Curcumin and Selenium Synergistically Alleviate Oxidative Stress in IPEC-J2 Cells and ICR Mice
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Maintenance
2.2. Drug Treatment
2.3. Animals and Treatments
2.4. Cell Viability Assay
2.5. Antioxidant Capacity Assays
2.6. ROS Assay
2.7. Mitochondrial Membrane Potential (MMP) Assay
2.8. Transmission Electron Microscope (TEM) Scanning Assay
2.9. RNA Isolation and RT-qPCR Assay
2.10. H&E Staining and Immunohistochemical (IHC) Assay
2.11. 16s rRNA Gene Sequencing
2.12. Statistical Analysis
3. Results
3.1. Cur and Se Exert Synergistic Antioxidant Effects in IPEC-J2 Cells
3.2. Cur and Se Protect the Mitochondria of IPEC-J2 Cells Damaged by H2O2
3.3. Cur and Se Alleviate DSS-Induced Colitis in ICR Mice
3.4. Cur and Se Ameliorate DSS-Induced Colonic Morphology and Barrier Damage in ICR Mice
3.5. Cur and Se Alleviate DSS-Induced Oxidative Stress in ICR Mice
3.6. Cur and Se Promote Antioxidant and Anti-Inflammatory Gene Expression in Mice Colon Tissues
3.7. Cur and Se Modulate the Gut Microbiota Dysbiosis Induced by DSS in ICR Mice
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Forman, H.J.; Zhang, H. Targeting oxidative stress in disease: Promise and limitations of antioxidant therapy. Nat. Rev. Drug Discov. 2021, 20, 689–709. [Google Scholar] [CrossRef]
- Hashim, F.J.; Vichitphan, S.; Boonsiri, P.; Vichitphan, K. Neuroprotective Assessment of Moringa oleifera Leaves Extract against Oxidative-Stress-Induced Cytotoxicity in SHSY5Y Neuroblastoma Cells. Plants 2021, 10, 889. [Google Scholar] [CrossRef]
- Hao, Y.; Xing, M.; Gu, X. Research Progress on Oxidative Stress and Its Nutritional Regulation Strategies in Pigs. Animals 2021, 11, 1384. [Google Scholar] [CrossRef] [PubMed]
- Qiao, L.; Dou, X.; Song, X.; Chang, J.; Yi, H.; Xu, C. Targeting mitochondria with antioxidant nutrients for the prevention and treatment of postweaning diarrhea in piglets. Anim. Nutr. 2023, 15, 275–287. [Google Scholar] [CrossRef] [PubMed]
- Muro, P.; Zhang, L.; Li, S.; Zhao, Z.; Jin, T.; Mao, F.; Mao, Z. The emerging role of oxidative stress in inflammatory bowel disease. Front. Endocrinol. 2024, 15, 1390351. [Google Scholar] [CrossRef]
- Liu, M.; Wen, H.; Zuo, L.; Song, X.; Geng, Z.; Ge, S.; Ge, Y.; Wu, R.; Chen, S.; Yu, C.; et al. Bryostatin-1 attenuates intestinal ischemia/reperfusion-induced intestinal barrier dysfunction, inflammation, and oxidative stress via activation of Nrf2/HO-1 signaling. FASEB J. 2023, 37, e22948. [Google Scholar] [CrossRef]
- Li, Y.; Cai, L.; Bi, Q.; Sun, W.; Pi, Y.; Jiang, X.; Li, X. Genistein Alleviates Intestinal Oxidative Stress by Activating the Nrf2 Signaling Pathway in IPEC-J2 Cells. Vet. Sci. 2024, 11, 154. [Google Scholar] [CrossRef]
- Xu, L.; He, S.; Yin, P.; Li, D.; Mei, C.; Yu, X.; Shi, Y.; Jiang, L.; Liu, F. Punicalagin induces Nrf2 translocation and HO-1 expression via PI3K/Akt, protecting rat intestinal epithelial cells from oxidative stress. Int. J. Hyperth. 2016, 32, 465–473. [Google Scholar] [CrossRef]
