Evaluation of the Sedative Effect of Limonene to Reduce Stress During Transportation of Gilthead Seabream (Sparus aurata)
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics
2.2. Determination of the Optimal Sedative Concentration of Limonene
2.3. Behaviour Analyses with Video Recording
2.4. Short-Distance Transport Simulation and Sampling
2.5. Analysis
2.5.1. Water Parameters
2.5.2. Osmolality and Ion Levels in Plasma and Water
2.5.3. Cortisol in Plasma
2.5.4. Metabolites in Plasma and Liver
2.5.5. Gene Expression in the Head Kidney
2.6. Statistics
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ashley, P.J. Fish welfare: Current issues in aquaculture. Appl. Anim. Behav. Sci. 2007, 104, 199–235. [Google Scholar] [CrossRef] [Scilit]
- Schreck, C.B.; Tort, L. The Concept of Stress in Fish. In Fish Physiology: Biology of Stress in Fish; Schreck, C.B., Tort, L., Farrell, A.P., Brauner, C.J., Eds.; Academic Press: Cambridge, MA, USA, 2016; pp. 1–34. [Google Scholar] [CrossRef] [Scilit]
- Aydın, B.; Barbas, L.A.L. Sedative and anesthetic properties of essential oils and their active compounds in fish: A review. Aquaculture 2020, 520, 734999. [Google Scholar] [CrossRef] [Scilit]
- Nair, V.R.; Parvathy, U.; Jithin, T.J.; Binsi, P.K.; Ravishankar, C.N. Live transportation of food fishes: Current scenario and future prospects. Curr. Sci. 2023, 124, 00113891. [Google Scholar] [CrossRef] [Scilit]
- Fang, D.; Mei, J.; Xie, J.; Qiu, W. The Effects of Transport Stress (Temperature and Vibration) on Blood Biochemical Parameters, Oxidative Stress, and Gill Histomorphology of Pearl Gentian Groupers. Fishes 2023, 8, 218. [Google Scholar] [CrossRef] [Scilit]
- Martín, I.; Gutierrez, J.R.; Martos-Sitcha, J.A.; Rasines, I.; Rodríguez, C.; Mancera, J.M.; Chereguini, O. Prolonged emersion of Solea senegalensis, Kaup 1858, for its application in transport. Aquac. Res. 2017, 48, 3393–3400. [Google Scholar] [CrossRef] [Scilit]
- Bonga, S.W. Hormonal responses to stress|Hormone Response to Stress. In Encyclopedia of Fish Physiology; Elsevier: Amsterdam, The Netherlands, 2011; pp. 1515–1523. [Google Scholar] [CrossRef] [Scilit]
- Gorissen, M.; Flik, G. The Endocrinology of the Stress Response in Fish. In Fish Physiology: Biology of Stress in Fish; Schreck, C.B., Tort, L., Farrell, A.P., Brauner, C.J., Eds.; Academic Press: Cambridge, MA, USA, 2016; pp. 75–111. [Google Scholar] [CrossRef] [Scilit]
- Souza, C.F.; Baldissera, M.D.; Baldisserotto, B.; Heinzmann, B.M.; Martos-Sitcha, J.A.; Mancera, J.M. Essential oils as stress-reducing agents for fish aquaculture: A review. Front. Physiol. 2019, 10, 785. [Google Scholar] [CrossRef] [Scilit]
- Ross, L.G.; Ross, B. Anaesthetic and Sedative Techniques for Aquatic Animals, 3rd ed.; Blackwell Publishing Ltd.: Oxford, UK, 2008. [Google Scholar] [CrossRef] [Scilit]
- Purbosari, N.; Warsiki, E.; Syamsu, K.; Santoso, J. Natural versus synthetic anesthetic for transport of live fish: A review. Aquac. Fish. 2019, 4, 129–133. [Google Scholar] [CrossRef] [Scilit]
- Jerez-Cepa, I.; Fernández-Castro, M.; Alameda-López, M.; González-Manzano, G.; Mancera, J.M.; Ruiz-Jarabo, I. Transport and recovery of gilthead seabream (Sparus aurata L.) sedated with AQUI-S® and etomidate: Effects on intermediary metabolism and osmoregulation. Aquaculture 2021, 530, 735745. [Google Scholar] [CrossRef] [Scilit]
- Chance, R.J.; Cameron, G.A.; Fordyce, M.; Noguera, P.; Wang, T.; Collins, C.; Secombes, C.J.; Collet, B. Effects of repeated anaesthesia on gill and general health of Atlantic salmon, Salmo salar. J. Fish Biol. 2018, 93, 1069–1081. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, X.; Wang, Y.; Yu, N.; Le, Q.; Hu, J.; Yang, Y.; Yan, X. Transcriptome analysis reveals the influence of anaesthetic stress on the immune system of crucian carp (Carassius auratus) under the process of treatment and low concentration transport by MS-222 and Eugenol. Aquac. Res. 2019, 50, 3138–3153. [Google Scholar] [CrossRef] [Scilit]
