8A3 | sodium/calcium exchanger 3 | CCCCCGCATGGTGGATATG CCCTCCTGCACTAACAGTGA |
| SLC12A1 | sodium–potassium–chloride cotransporter | TCATTGGCCTGAGCGTAGTTG TTTGTGCAAATAGCCGACATAGA |
| SLC22A13 | Organic Anion Transporter | TTCAGGTGCGGTTGACCATC GTGGTTCTTAACCCAGGACAC |
| SLC7a11 | cystine/glutamate antiporter | GGCACCGTCATCGGATCAG CTCCACAGGCAGACCAGAAAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ramamoorthy, R.; Speciale, A.R.; West, E.M.; Hussain, H.; Elumalai, N.; Schmitz Abe, K.E.; Ramesh, M.C.; Agrawal, P.B.; Jayakumar, A.R.; Paidas, M.J. Persistent Inflammation, Maladaptive Remodeling, and Fibrosis in the Kidney Following Long COVID-like MHV-1 Mouse Model. Diseases 2025, 13, 246. https://doi.org/10.3390/diseases13080246
Ramamoorthy R, Speciale AR, West EM, Hussain H, Elumalai N, Schmitz Abe KE, Ramesh MC, Agrawal PB, Jayakumar AR, Paidas MJ. Persistent Inflammation, Maladaptive Remodeling, and Fibrosis in the Kidney Following Long COVID-like MHV-1 Mouse Model. Diseases. 2025; 13(8):246. https://doi.org/10.3390/diseases13080246
Chicago/Turabian StyleRamamoorthy, Rajalakshmi, Anna Rosa Speciale, Emily M. West, Hussain Hussain, Nila Elumalai, Klaus Erich Schmitz Abe, Madesh Chinnathevar Ramesh, Pankaj B. Agrawal, Arumugam R. Jayakumar, and Michael J. Paidas. 2025. "Persistent Inflammation, Maladaptive Remodeling, and Fibrosis in the Kidney Following Long COVID-like MHV-1 Mouse Model" Diseases 13, no. 8: 246. https://doi.org/10.3390/diseases13080246
APA StyleRamamoorthy, R., Speciale, A. R., West, E. M., Hussain, H., Elumalai, N., Schmitz Abe, K. E., Ramesh, M. C., Agrawal, P. B., Jayakumar, A. R., & Paidas, M. J. (2025). Persistent Inflammation, Maladaptive Remodeling, and Fibrosis in the Kidney Following Long COVID-like MHV-1 Mouse Model. Diseases, 13(8), 246. https://doi.org/10.3390/diseases13080246