- Shandilya, S.; Kumar, S.; Kumar Jha, N.; Kumar Kesari, K.; Ruokolainen, J. Interplay of gut microbiota and oxidative stress: Perspective on neurodegeneration and neuroprotection. J. Adv. Res. 2022, 38, 223–244. [Google Scholar] [CrossRef]
- Nagy-Grócz, G.; Spekker, E.; Vécsei, L. Kynurenines, Neuronal Excitotoxicity, and Mitochondrial Oxidative Stress: Role of the Intestinal Flora. Int. J. Mol. Sci. 2024, 25, 1698. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; Fu, D.; Zhang, Y.; Wang, H.; Su, W.; Song, Y.; Tan, M. Curcumin-loaded proliposomes via glycerol-infused: Mechanism, stability and antioxidant activities. Food Chem. 2025, 478, 143763. [Google Scholar] [CrossRef]
- Jain, S.; Lenaghan, S.; Dia, V.; Zhong, Q. Co-delivery of curcumin and quercetin in shellac nanocapsules for the synergistic antioxidant properties and cytotoxicity against colon cancer cells. Food Chem. 2023, 428, 136744. [Google Scholar] [CrossRef]
- Ruan, D.; Zhu, Y.W.; Fouad, A.M.; Yan, S.J.; Chen, W.; Zhang, Y.N.; Xia, W.G.; Wang, S.; Jiang, S.Q.; Yang, L.; et al. Dietary curcumin enhances intestinal antioxidant capacity in ducklings via altering gene expression of antioxidant and key detoxification enzymes. Poult. Sci. 2019, 98, 3705–3714. [Google Scholar] [CrossRef]
- Peng, Y.; Ao, M.; Dong, B.; Jiang, Y.; Yu, L.; Chen, Z.; Hu, C.; Xu, R. Anti-Inflammatory Effects of Curcumin in the Inflammatory Diseases: Status, Limitations and Countermeasures. Drug Des. Devel Ther. 2021, 15, 4503–4525. [Google Scholar] [CrossRef] [PubMed]
- Razavi, B.M.; Ghasemzadeh Rahbardar, M.; Hosseinzadeh, H. A review of therapeutic potentials of turmeric (Curcuma longa) and its active constituent, curcumin, on inflammatory disorders, pain, and their related patents. Phytother. Res. 2021, 35, 6489–6513. [Google Scholar] [CrossRef] [PubMed]
- Ding, J.; Liu, Z.; Liu, S.; Xie, X.; Yin, Q.; Lu, W.; Wang, W.; Zhang, Y. Preparation and anti-tumor ability evaluation of anti-PD-L1 conjugated curcumin in colon cancer. Int. J. Biol. Macromol. 2025, 306, 141563. [Google Scholar] [CrossRef] [PubMed]
- Dei Cas, M.; Ghidoni, R. Dietary Curcumin: Correlation between Bioavailability and Health Potential. Nutrients 2019, 11, 2147. [Google Scholar] [CrossRef]
- Liu, S.; Liu, J.; He, L.; Liu, L.; Cheng, B.; Zhou, F.; Cao, D.; He, Y. A Comprehensive Review on the Benefits and Problems of Curcumin with Respect to Human Health. Molecules 2022, 27, 4400. [Google Scholar] [CrossRef]
- Zhao, J.; Liang, G.; Zhou, G.; Hong, K.; Yang, W.; Liu, J.; Zeng, L. Efficacy and safety of curcumin therapy for knee osteoarthritis: A Bayesian network meta-analysis. J. Ethnopharmacol. 2024, 321, 117493. [Google Scholar] [CrossRef]
- Chen, Y.; Jiang, Z.; Xu, J.; Zhang, J.; Sun, R.; Zhou, J.; Lu, Y.; Gong, Z.; Huang, J.; Shen, X.; et al. Improving the ameliorative effects of berberine and curcumin combination via dextran-coated bilosomes on non-alcohol fatty liver disease in mice. J. Nanobiotechnol. 2021, 19, 230. [Google Scholar] [CrossRef]
