Dietary Plant-Based Mixture Improves Feed Efficiency, Gross Profit, Physiological Performance, Gene Expression and Gut Health of Nile Tilapia (Oreochromis niloticus)
Simple Summary
Abstract
1. Introduction
2. Material and Methods
2.1. Fish and Experimental Facility
2.2. Experimental Diets and Feeding
2.3. Calculation of Growth and Feed Efficiency
- (a)
- Weight Gain (WG) = Final weight (Wf) − Initial weight (Wi); expressed in g;
- (b)
- Specific Growth Rate (SGR) = 100 × (ln Wf − ln Wi)/trial period (days); expressed in % day−1;
- (c)
- Feed Conversion Ratio (FCR) = Feed Intake (FI)/Body Weight Gain (WG);
- (d)
- Protein Efficiency Ratio (PER) = Body Weight Gain (WG)/Protein Intake (PI);
- (e)
- Survival = 100 × (Final stocked fish number/Initial stocked fish number); expressed as a percentage (%).
2.4. Economic Analysis
- -
- Total feed intake (kg m−3) = FCR × weight gain m−3.
- -
- Total feed cost (USD m−3) = amount of feed intake m−3 × feed price in USD kg−1.
- -
- Total fish sales (USD m−3) = fish yield (kg m−3) × fish price in USD kg−1.
- -
- Gross profit over feed cost (USD m−3) = total fish sale − total feed cost.
- -
- Profitability over the control diet (%) = 100 (profit from fish fed PAN diets − profit from fish fed the control diet)/profit from fish fed the control diet.
2.5. Whole Body Composition and Flesh Quality
2.6. Immunological and Antioxidant Enzyme Analysis
2.6.1. Phagocytic Activity
2.6.2. Lysozyme Activity
2.6.3. Alternative Complement Activity
2.6.4. Antioxidant Enzymes
2.7. Digestive Enzymes Analysis
2.8. Liver Function Enzymes
2.9. Expression of Cytokine Genes
2.10. Analysis of Gut Microbiota
2.11. Intestinal Histological Analysis
2.12. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Economical Analysis
3.3. Body Composition
3.4. Digestive and Hepatic Enzymes
3.5. Immunological and Antioxidant Responses
3.6. Cytokine Gene Expression
3.7. Gut Microbiota
3.8. Intestinal Histology
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- FAO. The State of World Fisheries and Aquaculture 2024—Blue Transformation in Action; Rome FAO: Rome, Italy, 2024; ISBN 978-92-5-138763-4. [Google Scholar]
- El-Sayed, A.F.M. Tilapia Culture, 2nd ed.; Elsevier/Academic Press: London, UK; San Diego, CA, USA, 2020; 348p. [Google Scholar]
- Eissa, E.-S.H.; Alaidaroos, B.A.; Jastaniah, S.D.; Munir, M.B.; Shafi, M.E.; Abd El-Aziz, Y.M.; Bazina, W.K.; Ibrahim, S.b.; Eissa, M.E.H.; Paolucci, M.; et al. Dietary Effects of Nano Curcumin on Growth Performances, Body Composition, Blood Parameters and Histopathological Alternation in Red Tilapia (Oreochromis sp.) Challenged with Aspergillus flavus. Fishes 2023, 8, 208. [Google Scholar] [CrossRef]
- Kennedy, D.A.; Kurath, G.; Brito, I.L.; Purcell, M.K.; Read, A.F.; Winton, J.R. Potential drivers of virulence evolution in aquaculture. Evol. Appl. 2016, 9, 344–354. [Google Scholar] [CrossRef] [PubMed]
- Maron, D.F.; Smith, T.J.; Nachman, K.E. Restrictions on antimicrobial use in food animal production: An international regulatory and economic survey. Glob. Health 2013, 9, 48. [Google Scholar] [CrossRef]
- Dawood, M.A.O.; Koshio, S. Recent advances in the role of probiotics and prebiotics in carp aquaculture: A review. Aquaculture 2016, 454, 243–251. [Google Scholar] [CrossRef]
- Amenyogbe, E.; Chen, G.; Wang, Z.; Huang, J.; Huang, B.; Li, H. The exploitation of probiotics, prebiotics and synbiotics in aquaculture: Present study, limitations and future directions: A review. Aquac. Int. 2020, 28, 1017–1041. [Google Scholar] [CrossRef]
- Rohani, M.F.; Islam, S.M.; Hossain, M.K.; Ferdous, Z.; Siddik, M.A.B.; Nuruzzaman, M. Probiotics, prebiotics and synbiotics improved the functionality of aquafeed: Upgrading growth, reproduction, immunity and disease resistance in fish. Fish Shellfish. Immunol. 2022, 120, 569–589. [Google Scholar] [CrossRef]
- Ameen, F.; Al-Niaeem, K.; Taher, M.M.; Sultan, F.A.H. Potential of plant extracts to inhibit the Ichthyophonus sp. infection in blue tilapia: A preliminary study in vitro. Natl. Acad. Sci. Lett. 2018, 41, 129–132. [Google Scholar] [CrossRef]
- Gabriel, N.N. Review on the progress in the role of herbal extracts in tilapia culture. Cogent Food Agric. 2019, 5, 1619651. [Google Scholar] [CrossRef]
