Humulus lupulus Promoting Osteoblast Activity and Bone Integrity: Effects and Mechanisms
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Care and Management
2.2. Hop Ethanol Extract Preparation
2.3. Study Design
2.4. Bone Structural Parameters
2.4.1. Bone Histomorphometry
2.4.2. Three-Point Bending Test
2.5. Ex Vivo Cell Cultures
2.5.1. Bone Marrow Stem Cell Isolation and Maintenance
2.5.2. BMSCs’ Osteogenic Differentiation
2.5.3. Gene Expression of Bone Marrow Stromal Cell Osteogenic and Pro/Anti-Resorptive Markers
2.6. Statistical Analysis
3. Results
3.1. General Observations
3.2. Bone Histomorphometry
3.3. Three-Point Bending Tests
3.4. Osteogenic Potential of Bone Marrow Stem Cells (BMSCs)
3.5. Gene Expression of Osteoblastic and Pro/Anti-Resorptive Markers
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| 6-PN | 6-prenylnaringenin |
| 8-PN | 8-prenylnaringenin |
| ALP | alkaline phosphatase activity |
| BMSCs | bone marrow stem cells |
| C | control group |
| DMEM | Dulbecco’s Modified Eagle Medium |
| Dy | displacement |
| Eabs | absorbed energy |
| E-Eabs | elastic absorbed energy |
| ER-α | estrogen receptor α |
| FBS | fetal bovine serum |
| Fmax | maximum load |
| Fy | yield load |
| H&E | hematoxylin–eosin |
| IGF-1 | insulin-like growth factor 1 |
| IL-1 | interleukin-1 |
| IL-6 | interleukin-6 |
| IXan | isoxanthohumol |
| LPL | hop extract |
| MMLV-RT | Moloney Murine Leukemia Virus Reverse Transcriptase |
| Oc | osteocalcin |
| OP | osteoporosis |
| OPG | osteoprotegerin |
| PBS | phosphate-buffered saline |
| P-Eabs | plastic absorbed energy |
| p-NP | p-nitrophenol |
| p-NPP | p-nitrophenyl phosphate |
| RANK | receptor activator of nuclear factor κB |
| RANKL | receptor activator of NFκB ligand |
| RT-PCR | reverse transcriptase polymerase chain reaction |
| Runx2 | Runt-related transcription factor 2 |
| T-Eabs | total absorbed energy |
| TGF-β | transforming growth factor-beta |
| TNF-α | tumor necrosis factor-alpha |
| Xan | xanthohumol |
References
- Wanionok, N.E.; Morel, G.R.; Fernández, J.M. Osteoporosis and Alzheimer’s disease (or Alzheimer’s disease and Osteoporosis). Ageing Res. Rev. 2024, 99, 102408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, N.; Cornelissen, D.; Silverman, S.; Pinto, D.; Si, L.; Kremer, I.; Bours, S.; de Bot, R.; Boonen, A.; Evers, S.; et al. An Updated Systematic Review of Cost-Effectiveness Analyses of Drugs for Osteoporosis. Pharmacoeconomics 2021, 39, 181–209. [Google Scholar] [CrossRef] [Scilit]
- Słupski, W.; Jawień, P.; Nowak, B. Botanicals in Postmenopausal Osteoporosis. Nutrients 2021, 13, 1609. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, L.; Chen, W.; Qian, A.; Li, Y.P. Wnt/β-catenin signaling components and mechanisms in bone formation, homeostasis, and disease. Bone Res. 2024, 12, 39. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Infante, A.; Rodríguez, C.I. Osteogenesis and aging: Lessons from mesenchymal stem cells. Stem Cell Res. Ther. 2018, 9, 244. [Google Scholar] [CrossRef] [Scilit]
- Han, Y.; You, X.; Xing, W.; Zhang, Z.; Zou, W. Paracrine and endocrine actions of bone-the functions of secretory proteins from osteoblasts, osteocytes, and osteoclasts. Bone Res. 2018, 6, 16. [Google Scholar] [CrossRef] [Scilit]