- Mohanty, C.; Das, M.; Sahoo, S.K. Emerging role of nanocarriers to increase the solubility and bioavailability of curcumin. Expert. Opin. Drug Deliv. 2012, 9, 1347–1364. [Google Scholar] [CrossRef]
- Ma, L.; Zhao, Y.; Yu, J.; Ji, H.; Liu, A. Characterization of Se-enriched Pleurotus ostreatus polysaccharides and their antioxidant effects in vitro. Int. J. Biol. Macromol. 2018, 111, 421–429. [Google Scholar] [CrossRef]
- Bhattarai, U.; Xu, R.; He, X.; Pan, L.; Niu, Z.; Wang, D.; Zeng, H.; Chen, J.X.; Clemmer, J.S.; Chen, Y. High selenium diet attenuates pressure overload-induced cardiopulmonary oxidative stress, inflammation, and heart failure. Redox Biol. 2024, 76, 103325. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Li, Q.; Shan, J.; Xing, J.; Liu, X.; Ma, Y.; Qian, H.; Chen, X.; Wang, X.; Wu, L.M.; et al. Multifunctional two-dimensional Bi(2)Se(3) nanodiscs for anti-inflammatory therapy of inflammatory bowel diseases. Acta Biomater. 2023, 160, 252–264. [Google Scholar] [CrossRef] [PubMed]
- Zhu, S.; Hu, J.; Liu, S.; Guo, S.; Jia, Y.; Li, M.; Kong, W.; Liang, J.; Zhang, J.; Wang, J. Synthesis of Se-polysaccharide mediated by selenium oxychloride: Structure features and antiproliferative activity. Carbohydr. Polym. 2020, 246, 116545. [Google Scholar] [CrossRef]
- Huang, J.Q.; Jiang, Y.Y.; Ren, F.Z.; Lei, X.G. Novel role and mechanism of glutathione peroxidase-4 in nutritional pancreatic atrophy of chicks induced by dietary selenium deficiency. Redox Biol. 2022, 57, 102482. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Liu, J.; Liu, M.; Liang, M.; Wang, Z.; Sha, Y.; Ma, H.; Lin, Y.; Li, B.; You, J.; et al. Effects of selenium-enriched yeast dietary supplementation on egg quality, gut morphology and caecal microflora of laying hens. Anim. Biotechnol. 2024, 35, 2258188. [Google Scholar] [CrossRef]
- Ghaeini Hesarooeyeh, Z.; Basham, A.; Sheybani-Arani, M.; Abbaszadeh, M.; Salimi Asl, A.; Moghbeli, M.; Saburi, E. Effect of resveratrol and curcumin and the potential synergism on hypertension: A mini-review of human and animal model studies. Phytother. Res. 2024, 38, 42–58. [Google Scholar] [CrossRef]
- He, Z.; Lin, Z.; Yan, Y.; Wang, J.; Zhang, S.; Zheng, B.; Huang, X. Curcumin and selenium synergistically mitigate oxidative stress in white-feathered broilers. Front. Vet. Sci. 2025, 12, 1600466, Correction in Front. Vet. Sci. 2025, 12, 1650011. https://doi.org/10.3389/fvets.2025.1650011. [Google Scholar] [CrossRef]
- Wang, S.; Zhu, F. Dietary antioxidant synergy in chemical and biological systems. Crit. Rev. Food Sci. Nutr. 2017, 57, 2343–2357. [Google Scholar] [CrossRef]
- Grădinariu, L.; Dediu, L.; Crețu, M.; Grecu, I.R.; Docan, A.; Istrati, D.I.; Dima, F.M.; Stroe, M.D.; Vizireanu, C. The Antioxidant and Hepatoprotective Potential of Berberine and Silymarin on Acetaminophen Induced Toxicity in Cyprinus carpio L. Animals 2024, 14, 373. [Google Scholar] [CrossRef]
- Villanueva-Bermejo, D.; Siles-Sánchez, M.L.N.; Martín Hernández, D.; Rodríguez García-Risco, M.; Jaime, L.; Santoyo, S.; Fornari, T. Theoretical framework to evaluate antioxidant synergistic effects from the coextraction of marjoram, rosemary and parsley. Food Chem. 2024, 437, 137919. [Google Scholar] [CrossRef]