- Ghosal, I.; Mukherjee, D.; Chakraborty, S.B. The effects of four plant extracts on growth, sex reversal, immunological and haemato-biochemical parameters in Nile tilapia, Oreochmomis niloticus (Linnaeus, 1758). Aquac Res 2021, 52, 559–576. [Google Scholar] [CrossRef]
- Reverter, M.; Bontemps, N.; Lecchini, D.; Banaigs, B.; Sasal, P. Use of plant extracts in fish aquaculture as an alternative to chemotherapy: Current status and future perspectives. Aquaculture 2014, 433, 50–61. [Google Scholar] [CrossRef]
- Bae, J.Y.; Park, G.H.; Lee, J.Y.; Okorie, O.E.; Bai, S.C. Effects of dietary propolis supplementation on growth performance, immune responses, disease resistance and body composition of juvenile eel, Anguilla japonica. Aquac. Int. 2012, 20, 513–523. [Google Scholar] [CrossRef]
- Eslami, M.; Zaretabar, A.; Dawood, M.A.O.; Mohammadzadeh, S.; Shahali, Y.; Ahmadifar, E. Can dietary ethanolic extract of propolis alter growth performance, digestive enzyme activity, antioxidant and immune indices in juvenile beluga sturgeon (Huso huso)? Aquaculture 2022, 552, 737–739. [Google Scholar] [CrossRef]
- Alrashada, Y.N.; Hassanien, H.A.; Abbas, A.O.; Alkhamis, S.A.; Alkobaby, A.I. Dietary propolis improves the growth performance, redox status and immune response of Nile tilapia upon a cold-stress challenge. Ranjan A, éditeur. PLoS ONE 2023, 18, e0293727. [Google Scholar] [CrossRef] [PubMed]
- Berretta, A.A.; Zamarrenho, L.G.; Correa, J.A.; De Lima, J.A.; Borini, G.B.; Ambrósio, S.R. Development and characterization of new green propolis extract formulations as promising candidates to substitute for green propolis hydroalcoholic extract. Molecules 2023, 28, 3510. [Google Scholar] [CrossRef] [PubMed]
- Hoa, T.T.T.; Fagnon, M.S.; Duyen, T.T.M.; Viet, L.Q.; Chabrillat, T.; Kerros, S. Dietary effect of botanical blend (Phyto AquaNityTM) on growth, immunity and survival of Pacific White shrimps challenged against WSSV. Aquac. Rep. 2024, 34, 101914. [Google Scholar] [CrossRef]
- Meurer, F.M.; Da Costa, M.; De Barros, D.A.D.; De Oliveira, S.T.; Da Paixão, P.S. Brown propolis extract in feed as a growth promoter of Nile tilapia (Oreochromis niloticus, Linnaeus 1758) fingerlings. Aquac. Res. 2009, 40, 603–608. [Google Scholar] [CrossRef]
- Dotta, G.; De Andrade, J.I.A.; Tavares Gonçalves, E.L.; Brum, A.; Mattos, J.J.; Maraschin, M. Leukocyte phagocytosis and lysozyme activity in Nile tilapia fed supplemented diet with natural extracts of propolis and Aloe barbadensis. Fish Shellfish. Immunol. 2014, 39, 280–294. [Google Scholar] [CrossRef]
- Hamed, H.S.; Abdel-Tawwab, M. Ameliorative effect of propolis supplementation on alleviating bisphenol-A toxicity: Growth performance, biochemical variables and oxidative stress biomarkers of Nile tilapia, Oreochromis niloticus (L.) fingerlings. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2017, 202, 63–79. [Google Scholar] [CrossRef] [PubMed]
- Acar, Ü. Effects of diet supplemented with ethanolic extract of propolis on growth performance, hematological and serum biochemical parameters and disease resistance of Mozambique tilapia (Oreochromis mossambicus) against Streptococcus iniae. Aquaculture 2018, 495, 339–344. [Google Scholar] [CrossRef]
- Hassaan, M.S.; El Nagar, A.G.; Salim, H.S.; Fitzsimmons, K.; El-Haroun, E.R. Nutritional mitigation of winter thermal stress in Nile tilapia by propolis-extract: Associated indicators of nutritional status, physiological responses and transcriptional response of delta-9-desaturase gene. Aquaculture 2019, 511, 734–756. [Google Scholar] [CrossRef]
- Qayyum, S.; Mehdi, A. Potential efficacy of Turmeric as an anti-inflammatory agent and antioxidant in the treatment of Osteoarthritis. Khyber Med. Univ. J. (KMUJ) 2023, 15, 190–197. [Google Scholar]
- Dehzad, M.J.; Ghalandari, H.; Nouri, M.; Askarpour, M. Antioxidant and anti-inflammatory effects of curcumin/turmeric supplementation in adults: A GRADE-assessed systematic review and dose–response meta-analysis of randomized controlled trials. Cytokine 2023, 164, 144–156. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Wang, X.; Li, X.; Lu, K.; Wang, L.; Ma, X. Antioxidant effects of the aqueous extract of turmeric against hydrogen peroxide-induced oxidative stress in spotted seabass (Lateolabrax maculatus). Aquac. Fish. 2024, 9, 71–77. [Google Scholar] [CrossRef]