- Levin, E.R.; Vitek, W.S.; Hammes, S.R. Estrógenos, progestinas y tracto reproductor femenino. In Goodman & Gilman: Las Bases Farmacológicas de la Terapéutica, 13th ed.; Brunton, L.L., Hilal-Dandan, R., Knollmann, B.C., Eds.; McGraw-Hill: New York, NY, USA, 2019; pp. 803–832. [Google Scholar]
- Maeda, K.; Kobayashi, Y.; Koide, M.; Uehara, S.; Okamoto, M.; Ishihara, A.; Kayama, T.; Saito, M.; Marumo, K. The Regulation of Bone Metabolism and Disorders by Wnt Signaling. Int. J. Mol. Sci. 2019, 20, 5525. [Google Scholar] [CrossRef] [Scilit]
- Hoffmann, D.B.; Griesel, M.H.; Brockhusen, B.; Tezval, M.; Komrakova, M.; Menger, B.; Wassmann, M.; Stuermer, K.M.; Sehmisch, S. Effects of 8-Prenylnaringenin and Whole-Body Vibration Therapy on a Rat Model of Osteopenia. J. Nutr. Metab. 2016, 2016, 6893137. [Google Scholar] [CrossRef] [Scilit]
- Hümpel, M.; Isaksson, P.; Schaefer, O.; Kaufmann, U.; Ciana, P.; Maggi, A.; Schleuning, W.D. Tissue specificity of 8-prenylnaringenin: Protection from ovariectomy induced bone loss with minimal trophic effects on the uterus. J. Steroid Biochem. Mol. Biol. 2005, 97, 299–305. [Google Scholar] [CrossRef] [Scilit]
- Sehmisch, S.; Hammer, F.; Christoffel, J.; Seidlova-Wuttke, D.; Tezval, M.; Wuttke, W.; Stuermer, K.M.; Stuermer, E.K. Comparison of the phytohormones genistein, resveratrol and 8-prenylnaringenin as agents for preventing osteoporosis. Planta Med. 2008, 74, 794–801. [Google Scholar] [CrossRef] [Scilit]
- Tronina, T.; Popłoński, J.; Bartmańska, A. Flavonoids as Phytoestrogenic Components of Hops and Beer. Molecules 2020, 25, 4201. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lecomte, M.; Tomassi, D.; Rizzoli, R.; Tenon, M.; Berton, T.; Harney, S.; Fança-Berthon, P. Effect of a Hop Extract Standardized in 8-Prenylnaringenin on Bone Health and Gut Microbiome in Postmenopausal Women with Osteopenia: A One-Year Randomized, Double-Blind, Placebo-Controlled Trial. Nutrients 2023, 15, 2688. [Google Scholar] [CrossRef] [Scilit]
- Colareda, G.A.; Díaz, R.G.; Lojano-Gutierrez, L.C.; Matera, S.I.; Córdoba, O.L.; Flores, M.L.; Consolini, A.E. Cardioprotective and antispasmodic effects of Humulus lupulus (Hops) in an oral subacute treatment in rats. J. Biol. Act. Prod. Nat. 2024, 14, 463–480. [Google Scholar] [CrossRef] [Scilit]
- Wanionok, N.E.; Colareda, G.A.; Fernandez, J.M. In vitro effects and mechanisms of Humulus lupulus extract on bone marrow progenitor cells and endothelial cells. Mol. Cell Endocrinol. 2024, 592, 112328. [Google Scholar] [CrossRef] [Scilit]
- Torres, M.L.; Wanionok, N.E.; McCarthy, A.D.; Morel, G.R.; Fernández, J.M. Systemic oxidative stress in old rats is associated with both osteoporosis and cognitive impairment. Exp. Gerontol. 2021, 156, 111596. [Google Scholar] [CrossRef] [Scilit]
- Wanionok, N.E.; Molinuevo, M.S.; Fernández, J.M.; Besada, L.; Cortizo, A.M.; Castillo, E.J.; Jiron, J.M.; Sedlinsky, C.; Schurman, L.; Aguirre, J.I.; et al. Skeletal Effects of a Prolonged Oral Metformin Treatment in Adult Wistar Rats. Exp. Clin. Endocrinol. Diabetes 2024, 132, 547–556. [Google Scholar] [CrossRef] [Scilit]