- Yamamoto, M.; Kensler, T.W.; Motohashi, H. The KEAP1-NRF2 System: A Thiol-Based Sensor-Effector Apparatus for Maintaining Redox Homeostasis. Physiol. Rev. 2018, 98, 1169–1203. [Google Scholar] [CrossRef]
- Crisman, E.; Duarte, P.; Dauden, E.; Cuadrado, A.; Rodríguez-Franco, M.I.; López, M.G.; León, R. KEAP1-NRF2 protein-protein interaction inhibitors: Design, pharmacological properties and therapeutic potential. Med. Res. Rev. 2023, 43, 237–287. [Google Scholar] [CrossRef]
- Wen, Z.S.; Tang, Z.; Ma, L.; Zhu, T.L.; Wang, Y.M.; Xiang, X.W.; Zheng, B. Protective Effect of Low Molecular Weight Seleno-Aminopolysaccharide on the Intestinal Mucosal Oxidative Damage. Mar. Drugs 2019, 17, 64. [Google Scholar] [CrossRef]
- Guo, M.; Wang, X. Pathological mechanism and targeted drugs of ulcerative colitis: A review. Medicine 2023, 102, e35020. [Google Scholar] [CrossRef]
- Dong, N.; Li, X.; Xue, C.; Zhang, L.; Wang, C.; Xu, X.; Shan, A. Astragalus polysaccharides alleviates LPS-induced inflammation via the NF-κB/MAPK signaling pathway. J. Cell Physiol. 2020, 235, 5525–5540. [Google Scholar] [CrossRef]
- Wang, Y.; Zhang, Z.; Du, M.; Ji, X.; Liu, X.; Zhao, C.; Pang, X.; Jin, E.; Wen, A.; Li, S.; et al. Berberine alleviates ETEC-induced intestinal inflammation and oxidative stress damage by optimizing intestinal microbial composition in a weaned piglet model. Front. Immunol. 2024, 15, 1460127. [Google Scholar] [CrossRef]
- Li, T.; Raja, B.; Liao, J.; Zheng, L.; Yin, F.; Gan, S.; Sun, X.; Lyu, G.; Ma, J. The characteristics, influence factors, and regulatory strategies of growth retardation in ruminants: A review. Front. Vet. Sci. 2025, 12, 1566427. [Google Scholar] [CrossRef]
- Zdunek-Zastocka, E.; Michniewska, B.; Pawlicka, A.; Grabowska, A. Pisum sativumCadmium Alters the Metabolism and Perception of Abscisic Acid in Leaves in a Developmentally Specific Manner. Int. J. Mol. Sci. 2024, 25, 6582. [Google Scholar] [CrossRef]
- Paz, S.; Martinez-Lopez, A.; Villanueva-Lazo, A.; Pedroche, J.; Millan, F.; Millan-Linares, M. Amaranthus caudatusIdentification and Characterization of Novel Antioxidant Protein Hydrolysates from Kiwicha (Amaranthus caudatus L.). Antioxidants 2021, 10, 645. [Google Scholar] [CrossRef]
- Li, Q.; Yang, S.; Chen, F.; Guan, W.; Zhang, S. Nutritional strategies to alleviate oxidative stress in sows. Anim. Nutr. 2022, 9, 60–73. [Google Scholar] [CrossRef]
- Racewicz, P.; Ludwiczak, A.; Skrzypczak, E.; Składanowska-Baryza, J.; Biesiada, H.; Nowak, T.; Nowaczewski, S.; Zaborowicz, M.; Stanisz, M.; Ślósarz, P. Welfare Health and Productivity in Commercial Pig Herds. Animals 2021, 11, 1176. [Google Scholar] [CrossRef]
- Zhang, D.; Ma, S.; Wang, L.; Ma, H.; Wang, W.; Xia, J.; Liu, D. Min pig skeletal muscle response to cold stress. PLoS ONE 2022, 17, e0274184. [Google Scholar] [CrossRef]