- Yang, G.; Yu, R.; Qiu, H.; Wu, H.; Yan, Q.; Chen, W. Beneficial effects of emodin and curcumin supplementation on antioxidant defence response, inflammatory response and intestinal barrier of Pengze crucian carp (Carassius auratus var. Pengze). Aquac. Nutr. 2020, 26, 1958–1969. [Google Scholar] [CrossRef]
- Fagnon, M.S.; Thorin, C.; Calvez, S. Meta-analysis of dietary supplementation effect of turmeric and curcumin on growth performance in fish. Rev. Aquac. 2020, 12, 2268–2283. [Google Scholar] [CrossRef]
- Abdelrazek, H.M.A.; Tag, H.M.; Kilany, O.E.; Reddy, P.G. Hassan AM. Immuomodulatory effect of dietary turmeric supplementation on Nile tilapia (Oreochromis niloticus). Aquac. Nutr. 2017, 23, 1048–1054. [Google Scholar] [CrossRef]
- Alhawas, B.; Abd El-Hamid, M.I.; Hassan, Z.; Ibrahim, G.A.; Neamat-Allah, A.N.F.; Rizk El-Ghareeb, W. Curcumin loaded liposome formulation: Enhanced efficacy on performance, flesh quality, immune response with defense against Streptococcus agalactiae in Nile tilapia (Oreochromis niloticus). Fish Shellfish. Immunol. 2023, 138, 108776. [Google Scholar] [CrossRef] [PubMed]
- El Basuini, M.F.; Zaki, M.A.A.; El-Hais, A.M.; Elhanafy, M.G.; El-Bilawy, E.H.; Zaineldin, A.I. Microbial, immune and antioxidant responses of Nile tilapia with dietary nano-curcumin supplements under chronic low temperatures. Aquac. Fish. 2024, 9, 57–65. [Google Scholar] [CrossRef]
- Sruthi, M.V.; Nair, A.B.; Arun, D.; Thushara, V.V.; Sheeja, C.C.; Vijayasree, A.S. Dietary curcumin influences leptin, growth hormone and hepatic growth factors in Tilapia (Oreochromis mossambicus). Aquaculture 2018, 496, 105–111. [Google Scholar] [CrossRef]
- El-Sayed, A.M.; Figueiredo-Silva, C.; Zeid, S.M.S.; Makled, S.O. Metal–amino acid complexes (Zn, Se, Cu, Fe and Mn) enhance immune response, antioxidant capacity, liver function enzymes and expression of cytokine genes in Nile Tilapia reared under field conditions. J. Aquat. Anim. Health 2023, 35, 248–262. [Google Scholar] [CrossRef] [PubMed]
- Makled, S.O.; Hamdan, A.M.; El-Sayed, A.M. Effects of dietary supplementation of a marine thermotolerant bacterium, Bacillus paralicheniformis SO-1, on growth performance and immune responses of Nile tilapia, Oreochromis niloticus. Aquac. Nutr. 2019, 25, 817–827. [Google Scholar] [CrossRef]
- Sun, Y.Z.; Yang, H.L.; Ma, R.L.; Lin, W.Y. Probiotic applications of two dominant gut Bacillus strains with antagonistic activity improved the growth performance and immune responses of grouper Epinephelus coioides. Fish Shellfish. Immunol. 2010, 29, 803–809. [Google Scholar] [CrossRef]
- Yano, T.; Hatayama, Y.; Matsuyama, H.; Nakao, M. Titration of the alternative complement pathway activity of representative cultured fishes. Nippon. Suisan Gakkaishi 1988, 54, 1049–1054. [Google Scholar] [CrossRef]
- Prieto, A.I.; Pichardo, S.; Jos, Á.; Moreno, I.; Cameán, A.M. Time-dependent oxidative stress responses after acute exposure to toxic cyanobacterial cells containing microcystins in tilapia fish (Oreochromis niloticus) under laboratory conditions. Aquat. Toxicol. 2007, 84, 337–345. [Google Scholar] [CrossRef] [PubMed]
- Ashouri, S.; Keyvanshokooh, S.; Salati, A.P.; Johari, S.A.; Pasha-Zanoosi, H. Effects of different levels of dietary selenium nanoparticles on growth performance, muscle composition, blood biochemical profiles and antioxidant status of common Carp (Cyprinus carpio). Aquaculture 2015, 446, 25–29. [Google Scholar] [CrossRef]
- Khan, K.U.; Zuberi, A.; Nazir, S.; Fernandes JB, K.; Jamil, Z.; Sarwar, H. Effects of dietary selenium nanoparticles on physiological and biochemical aspects of juvenile Tor putitora. Turk. J. Zool. 2016, 40, 704–712. [Google Scholar] [CrossRef]
- Makled, S.O.; Hamdan, A.M.; El-Sayed, A.F.M. Growth promotion and immune stimulation in Nile tilapia, Oreochromis niloticus, fingerlings following dietary administration of a novel marine probiotic, Psychrobacter maritimus S. Probiotics Antimicrob. Prot. 2020, 12, 365–374. [Google Scholar] [CrossRef]