- Molinuevo, M.S.; Schurman, L.; McCarthy, A.D.; Cortizo, A.M.; Tolosa, M.J.; Gangoiti, M.V.; Arnol, V.; Sedlinsky, C. Effect of metformin on bone marrow progenitor cell differentiation: In vivo and in vitro studies. J. Bone Miner. Res. 2010, 25, 211–221. [Google Scholar] [CrossRef] [Scilit]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Štulíková, K.; Karabín, M.; Nešpor, J.; Dostálek, P. Therapeutic Perspectives of 8-Prenylnaringenin, a Potent Phytoestrogen from Hops. Molecules 2018, 23, 660. [Google Scholar] [CrossRef] [Scilit]
- Minecka, A.; Zych, M.; Kaczmarczyk-Sedlak, I. 8-Prenylnaringenin from hop (Humulus lupulus L.)—A panacea for menopause? Herba Pol. 2017, 63, 34–44. [Google Scholar] [CrossRef] [Scilit]
- Pohjanvirta, R.; Nasri, A. The Potent Phytoestrogen 8-Prenylnaringenin: A Friend or a Foe? Int. J. Mol. Sci. 2022, 23, 3168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Solak, K.A.; Santos, R.R.; van den Berg, M.; Blaauboer, B.J.; Roelen, B.A.; van Duursen, M.B. Naringenin (NAR) and 8-prenylnaringenin (8-PN) reduce the developmental competence of porcine oocytes in vitro. Reprod. Toxicol. 2014, 49, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nowak, B.; Matuszewska, A.; Popłoński, J.; Nikodem, A.; Filipiak, J.; Tomanik, M.; Dziewiszek, W.; Danielewski, M.; Belowska-Bień, K.; Kłobucki, M.; et al. Prenylflavonoids counteract ovariectomy-induced disturbances in rats. J. Funct. Foods 2021, 86, 104742. [Google Scholar] [CrossRef] [Scilit]
- Lee, H.; Chung, S.H.; Kwon, D.J.; Nam, M.J.; Choi, J.H.; Suh, H.J.; Choi, H.S.; Han, S.H. Sleep-enhancing effect of Hongcheon-hop (Humulus lupulus L.) extract containing xanthohumol and humulone through GABAA receptor. J. Ethnopharmacol. 2025, 338 Pt 2, 119019. [Google Scholar] [CrossRef] [Scilit]
- Butterweck, V.; Brattstroem, A.; Grundmann, O.; Koetter, U. Hypothermic effects of hops are antagonized with the competitive melatonin receptor antagonist luzindole in mice. J. Pharm. Pharmacol. 2007, 59, 549–552. [Google Scholar] [CrossRef] [Scilit]
- Segawa, S.; Kuroda, H.; Kaneko, T.; Watari, J. Oral administration of a hop water extract ameliorates the development of dermatitis induced by the periodical topical application of a mite antigen in atopic dermatitis model NC/Nga mice. Biosci. Biotechnol. Biochem. 2008, 72, 974–981. [Google Scholar] [CrossRef] [Scilit]
- Sun, X.; Xia, T.; Zhang, S.; Zhang, J.; Xu, L.; Han, T.; Xin, H. Hops extract and xanthohumol ameliorate bone loss induced by iron overload via activating Akt/GSK3β/Nrf2 pathway. J. Bone Miner. Metab. 2022, 40, 375–388. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xia, T.S.; Xu, S.Y.; Lai, L.Y.; Jiang, Y.P.; Wang, N.N.; Xin, H.L. Bitter acids from Humulus lupulus L. alleviate D-galactose induced osteoblastic senescence and bone loss via regulating AKT/mTOR-mediated autophagy. J. Food Drug Anal. 2024, 32, 506–519. [Google Scholar] [CrossRef] [Scilit]
- Suh, K.S.; Rhee, S.Y.; Kim, Y.S.; Lee, Y.S.; Choi, E.M. Xanthohumol modulates the expression of osteoclast-specific genes during osteoclastogenesis in RAW264.7 cells. Food Chem. Toxicol. 2013, 62, 99–106. [Google Scholar] [CrossRef] [Scilit]