- Lopresti, A. The Problem of Curcumin and Its Bioavailability: Could Its Gastrointestinal Influence Contribute to Its Overall Health-Enhancing Effects? Adv. Nutr. Int. Rev. J. 2018, 9, 41–50. [Google Scholar] [CrossRef]
- Chang, R.; Chen, L.; Qamar, M.; Wen, Y.; Li, L.; Zhang, J.; Li, X.; Assadpour, E.; Esatbeyoglu, T.; Kharazmi, M.; et al. The bioavailability, metabolism and microbial modulation of curcumin-loaded nanodelivery systems. Adv. Colloid Interface Sci. 2023, 318, 102933. [Google Scholar] [CrossRef]
- Wen, C.; Cao, L.; Yu, Z.; Liu, G.; Zhang, J.; Xu, X. Advances in lipo-solubility delivery vehicles for curcumin: Bioavailability, precise targeting, possibilities and challenges. Crit. Rev. Food Sci. Nutr. 2024, 64, 10835–10854. [Google Scholar] [CrossRef]
- Chilala, P.; Skalickova, S.; Horky, P. Selenium Status of Southern Africa. Nutrients 2024, 16, 975. [Google Scholar] [CrossRef]
- Chou, T.C. Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies. Pharmacol. Rev. 2006, 58, 621–681. [Google Scholar] [CrossRef]
- Lin, Z.; Li, Q.; Zhao, Y.; Lin, Z.; Cheng, N.; Zhang, D.; Liu, G.; Lin, J.; Zhang, H.; Lin, D. Combination of Auranofin and ICG-001 Suppress the Proliferation and Metastasis of Colon Cancer. Front. Oncol. 2021, 11, 738085. [Google Scholar] [CrossRef]
- Banerjee, V.; Sharda, N.; Huse, J.; Singh, D.; Sokolov, D.; Czinn, S.J.; Blanchard, T.G.; Banerjee, A. Synergistic potential of dual andrographolide and melatonin targeting of metastatic colon cancer cells: Using the Chou-Talalay combination index method. Eur. J. Pharmacol. 2021, 897, 173919. [Google Scholar] [CrossRef]
- Yin, H.; Wang, C.; Shuai, Y.; Xie, Z.; Liu, J. Pig-Derived Probiotic Bacillus tequilensis YB-2 Alleviates Intestinal Inflammation and Intestinal Barrier Damage in Colitis Mice by Suppressing the TLR4/NF-κB Signaling Pathway. Animals 2024, 14, 1989. [Google Scholar] [CrossRef]
- Wei, J.; Liu, Y.; Li, H.; Lu, Z.; Liu, Y.; Zhang, Y.; Lan, C.; Wu, A.; He, J.; Cai, J.; et al. Unlocking the power of swine gut bacteria: Newly isolated Blautia strain and its metabolites inhibit the replication of Salmonella Typhimurium in macrophages and alleviate DSS-induced colitis in mice. J. Anim. Sci. Biotechnol. 2025, 16, 87. [Google Scholar] [CrossRef]
- Liu, S.; Li, J.; Kang, W.; Li, Y.; Ge, L.; Liu, D.; Liu, Y.; Huang, K. Aflatoxin B1 Induces Intestinal Barrier Dysfunction by Regulating the FXR-Mediated MLCK Signaling Pathway in Mice and in IPEC-J2 Cells. J. Agric. Food Chem. 2023, 71, 867–876. [Google Scholar] [CrossRef]
- Sun, Y.Y.; Zhu, H.J.; Zhao, R.Y.; Zhou, S.Y.; Wang, M.Q.; Yang, Y.; Guo, Z.N. Remote ischemic conditioning attenuates oxidative stress and inflammation via the Nrf2/HO-1 pathway in MCAO mice. Redox Biol. 2023, 66, 102852. [Google Scholar] [CrossRef]
- Wang, F.; Amona, F.M.; Pang, Y.; Zhang, Q.; Liang, Y.; Chen, X.; Ke, Y.; Chen, J.; Song, C.; Wang, Y.; et al. Porcine reproductive and respiratory syndrome virus nsp5 inhibits the activation of the Nrf2/HO-1 pathway by targeting p62 to antagonize its antiviral activity. J. Virol. 2025, 99, e0158524. [Google Scholar] [CrossRef]