- Suzer, C.; Çoban, D.; Kamaci, H.O.; Saka, Ş.; Firat, K.; Otgucuoğlu, Ö. Lactobacillus spp. bacteria as probiotics in gilthead sea bream (Sparus aurata, L.) larvae: Effects on growth performance and digestive enzyme activities. Aquaculture 2008, 280, 140–155. [Google Scholar] [CrossRef]
- Reitman, S.; Frankel, S.A. Colorimetric method for the determination of serum glutamic oxalacetic and glutamic pyruvic transaminases. Am. J. Clin. Pathol. 1957, 28, 56–63. [Google Scholar] [CrossRef] [PubMed]
- Jiang, B.; Li, Q.; Zhang, Z.; Huang, Y.; Wu, Y.; Li, X.; Huang, M.; Huang, Y.; Jian, J. Selection and evaluation of stable reference genes for quantitative real-time PCR in the head kidney leukocyte of Oreochromis niloticus. Aquac. Rep. 2023, 31, 101660. [Google Scholar] [CrossRef]
- Spiegel, H.E.; Symington, J.A.; Hordynsky, W.E.; Babson, A.L. Colorimetric determination of lactate dehydrogenase (L-Lactate: Nad Oxidoreductase) activity. In Standard Methods of Clinical Chemistry; Elsevier: Amsterdam, The Netherlands, 1972; pp. 43–47. [Google Scholar]
- Opiyo, M.A.; Jumbe, J.; Ngugi, C.C.; Charo-Karisa, H. Dietary administration of probiotics modulates non-specific immunity and gut microbiota of Nile tilapia (Oreochromis niloticus) cultured in low input ponds. Int. J. Vet. Sci. Med. 2019, 7, 1–9. [Google Scholar] [CrossRef]
- Yusefi, M.; Mohammadi, A.H.; Salati, A.P. Effects of dietary sodium diformate on growth performance, immunological and biochemical blood indices, antioxidant capacity and thermal stress tolerance of juvenile common carp (Cyprinus carpio). Aquac. Rep. 2022, 22, 100963. [Google Scholar] [CrossRef]
- Standen, B.T.; Rodiles, A.; Peggs, D.L.; Davies, S.J.; Santos, G.A.; Merrifield, D.L. Modulation of the intestinal microbiota and morphology of tilapia, Oreochromis niloticus, following the application of a multi-species probiotic. Appl. Microbiol. Biotechnol. 2015, 99, 8403–8417. [Google Scholar] [CrossRef]
- Nelson, K.M.; Dahlin, J.L.; Bisson, J.; Graham, J.; Pauli, G.F.; Walters, M.A. The Essential Medicinal Chemistry of Curcumin: Miniperspective. J. Med. Chem. 2017, 60, 1620–1637. [Google Scholar] [CrossRef]
- EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP); Bampidis, V.; Azimonti, G.; Bastos, M.-L.; Christensen, H.; Kos, D.M. Safety and efficacy of turmeric extract, turmeric oil, turmeric oleoresin and turmeric tincture from Curcuma longa L. rhizome when used as sensory additives in feed for all animal species. EFSA 2020, 18, e06146. [Google Scholar]
- Li, X.; Wu, L.; Duan, L.; Wang, W.; Zhao, P.; Wu, M. Effects of dietary curcumin on growth and flesh quality in juvenile Genetically Improved Farmed Tilapia (GIFT, Oreochromis niloticus). Aquac. Res. 2023, 2023, 1–11. [Google Scholar] [CrossRef]
- Santos, E.L.; Barbosa, J.M.; Porto-Neto, F.F.; Ludke, J.V.; Silva, T.J.; Lima, M.R. Propolis extract as a feed additive of the Nile tilapia juveniles. Arq. Bras. Med. Vet Zootec. 2023, 75, 744–752. [Google Scholar] [CrossRef]
- Mahfouz, M.E. Ameliorative effect of curcumin on aflatoxin B1-induced changes in liver gene expression of Oreochromis niloticus. Mol. Biol. 2015, 49, 313–324. [Google Scholar] [CrossRef]
- Mahmoud, H.K.; Al-Sagheer, A.A.; Reda, F.M.; Mahgoub, S.A.; Ayyat, M.S. Dietary curcumin supplement influence on growth, immunity, antioxidant status and resistance to Aeromonas hydrophila in Oreochromis niloticus. Aquaculture 2017, 475, 16–23. [Google Scholar] [CrossRef]
- Hassan, A.A.M.; Yacout, M.H.; Khalel, M.S.; Hafsa, S.H.A.; Ibrahim, M.A.R.; Mocuta, D.N. Effects of some herbal plant supplements on growth performance and the immune response in Nile Tilapia (Oreochromis niloticus). Agric. Life Life Agric. Conf. Proc. 2018, 1, 134–141. [Google Scholar] [CrossRef]
- El-abd, H.; Abd El-Latif, A.; Shaheen, A. Effect of curcumin on growth performance and antioxidant stress status of Nile tilapia (Oreochromis niloticus). Iran. J. Fish. Sci. 2021, 20, 1234–1246. [Google Scholar]
- Amer, S.A.; El-Araby, D.A.; Tartor, H.; Farahat, M.; Goda, N.I.A.; Farag, M.F.M. Long-term feeding with curcumin affects the growth, antioxidant capacity, immune status, tissue histoarchitecture, immune expression of proinflammatory cytokines and apoptosis indicators in Nile tilapia, Oreochromis niloticus. Antioxidants 2022, 11, 937. [Google Scholar] [CrossRef]