- Luo, D.; Kang, L.; Ma, Y.; Chen, H.; Kuang, H.; Huang, Q.; He, M.; Peng, W. Effects and mechanisms of 8-prenylnaringenin on osteoblast MC3T3-E1 and osteoclast-like cells RAW264.7. Food Sci. Nutr. 2014, 2, 341–350. [Google Scholar] [CrossRef] [Scilit]
- Xu, S.; Xia, T.; Zhang, J.; Jiang, Y.; Wang, N.; Xin, H. Protective effects of bitter acids from Humulus lupulus L. against senile osteoporosis via activating Nrf2/HO-1/NQO1 pathway in D-galactose induced aging mice. J. Funct. Foods 2022, 94, 105099. [Google Scholar] [CrossRef] [Scilit]
- Xia, T.S.; Lin, L.Y.; Zhang, Q.Y.; Jiang, Y.P.; Li, C.H.; Liu, X.Y.; Qin, L.P.; Xin, H.L. Humulus lupulus L. Extract Prevents Ovariectomy-Induced Osteoporosis in Mice and Regulates Activities of Osteoblasts and Osteoclasts. Chin. J. Integr. Med. 2021, 27, 31–38. [Google Scholar] [CrossRef] [Scilit]
- Keiler, A.M.; Helle, J.; Bader, M.I.; Ehrhardt, T.; Nestler, K.; Kretzschmar, G.; Bernhardt, R.; Vollmer, G.; Nikolić, D.; Bolton, J.L.; et al. A standardized Humulus lupulus (L.) ethanol extract partially prevents ovariectomy-induced bone loss in the rat without induction of adverse effects in the uterus. Phytomedicine 2017, 34, 50–58. [Google Scholar] [CrossRef] [Scilit]



| Marker | Genebank Code | Product Size (bp) | Sequence | |
|---|---|---|---|---|
| Housekeeping gene | ||||
| β-Actin | NM_031144.3 | 345 | Fw | CCTTCAACACCCCAGCCAT |
| Rv | CATAGCTCTTCTCCAGGGA | |||
| Markers regulating osteoblast/osteoclast differentiation | ||||
| Runx2 (2 bands) | XM_006244554.2 | 598/424 | Fw | GCCGGGAATGATGAGAACTA |
| Rv | TGAGAGAGGAAGGCCAGA | |||
| RANKL | NM_057149.1 | 432 | Fw | TCGCTCTGTTCCTGTACTTT |
| Rv | CCCTTAGTTTTCCGTTGCTT | |||
| OPG | U94330.1 | 408 | Fw | CTCCTGGCACCTACCTAA |
| Rv | GTGTTGCATTTCCTTTCTGA | |||
| t1 Col | NM_053304.1 | 651 | Fw | GCATACACAATGGCCTAA |
| Rv | CTGTTCCAGGCAATCCAC | |||
| ALP | J03572.1 | 737 | Fw | GACAGCAAGCCCAAGAGA |
| Rv | CAGTTCAGTGCGGTTCCA | |||
| Parameters | Control | LPL |
|---|---|---|
| Stiffness (N/mm) | 237.7 ± 12.9 | 392.4 ± 17.3 * |
| Yield Point (N) | 88.8 ± 3.5 | 120.5 ± 11.6 * |
| Maximum load (N) | 106.4 ± 8.7 | 147.5 ± 13.2 * |
| Work to fracture (T-Eabs, Nmm) | 18.4 ± 1.9 | 31.1 ± 4.0 * |
| P-Eabs (Nmm) | 15.4 ± 1.2 | 24.2 ± 3.4 |
| E-Eabs (Nmm) | 3.0 ± 1.0 | 6.9 ± 1.9 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wanionok, N.E.; Colareda, G.A.; Fernandez, J.M. Humulus lupulus Promoting Osteoblast Activity and Bone Integrity: Effects and Mechanisms. Biology 2025, 14, 582. https://doi.org/10.3390/biology14050582
Wanionok NE, Colareda GA, Fernandez JM. Humulus lupulus Promoting Osteoblast Activity and Bone Integrity: Effects and Mechanisms. Biology. 2025; 14(5):582. https://doi.org/10.3390/biology14050582
Chicago/Turabian StyleWanionok, Nahuel Ezequiel, Germán Andrés Colareda, and Juan Manuel Fernandez. 2025. "Humulus lupulus Promoting Osteoblast Activity and Bone Integrity: Effects and Mechanisms" Biology 14, no. 5: 582. https://doi.org/10.3390/biology14050582
APA StyleWanionok, N. E., Colareda, G. A., & Fernandez, J. M. (2025). Humulus lupulus Promoting Osteoblast Activity and Bone Integrity: Effects and Mechanisms. Biology, 14(5), 582. https://doi.org/10.3390/biology14050582