- Ji, R.; Jia, F.; Chen, X.; Gao, Y.; Yang, J. Carnosol inhibits KGN cells oxidative stress and apoptosis and attenuates polycystic ovary syndrome phenotypes in mice through Keap1-mediated Nrf2/HO-1 activation. Phytother. Res. 2023, 37, 1405–1421. [Google Scholar] [CrossRef]
- Wang, Y.; Wu, Y.; Wang, Y.; Fu, A.; Gong, L.; Li, W.; Li, Y. Bacillus amyloliquefaciens SC06 alleviates the oxidative stress of IPEC-1 via modulating Nrf2/Keap1 signaling pathway and decreasing ROS production. Appl. Microbiol. Biotechnol. 2017, 101, 3015–3026. [Google Scholar] [CrossRef]
- Jia, C.; Chai, J.; Zhang, S.; Sun, Y.; He, L.; Sang, Z.; Chen, D.; Zheng, X. The Advancements of Marine Natural Products in the Treatment of Alzheimer’s Disease: A Study Based on Cell and Animal Experiments. Mar. Drugs 2025, 23, 91. [Google Scholar] [CrossRef]
- Kurtul, E.; Küpeli Akkol, E.; Karpuz Ağören, B.; Yaylacı, B.; Bahadır Acıkara, Ö.; Sobarzo-Sánchez, E. HeracleumPhytochemical investigation and assessment of the anti-inflammatory activity of four taxa growing in Turkey. Front. Pharmacol. 2024, 15, 1494786. [Google Scholar] [CrossRef]
- Zheng, Y.; Liu, Z.; Cai, A.; Xu, S.; Weng, Z.; Gao, W.; Xu, Y. Study on the mechanism of Ginseng-Gegen for mesenteric lymphadenitis based on network pharmacology. Transl. Pediatr. 2022, 11, 1534–1543. [Google Scholar] [CrossRef]
- Zhang, Y.; Shi, H.; Yun, Y.; Feng, H.; Wang, X. Dioscorea alataThe Effect of Anthocyanins from L. on Antioxidant Properties of Perinatal Hainan Black Goats and Its Possible Mechanism in the Mammary Gland. Animals 2022, 12, 3320. [Google Scholar] [CrossRef]
- Adebayo, M.; Singh, S.; Singh, A.P.; Dasgupta, S. Mitochondrial fusion and fission: The fine-tune balance for cellular homeostasis. FASEB J. 2021, 35, e21620. [Google Scholar] [CrossRef]
- Zacharioudakis, E.; Gavathiotis, E. Mitochondrial dynamics proteins as emerging drug targets. Trends Pharmacol. Sci. 2023, 44, 112–127. [Google Scholar] [CrossRef]
- Xu, D.; Zhang, K.; Qu, X.H.; Wang, T.; Yang, P.; Yang, Y.; Jiang, L.P.; Wan, Y.Y.; Tou, F.F.; Chen, Z.P.; et al. Curcumin protects retinal neuronal cells against oxidative stress-induced damage by regulating mitochondrial dynamics. Exp. Eye Res. 2022, 224, 109239. [Google Scholar] [CrossRef]
- Shi, Y.; Han, L.; Zhang, X.; Xie, L.; Pan, P.; Chen, F. Selenium Alleviates Cerebral Ischemia/Reperfusion Injury by Regulating Oxidative Stress, Mitochondrial Fusion and Ferroptosis. Neurochem. Res. 2022, 47, 2992–3002. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Lin, Q.; Gou, F.; Zhu, J.; Yu, M.; Hong, Q.; Hu, C. Effects of hesperidin on mitochondrial function, mitochondria-associated endoplasmic reticulum membranes and IP3R-MCU calcium axis in the intestine of piglets exposed to deoxynivalenol. Food Funct. 2024, 15, 6459–6474. [Google Scholar] [CrossRef]
- Weiss, G.A.; Hennet, T. Mechanisms and consequences of intestinal dysbiosis. Cell Mol. Life Sci. 2017, 74, 2959–2977. [Google Scholar] [CrossRef]