- Kujumgiev, A.; Tsvetkova, I.; Serkedjieva, Y.; Bankova, V.; Christov, R.; Popov, S. Antibacterial, antifungal and antiviral activity of propolis of different geographic origin. J. Ethnopharmacol. 1999, 64, 235–240. [Google Scholar] [CrossRef] [PubMed]
- Midhun, S.J.; Arun, D.; Edatt, L.; Sruthi, M.V.; Thushara, V.V.; Oommen, O.V. Modulation of digestive enzymes, GH, IGF-1 and IGF-2 genes in the teleost, Tilapia (Oreochromis mossambicus) by dietary curcumin. Aquac. Int. 2016, 24, 1277–1286. [Google Scholar] [CrossRef]
- Salem, M.E.; Almisherfi, H.M.; El-Sayed, A.F.M.; Makled, S.O.; Abdel-Ghany, H.M. Modulatory effects of dietary prickly pear (Opuntia ficus-indica) peel on high salinity tolerance, growth rate, immunity and antioxidant capacity of Nile tilapia (Oreochromis niloticus). Fish Physiol. Biochem. 2024, 50, 543–556. [Google Scholar] [CrossRef] [PubMed]
- Abdel-Ghany, H.M.; El-Sisy, D.M.; Salem, M.E.S. A comparative study of effects of curcumin and its nanoparticles on the growth, immunity and heat stress resistance of Nile tilapia (Oreochromis niloticus). Sci. Rep. 2023, 13, 2523. [Google Scholar] [CrossRef]
- Yang, J.; Hong, J.; Fu, Z.; Ma, Z. Effects of dietary curcumin on growth and digestive physiology of Seriola dumerili. Front. Mar. Sci. 2022, 9, 862379. [Google Scholar] [CrossRef]
- De Albuquerque, N.C.P.; Tadini, M.C.; Aguillera, F.A.L.S.; Ballestero, G.; Teixeira, T.V.; Marquele, D.-O.F. Citrus, milk thistle and propolis extracts improved the intestinal permeability of curcuminoids from turmeric extract─ an In Silico and In Vitro permeability Caco-2 Cells approach. ACS Food Sci. Technol. 2023, 3, 113–122. [Google Scholar] [CrossRef]
- Patel, D.K.; Patel, K.; Gadewar, M.; Tahilyani, V. Pharmacological and bioanalytical aspects of galangin-a concise report. Asian Pac. J. Trop. Biomed. 2012, 2, S449–S455. [Google Scholar] [CrossRef]
- Naz, S.; Imran, M.; Rauf, A.; Orhan, I.E.; Shariati, M.A.; Iahtisham, U.l. Chrysin: Pharmacological and therapeutic properties. Life Sci. 2019, 235, 116797. [Google Scholar] [CrossRef] [PubMed]
- Sahinler, N.; Kaftanoglu, O. Natural product propolis: Chemical composition. Nat. Prod. Res. 2005, 19, 183–188. [Google Scholar] [CrossRef] [PubMed]
- Rufatto, L.C.; Dos Santos, D.A.; Marinho, F.; Henriques, J.A.P.; Roesch, E.M.; Moura, S. Red propolis: Chemical composition and pharmacological activity. Asian Pac. J. Trop. Biomed. 2017, 7, 591–598. [Google Scholar] [CrossRef]
- Zhang, H.A.; Kitts, D.D. Turmeric and its bioactive constituents trigger cell signaling mechanisms that protect against diabetes and cardiovascular diseases. Mol. Cell Biochem. 2021, 476, 3785–3814. [Google Scholar] [CrossRef]
- Huang, M.T. Antioxidant and antitumorigenic properties of curcumin. In Food Factors for Cancer Prevention; Ohigashi, H., Osawa, T., Terao, J., Watanabe, S., Yoshikawa, T., Eds.; Springer: Tokyo, Japan, 1997; pp. 249–252. [Google Scholar]
- Tanvir, E.M.; Hossen, M.D.S.; Hossain, M.D.F.; Afroz, R.; Gan, S.H.; Khalil, M.D.I. Antioxidant properties of popular turmeric (Curcuma longa) varieties from Bangladesh. J. Food Qual. 2017, 8471785. [Google Scholar] [CrossRef]
- Somparn, P.; Phisalaphong, C.; Nakornchai, S.; Unchern, S.; Morales, N.P. Comparative antioxidant activities of curcumin and its demethoxy and hydrogenated derivatives. Biol. Pharm. Bull. 2007, 30, 74–78. [Google Scholar] [CrossRef] [PubMed]
- Liu, G.; Ye, Z.; Liu, D.; Zhao, J.; Sivaramasamy, E.; Deng, Y. Influence of stocking density on growth, digestive enzyme activities, immune responses, antioxidant of Oreochromis niloticus fingerlings in biofloc systems. Fish Shellfish. Immunol. 2018, 81, 416–422. [Google Scholar] [CrossRef]
- El-Guendouz, S.; Lyoussi, B.; Miguel, M.G. Insight on propolis from Mediterranean countries: Chemical composition, biological activities and application fields. Chem. Biodivers. 2019, 16, e1900094. [Google Scholar] [CrossRef]
- Cao, L.; Ding, W.; Du, J.; Jia, R.; Liu, Y.; Zhao, C. Effects of curcumin on antioxidative activities and cytokine production in Jian carp (Cyprinus carpio var. Jian) with CCl4-induced liver damage. Fish Shellfish. Immunol. 2015, 43, 150–157. [Google Scholar] [CrossRef] [PubMed]
- El-Barbary, M.I. Detoxification and antioxidant effects of garlic and curcumin in Oreochromis niloticus injected with aflatoxin B1 with reference to gene expression of glutathione peroxidase (GPx) by RT-PCR. Fish Physiol. Biochem. 2016, 42, 617–629. [Google Scholar] [CrossRef] [PubMed]
- Kong, Y.; Li, M.; Guo, G.; Yu, L.; Sun, L.; Yin, Z. Effects of dietary curcumin inhibit deltamethrin-induced oxidative stress, inflammation and cell apoptosis in Channa argus via Nrf2 and NF-κB signaling pathways. Aquaculture 2021, 540, 736744. [Google Scholar] [CrossRef]
- Peddie, S.; Zou, J.; Secombes, C.J. Immunostimulation in the rainbow trout (Oncorhynchus mykiss) following intraperitoneal administration of Ergosan. Vet. Immunol. Immunopathol. 2002, 86, 101–113. [Google Scholar] [CrossRef] [PubMed]
- Machado, J.L.; Assunção, A.K.M.; Da Silva, M.C.P.; Reis, A.S.D.; Costa, G.C.; Arruda, D.D.S. Brazilian green propolis: Anti-inflammatory property by an immunomodulatory activity. Evid. -Based Complement. Altern. Med. 2012, 157652. [Google Scholar] [CrossRef] [PubMed]
- Yuan, L.; Wang, L.; Li, Z.H.; Zhang, M.Q.; Shao, W.; Sheng, G.P. Antibiotic resistance and microbiota in the gut of Chinese four major freshwater carp from retail markets. Environ. Pollut. 2019, 255, 113327. [Google Scholar] [CrossRef] [PubMed]
- Yusuf, M.S.; Hassan, M.A.; Tag, H.M.; Sarivistava, K.; Reddy, P.G.; Hasssan, A.M. Influence of turmeric (Curcuma longa) on performance, histomorphology and microbiota of intestine in juvenile Tilapia (Oreochromis niloticus). Int. J. Agric. Sci. Vet. Med. 2017, 5, 7–16. [Google Scholar]
- Moghadam, H.; Sourinejad, I.; Johari, S.A. Digestive enzyme activities, intestinal histology and gut microbiota of Pacific white shrimp Litopenaeus vannamei fed with turmeric, curcumin and nanomicelle curcumin. Aquac. Int. 2023, 31, 15–30. [Google Scholar] [CrossRef]
- Grondin, J.A.; Kwon, Y.H.; Far, P.M.; Haq, S.; Khan, W.I. Mucins in intestinal mucosal defense and inflammation: Learning from clinical and experimental studies. Front. Immunol. 2020, 11, 2054. [Google Scholar] [CrossRef] [PubMed]
- Mountford-McAuley, R.; Prior, J.; Clavijo McCormick, A. Factors affecting propolis production. J. Apic. Res. 2023, 62, 162–170. [Google Scholar] [CrossRef]
- Gültepe, N.; Acar, Ü.; Kesbiç, O.S.; Yılmaz, S.; Yıldırım, Ö.; Türker, A. Effects of dietary Tribulus terrestris extract supplementation on growth, feed utilization, hematological, immunological, and biochemical variables of Nile tilapia Oreochromis niloticus. Isr. J. Aquac. Bamidgeh 2014, 66, 1024. [Google Scholar] [CrossRef]
- Yin, G.; Jeney, G.; Racz, T.; Xu, P.; Jun, X.; Jeney, Z. Effect of two Chinese herbs (Astragalus radix and Scutellaria radix) on non-specific immune response of tilapia, Oreochromis niloticus. Aquaculture 2006, 253, 39–47. [Google Scholar] [CrossRef]
- Gad, F.A.M.; Emam, M.A.; Shourbela, R.M.; Younis, E.M.; Abdelwarith, A.A.; Davies, S.J.; Mahboub, H.H.; Elabd, H. The influence of various doses of Moringa oleifera extract on the antioxidant trait, cytokines, reproductive hormones performance, and gonadal histological profiles of Nile tilapia. Aquac. Int. 2024, 32, 7103–7118. [Google Scholar] [CrossRef]
- Ashry, A.M.; Hassan, A.M.; Habiba, M.M.; El-Zayat, A.; El-Sharnouby, M.E.; Sewilam, H.; Dawood, M.A. The impact of dietary curcumin on the growth performance, intestinal antibacterial capacity, and haemato-biochemical parameters of gilthead seabream (Sparus aurata). Animals 2021, 11, 1779. [Google Scholar] [CrossRef] [PubMed]
- Yonar, M.E.; Yonar, S.M.; İspir, Ü.; Ural, M.Ş. Effects of curcumin on haematological values, immunity, antioxidant status and resistance of rainbow trout (Oncorhynchus mykiss) against Aeromonas salmonicida subsp. achromogenes. Fish Shellfish. Immunol. 2019, 89, 83–90. [Google Scholar] [CrossRef] [PubMed]
- Kaplan, Ç.; Erdoğan, F. Effect of dietary propolis on growth, body composition, and serum biochemistry of juvenile sea bream (Sparus aurata). Aquac. Int. 2021, 29, 553–563. [Google Scholar] [CrossRef]




| Ingredient | PAN Level (g kg−1) | |||
|---|---|---|---|---|
| 0 (C) | 0.25 | 0.50 | 1.00 | |
| Local fishmeal (54% cp) | 30.00 | 30.00 | 30.00 | 30.00 |
| Poultry by-product meal (54% cp) | 75.00 | 75.00 | 75.00 | 75.00 |
| Soybean meal (46% cp) | 425.00 | 425.00 | 425.00 | 425.00 |