- Wen, X.; Tang, S.; Wan, F.; Zhong, R.; Chen, L.; Zhang, H. The PI3K/Akt-Nrf2 Signaling Pathway and Mitophagy Synergistically Mediate Hydroxytyrosol to Alleviate Intestinal Oxidative Damage. Int. J. Biol. Sci. 2024, 20, 4258–4276. [Google Scholar] [CrossRef]
- Hattori, K.; Akiyama, M.; Seki, N.; Yakabe, K.; Hase, K.; Kim, Y. Gut Microbiota Prevents Sugar Alcohol-Induced Diarrhea. Nutrients 2021, 13, 2029. [Google Scholar] [CrossRef]
- Zhou, C.; Peng, B.; Zhang, M.; Yang, Y.; Yi, Z.; Wu, Y. Ganjiang Huangqin Huanglian Renshen Decoction protects against ulcerative colitis by modulating inflammation, oxidative stress, and gut microbiota. Phytomedicine 2024, 135, 156172. [Google Scholar] [CrossRef] [PubMed]
- Qin, X.; Chen, M.; He, B.; Chen, Y.; Zheng, Y. Role of short-chain fatty acids in non-alcoholic fatty liver disease and potential therapeutic targets. Front. Microbiol. 2025, 16, 1539972. [Google Scholar] [CrossRef] [PubMed]
- Deng, Y.; Wang, Y.; Liu, Y.; Yang, X.; Zhang, H.; Xue, X.; Wan, Y. Akkermansia muciniphila isolated from forest musk deer ameliorates diarrhea in mice via modification of gut microbiota. Anim. Models Exp. Med. 2025, 8, 295–306. [Google Scholar] [CrossRef]
- Sun, Y.; Zhang, S.; Nie, Q.; He, H.; Tan, H.; Geng, F.; Ji, H.; Hu, J.; Nie, S. Gut firmicutes: Relationship with dietary fiber and role in host homeostasis. Crit. Rev. Food Sci. Nutr. 2023, 63, 12073–12088. [Google Scholar] [CrossRef]
- Samaddar, A.; van Nispen, J.; Armstrong, A.; Song, E.; Voigt, M.; Murali, V.; Krebs, J.; Manithody, C.; Denton, C.; Ericsson, A.C.; et al. Lower systemic inflammation is associated with gut firmicutes dominance and reduced liver injury in a novel ambulatory model of parenteral nutrition. Ann. Med. 2022, 54, 1701–1713. [Google Scholar] [CrossRef]
- Yang, B.; Li, M.; Wang, S.; Ross, R.P.; Stanton, C.; Zhao, J.; Zhang, H.; Chen, W. Lactobacillus ruminis Alleviates DSS-Induced Colitis by Inflammatory Cytokines and Gut Microbiota Modulation. Foods 2021, 10, 1349. [Google Scholar] [CrossRef]
- Wang, H.; Sun, Y.; Xiao, F.J.; Zhao, X.; Zhang, W.Y.; Xia, Y.J.; Wang, L.S. Mesenchymal Stem Cells Ameliorate DSS-Induced Experimental Colitis by Modulating the Gut Microbiota and MUC-1 Pathway. J. Inflamm. Res. 2023, 16, 2023–2039. [Google Scholar] [CrossRef]










| Group | 1–14 Day Processing | 15–21 Day Processing |
|---|---|---|
| Blank control group (Con) | Normal feed | Purified water for drinking |
| Model group (DSS) | Normal feed | Drinking a 3% solution of DSS |
| Curcumin group (Cur) | Gastric curcumin 200 mg/kg | Drinking a 3% solution of DSS |
| Sodium selenite group (Se) | Sodium selenite 2 mg/kg | Drinking a 3% solution of DSS |
| Low-dose curcumin combined with sodium selenite group (L-CS) | Gastric curcumin 50 mg/kg and sodium selenite 2 mg/kg | Drinking a 3% solution of DSS |
| Medium-dose curcumin combined with sodium selenite group (M-CS) | Gastric curcumin 100 mg/kg and sodium selenite 2 mg/kg | Drinking a 3% solution of DSS |
| High-dose curcumin combined with sodium selenite group (H-CS) | Gastric curcumin 200 mg/kg and sodium selenite 2 mg/kg | Drinking a 3% solution of DSS |