| Wheat bran | 287.00 | 287.00 | 287.00 | 287.00 |
| Rice bran | 115.00 | 115.00 | 115.00 | 115.00 |
| Corn | 51.15 | 50.90 | 50.65 | 50.15 |
| Soybean oil | 6.00 | 6.00 | 6.00 | 6.00 |
| Monocalcium phosphate | 4.00 | 4.00 | 4.00 | 4.00 |
| Sodium bicarbonate | 1.00 | 1.00 | 1.00 | 1.00 |
| Calcium carbonate | 1.00 | 1.00 | 1.00 | 1.00 |
| Vitamin a and mineral premix b | 2.00 | 2.00 | 2.00 | 2.00 |
| Vitamin C | 0.50 | 0.50 | 0.50 | 0.50 |
| Methionine | 0.50 | 0.50 | 0.50 | 0.50 |
| Lysine | 0.50 | 0.50 | 0.50 | 0.50 |
| Anti-toxin | 1.00 | 1.00 | 1.00 | 1.00 |
| Emulsifier | 0.25 | 0.25 | 0.25 | 0.25 |
| Phytase enzyme (mL kg−1) | 0.125 | 0.125 | 0.125 | 0.125 |
| Phyto AquaNity (PAN) | 0.00 | 0.25 | 0.50 | 1.00 |
| Proximate analysis | ||||
| Moisture | 7.80 | 8.50 | 8.70 | 8.90 |
| Crude protein | 30.50 | 30.10 | 30.00 | 30.30 |
| Crude lipid | 5.60 | 5.41 | 5.92 | 5.58 |
| Ash | 8.40 | 7.8 | 8.1 | 7.80 |
| Crude fiber | 4.00 | 4.20 | 4.00 | 4.10 |
| NFE c | 43.70 | 44.20 | 43.40 | 43.40 |
| Gross energy (MJ kg−1) d | 17.10 | 17.02 | 17.05 | 16.98 |
| Gene | Forward Sequence (5′ → 3′) | Accession No | Amplification Efficiency (%) | Product Length (bp) |
|---|---|---|---|---|
| IL-12 | F (5′ → 3′): GGGTGCGAGTCAGCTATGAG R (5′ → 3′): GGTTGTGGATTGGTTGCGTC | XM_003437924.4 | 99.1 | 159 |
| IL-1β | F (5′ → 3′): GACACTGCTTCTGAACTACAAGT R (5′ → 3′): TCAGCACTGGCTCTGAAGTG | XM_019365844.2 | 98.4 | 209 |
| TNF-α | F (5′ → 3′): GCAGCTGAATGAACCTCTCAC R (5′ → 3′): GTTCTCAGTCTGTCCCCAGC | XM_013266976.3 | 98.7 | 760 |
| TGF-1β | F (5′ → 3′): GTCCTGCAAGTGCAGCTAGA R (5′ → 3′): CATGCCTGTGTGAAACGACTG | XM_005463992.4 | 99.4 | 137 |
| IFN-γ | F (5′ → 3′): GGGTGGTGTTTTGGAGTCGT R (5′ → 3′): CATCTGTGCCTGGTAGCGAG | XM_013266976.3 | 97.7 | 161 |
| IL-4 | F (5′ → 3′): CAGCGAGAGAGAACTCGTGC R (5′ → 3′): GGTTTCCTTCTCCGTCGTGT | NM_214123.1 | 98.3 | 80 |
| CAT | F (5′ → 3′): TCCTGAATGAGGAGGAGCGA R (5′ → 3′): ATCTTAGATGAGGCGGTGATG | XM_003447521.5 | 97.5 | 129 |
| β-Actin | F: ACAACTCAGGCGCAGAGAAT R: TCCTGAGTCAAGCGCCAAAA | XM_003443127.5 | 99.7 | 73 |
| Parameter | PAN0 (C) | PAN0.25 | PAN0.5 | PAN1 |
|---|---|---|---|---|
| Growth and feed efficiency | ||||
| Wi (g fish−1) | 74.86 ± 1.27 | 74.55 ± 0.82 | 73.59 ± 1.10 | 73.88 ± 0.67 |
| Wf (g fish−1) | 186.10 ± 2.29 a | 184.85 ± 2.02 a | 190.72 ± 4.09 a | 187.48 ± 3.39 a |
| WG (g fish−1) | 111.24 ± 3.27 a | 110.30 ± 2.18 a | 117.13 ± 5.21 a | 112.60 ± 6.94 a |
| WG (%) | 148.68 ± 6.17 a | 147.95 ± 1.45 a | 159.11 ± 3.14 a | 152.54 ± 11.61 a |
| SGR (% day−1) * | 1.15 ± 0.02 a | 1.12 ± 0.01 a | 1.19 ± 0.02 a | 1.15 ± 0.06 a |
| FI (g fish−1) | 161.76 ± 3.51 a | 149.29 ± 1.78 b | 143.05 ± 2.35 b | 147.46 ± 3.29 b |
| FCR * | 1.46 ± 0.03 a | 1.35 ± 0.01 b | 1.24 ± 0.03 c | 1.31 ± 0.05 b,c |
| PER * | 2.25 ± 0.05 a | 2.45 ± 0.02 a,b | 2.69 ± 0.08 b | 2.53 + 0.20 b |
| Economic analysis | ||||
| Fish production (kg m−1) | 3.72 ± 0.05 a | 3.70 ± 0.04 a | 3.75 ± 0.02 a | 3.73 ± 0.07 a |
| Fish sale (USD m−1) | 7.82 ± 0.10 a | 7.76 ± 0.08 a | 7.87 ± 0.05 a | 7.83 ± 0.14 a |
| Gross profit (USD m−1) | 4.58 ± 0.10 a | 4.76 ± 0.07 a | 5.00 ± 0.05 b | 4.84 ± 0.11 b,a |
| Profitability (%) over the control diet | 4.08 ± 1.46a | 9.24 ± 1.13 b | 5.67 ± 2.29 a |
| Parameter (%) | Initial | PAN0 (C) | PAN0.25 | PAN0.5 | PAN1 |
|---|---|---|---|---|---|
| Moisture | 75.13 | 74.57 ± 0.25 | 74.30 ± 1.39 | 75.21 ± 0.39 | 74.70 ± 0.48 |
| Crude protein | 18.96 | 21.38 ± 0.45 | 21.51 ± 1.56 | 20.71 ± 0.51 | 20.78 ± 0.11 |
| Crude lipid | 3.09 | 2.45 ± 0.26 | 2.67 ± 0.26 | 2.63 ± 0.41 | 3.04 ± 0.54 |
| Ash | 1.81 | 1.49 ± 0.09 | 1.47 ± 0.20 | 1.41 ± 0.07 | 1.49 ± 0.10 |
| Enzymes | PAN0 (C) | PAN0.25 | PAN0.5 | PAN1 |
|---|---|---|---|---|
| Amylase (U mg−1) | 21.58 ± 2.36 a | 27.10 ± 1.95 b | 38.02 ± 2.02 c | 40.58 ± 0.89 c |
| Lipase (U mg−1) | 50.12 ± 2.44 a | 55.29 ± 3.46 a | 72.21 ± 3.66 b | 73.39 ± 3.73 b |
| Protease (U mg−1) | 62.18 ± 2.74 a | 71.69 ± 3.10 b | 85.10 ± 2.34 c | 87.26 ± 3.66 c |
| AST (U L−1) | 16.67 ± 2.08 a | 13.33 ± 1.00 a,b | 10.33 ± 0.57 b | 12.33 ± 0.57 b |
| ALT (U L−1) | 10.67 ± 1.15 a | 8.00 ± 1.00 a,b | 5.66 ± 0.57 b | 7.33 ± 1.15 b |
| LDH (U L−1) | 135.48 ± 4.52 a | 129.94 ± 0.50 a,b | 123.77 ± 2.20 b | 125.82 ± 2.29 b |
| Parameter | PAN0 (C) | PAN0.25 | PAN0.5 | PAN1 |
|---|---|---|---|---|
| PA (µM mL−1) | 1.22 ± 0.04 a | 1.26 ± 0.03 a | 1.47 ± 0.09 b | 1.51 ± 0.05 b |
| PO (mU mL−1) | 98.63 ± 2.13 a | 104.4 ± 2.26 a,b | 111.0 ± 2.27 b,c | 111.3 ± 1.33 c |
| ACH50 (ng mL−1) | 44.16 ± 2.62 a | 50.25 ± 1.05 b | 56.58 ± 2.49 c | 60.19 ± 2.63 c |
| LSZ (ng mL−1) | 82.57 ± 0.55 a | 87.85 ± 1.59 b | 101.30 ± 2.76 c | 104.9 ± 2.16 c |
| SOD (mU mL−1) | 29.93 ± 2.06 a | 31.42 ± 0.95 a | 39.64 ± 1.41 b | 39.62 ± 2.00 b |
| MDA (mU mL−1) | 23.41 ± 2.51 a | 17.13 ± 1.75 b | 14.14 ± 1.07 b | 13.41 ± 1.87 b |
| GPx (mU mL−1) | 3.47 ± 0.12 a | 4.35 ± 0.09 b | 4.51 ± 0.07 b | 4.55 ± 0.15 b |
| Catalase | 447.57 ± 12.39 a | 520.30 ± 8.80 b | 530.90 ± 8.61 b | 535.57 ± 4.40 b |
| Gene | PAN0 (C) | PAN0.25 | PAN0.5 | PAN1 |
|---|---|---|---|---|
| IFN-γ (pg mL−1) | 128.23 ± 1.16 a | 132.57 ± 0.55 b | 137.0 ± 1.21 c | 136.57 ± 0.47 c |
| TNF-α (copies mL−1) | 338.47 ± 1.92 a | 342.9 ± 0.8 b | 348.83 ± 0.76 c | 350.1 ± 2.45 c |
| TGF-1β (pg mL−1) | 65.60 ± 1.14 a | 66.63 ± 0.55 a,b | 69.83 ± 1.13 b,c | 72.07 ± 1.63 c |
| IL-1β (copies mL−1) | 563.57 ± 1.32 a | 569.70 ± 0.45 b | 575.03 ± 1.51 c | 582.57 ± 2.17 d |
| IL-4 (copies mL−1) | 81.33 ± 1.52 a | 88.33 ± 1.52 b | 96.67 ± 1.52 c | 100.67 ± 1.15 c |
| IL-12 (copies mL−1) | 244.33 ± 1.15 a | 258.67 ± 6.03 b | 276.67 ± 2.08 c | 279.00 ± 1.73 c |
| CAT (ng g−1) | 379.97 ± 0.66 a | 382.87 ± 1.07 b | 383.0 ± 0.66 b | 383.53 ± 0.41 b |
| Treatment | PAN0 | PAN0.25 | PAN 0.50 | PAN1 |
|---|---|---|---|---|
| Total bacterial counts | 142.67 ± 5.37 a | 185.67 ± 6.03 b | 217.00 ± 4.42 c | 206.33 ± 2.97 d |
| Beneficial bacterial counts | 44.33 ± 4.04 a | 112.3 ± 10.78 b | 158.3 ± 5.68 c | 142.0 ± 2.64 d |
| Total pathogenic bacterial counts | 98.33 ± 7.63 a | 73.33 ± 6.11 b | 58.33 ± 6.50 b,c | 64.33 ± 5.85 b,c |
| Parameters | PAN0 (C) | PAN0.25 | PAN0.5 | PAN1 |
|---|---|---|---|---|
| Anterior gut: | ||||
| Intestinal fold length (µm) | 133.21 ± 9.75 a | 138.20 ± 13.56 a | 175.0 ± 12.02 b | 197.0 ± 8.57 b |
| Interfold space (µm) | 80.40 ± 1.36 a | 73.83 ± 5.74 a | 68.45 ± 6.10 a,b | 60.13 ± 6.93 b |
| Goblet cells number (mm−2) | 51.99 ± 3.50 a | 57.91 ± 4.73 a,b | 67.19 ± 3.62 b,c | 72.84 ± 3.76 c |
| Middle gut | ||||
| Intestinal fold length (µm) | 155.4 ± 13.12 a | 203.0 ± 13.47 b | 284.5 ± 10.99 c | 305.5 ± 15.58 c |
| Interfold space (µm) | 61.00 ± 5.74 a | 40.04 ± 2.73 b | 36.59 ± 5.62 b | 32.62 ± 6.62 b |
| Goblet cells number (mm−2) | 77.62 ± 6.20 a | 88.98 ± 3.80 a,b | 101.43 ± 6.44 b | 107.1 ± 7.56 b |
| Posterior gut | ||||
| Intestinal fold length (µm) | 80.60 ± 5.76 a | 99.55 ± 2.09 a | 126.5 ± 7.41 b | 132.1 ± 8.99 b |
| Interfold space (µm) | 126.00 ± 24.61 a | 90.95 ± 2.08 b | 82.80 ± 1.98 b | 74.62 ± 8.12 b |
| Goblet cells number (mm−2) | 28.27 ± 2.31 a | 46.93 ± 9.95 b | 53.18 ± 8.28 b | 55.29 ± 4.53 b |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
El-Sayed, A.-F.M.; Fagnon, M.S.; Hamdan, A.M.; Chabrillat, T.; Kerros, S.; Zeid, S.M.S. Dietary Plant-Based Mixture Improves Feed Efficiency, Gross Profit, Physiological Performance, Gene Expression and Gut Health of Nile Tilapia (Oreochromis niloticus). Biology 2025, 14, 186. https://doi.org/10.3390/biology14020186
El-Sayed A-FM, Fagnon MS, Hamdan AM, Chabrillat T, Kerros S, Zeid SMS. Dietary Plant-Based Mixture Improves Feed Efficiency, Gross Profit, Physiological Performance, Gene Expression and Gut Health of Nile Tilapia (Oreochromis niloticus). Biology. 2025; 14(2):186. https://doi.org/10.3390/biology14020186
Chicago/Turabian StyleEl-Sayed, Abdel-Fattah M., Mahougnon Simeon Fagnon, Amira M. Hamdan, Thibaut Chabrillat, Sylvain Kerros, and Salma M. S. Zeid. 2025. "Dietary Plant-Based Mixture Improves Feed Efficiency, Gross Profit, Physiological Performance, Gene Expression and Gut Health of Nile Tilapia (Oreochromis niloticus)" Biology 14, no. 2: 186. https://doi.org/10.3390/biology14020186
APA StyleEl-Sayed, A.-F. M., Fagnon, M. S., Hamdan, A. M., Chabrillat, T., Kerros, S., & Zeid, S. M. S. (2025). Dietary Plant-Based Mixture Improves Feed Efficiency, Gross Profit, Physiological Performance, Gene Expression and Gut Health of Nile Tilapia (Oreochromis niloticus). Biology, 14(2), 186. https://doi.org/10.3390/biology14020186