| Genes | Primer Sequences | Product Length |
|---|---|---|
| Nrf2 (mus) | F: ACACGAGATGAGCTTAGGGC R: TCGGATCAATGCGAGCTGAG | 135 |
| HO-1 (mus) | F: CAGAAGAGGCTAAGACCGCC R: CTCTGACGAAGTGACGCCAT | 118 |
| NQO-1 (mus) | F: GCGAGAAGAGCCCTGATTGT R: TTCGAGTCCTTCAGCTCACC | 185 |
| IL-1β (mus) | F: GAAATGCCACCTTTTGACAGTG R: TGGATGCTCTCATCAGGACAG | 116 |
| TNF-α (mus) | F: GCCGATGGGTTGTACCTTGT | 139 |
| R: TCTTGACGGCAGAGAGGAGG | ||
| NF-κB (mus) | F: GTTTGATGCTGATGAAGACTTGG | 186 |
| R: GTCACCAGGCGAGTTATAGC | ||
| β-actin (mus) | F: TGTCCACCTTCCAGCAGATGT R: AGCTCAGTAACAGTCCGCCTAG | 101 |
| Cur (μM) | Se (μM) | CI Value | Combined Effect |
|---|---|---|---|
| 1.5 | 0.15 | 0.5317 | synergistic effect |
| 2 | 0.2 | 0.5721 | synergistic effect |
| 2.5 | 0.25 | 0.1828 | synergistic effect |
| 5 | 0.5 | 0.1350 | synergistic effect |
| 10 | 1 | 1.1198 | antagonistic effect |
| Group | Length of the Colon (cm) | Weight (g) | Last DAI Score |
|---|---|---|---|
| Con group | 8.68 ± 0.52 a | 25.47 ± 0.51 a | 0.00 c |
| DSS group | 5.27 ± 0.56 c | 22.10 ± 0.48 d | 2.61 ± 0.26 a |
| Cur group | 7.42 ± 0.50 b | 24.15 ± 0.51 bc | 1.46 ± 0.13 b |
| Se group | 7.18 ± 0.44 b | 24.15 ± 0.46 bc | 1.60 ± 0.21 b |
| L-CS group | 7.52 ± 0.28 a | 25.40 ± 0.49 b | 1.34 ± 0.11 b |
| M-CS group | 7.55 ± 0.29 a | 25.27 ± 0.51 b | 1.25 ± 0.22 b |
| H-CS group | 6.65 ± 0.33 b | 24.15 ± 0.61 c | 1.44 ± 0.31 b |
| Group | Chao1 | ACE | Shannon | Simpson |
|---|---|---|---|---|
| Con | 9478.71 ± 222.54 a | 11,662.89 ± 553.83 a | 7.76 ± 0.03 a | 0.97 |
| Dss | 4657.31 ± 286.67 d | 5763.14 ± 270.94 e | 6.44 ± 0.34 c | 0.99 |
| Cur | 6171.22 ± 135.12 c | 7475.53 ± 184.67 cd | 6.76 ± 0.60 abc | 0.98 |
| Se | 6018.91 ± 106.63 c | 6273.96 ± 152.24 de | 6.62 ± 0.75 bc | 0.98 |
| L-CS | 6945.48 ± 171.19 b | 7984.11 ± 132.98 bc | 7.09 ± 0.18 abc | 0.97 |
| M-CS | 7341.19 ± 156.85 b | 8915.53 ± 226.58 b | 7.61 ± 0.07 ab | 0.97 |
| H-CS | 6180.65 ± 137.24 c | 7225.53 ± 240.11 cd | 7.45 ± 0.20 abc | 0.98 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zheng, Y.; Liu, J.; Li, J.; Zheng, B.; Li, Q.; Huang, X.; Lin, Z. Curcumin and Selenium Synergistically Alleviate Oxidative Stress in IPEC-J2 Cells and ICR Mice. Biology 2025, 14, 1117. https://doi.org/10.3390/biology14091117
Zheng Y, Liu J, Li J, Zheng B, Li Q, Huang X, Lin Z. Curcumin and Selenium Synergistically Alleviate Oxidative Stress in IPEC-J2 Cells and ICR Mice. Biology. 2025; 14(9):1117. https://doi.org/10.3390/biology14091117
Chicago/Turabian StyleZheng, Yu, Jiali Liu, Junxin Li, Bohan Zheng, Qinjin Li, Xiaohong Huang, and Zhaoyan Lin. 2025. "Curcumin and Selenium Synergistically Alleviate Oxidative Stress in IPEC-J2 Cells and ICR Mice" Biology 14, no. 9: 1117. https://doi.org/10.3390/biology14091117
APA StyleZheng, Y., Liu, J., Li, J., Zheng, B., Li, Q., Huang, X., & Lin, Z. (2025). Curcumin and Selenium Synergistically Alleviate Oxidative Stress in IPEC-J2 Cells and ICR Mice. Biology, 14(9), 1117. https://doi.org/10.3390/biology14091117