- Ouyang, M.; Wen, B.; Ma, H.; Chen, C.; Gao, J.; Zhang, Y.; Chen, Z. Minimally invasive evaluation of the anaesthetic efficacy of MS-222 for ornamental discus fish using skin mucus biomarkers. Aquac. Res. 2020, 51, 2926–2935. [Google Scholar] [CrossRef] [Scilit]
- Wang, W.; Dong, H.; Sun, Y.; Sun, C.; Duan, Y.; Gu, Q.; Zhang, J. Immune and physiological responses of juvenile Chinese sea bass (Lateolabrax maculatus) to eugenol and tricaine methanesulfonate (MS-222) in gills. Aquacult. Rep. 2020, 18, 100554. [Google Scholar] [CrossRef] [Scilit]
- Dong, H.; Wang, W.; Duan, Y.; Li, H.; Liu, Q.; Sun, Y.; Zhang, J. Transcriptomic analysis of juvenile Chinese sea bass (Lateolabrax maculatus) anesthetized by MS-222 (tricaine methanesulfonate) and eugenol. Fish Physiol. Biochem. 2020, 46, 909–920. [Google Scholar] [CrossRef] [Scilit]
- Dong, H.; Zeng, X.; Wang, W.; Duan, Y.; Chen, J.; Zhang, J. Protection of teprenone against anesthetic stress in gills and liver of spotted seabass Lateolabrax maculatus. Aquaculture 2022, 557, 738333. [Google Scholar] [CrossRef] [Scilit]
- Readman, G.D.; Owen, S.F.; Murrell, J.C.; Knowles, T.G. Do fish perceive anaesthetics as aversive? PLoS ONE 2013, 8, e73773. [Google Scholar] [CrossRef] [Scilit]
- Souza, C.D.F.; Baldissera, M.D.; Salbego, J.; Lopes, J.M.; Vaucher, R.D.A.; Mourão, R.H.V.; Caron, B.O.; Heinzmann, B.M.; da Silva, L.V.F.; Baldisserotto, B. Physiological responses of Rhamdia quelen (Siluriformes: Heptapteridae) to anesthesia with essential oils from two different chemotypes of Lippia alba. Neotrop. Ichthyol. 2017, 15, e160083. [Google Scholar] [CrossRef] [Scilit]
- Bakkali, F.; Averbeck, S.; Averbeck, D.; Idaomar, M. Biological effects of essential oils–A review. Food Chem. Toxicol. 2008, 46, 446–475. [Google Scholar] [CrossRef] [Scilit]
- Carson, C.F.; Hammer, K.A. Chemistry and Bioactivity of Essential Oils. In Lipids and Essential Oils as Antimicrobial Agents; Thormar, H., Ed.; John Wiley & Sons: New York, NY, USA, 2011; pp. 203–238. [Google Scholar]
- Góra, J.; Lis, A.; Kula, J.; Staniszewska, M.; Wołoszyn, A. Chemical composition variability of essential oils in the ontogenesis of some plants. Flavour Fragr. J. 2002, 17, 445–451. [Google Scholar] [CrossRef] [Scilit]
- Tongnuanchan, P.; Benjakul, S. Essential oils: Extraction, bioactivities, and their uses for food preservation. J. Food Sci. 2014, 79, R1231–R1249. [Google Scholar] [CrossRef] [Scilit]
- Ni, Z.J.; Wang, X.; Shen, Y.; Thakur, K.; Han, J.; Zhang, J.G.; Hu, F.; Wei, Z.J. Recent updates on the chemistry, bioactivities, mode of action, and industrial applications of plant essential oils. Trends Food Sci. Technol. 2021, 110, 78–89. [Google Scholar] [CrossRef] [Scilit]
- Tavares-Dias, M. Current knowledge on use of essential oils as alternative treatment against fish parasites. Aquat. Living Resour. 2018, 31, 13. [Google Scholar] [CrossRef] [Scilit]
- Hoseini, S.M.; Mirghaed, A.T.; Yousefi, M. Application of herbal anaesthetics in aquaculture. Rev. Aquacult. 2019, 11, 550–564. [Google Scholar] [CrossRef] [Scilit]
- Bandeira, G., Jr.; Bianchini, A.E.; de Freitas Souza, C.; Descovi, S.N.; da Silva Fernandes, L.; de Lima Silva, L.; Descovi, S.N.; Cargnelutti, J.F.; Baldisserotto, B. The use of cinnamon essential oils in aquaculture: Antibacterial, anesthetic, growth-promoting, and antioxidant effects. Fishes 2022, 7, 133. [Google Scholar] [CrossRef] [Scilit]
- Sun, J. D-Limonene: Safety and clinical applications. Altern. Med. Rev. 2007, 12, 259–264. [Google Scholar]
- Viuda-Martos, M.; Ruiz-Navajas, Y.; Fernández-López, J.; Pérez-Álvarez, J. Antifungal activity of lemon (Citrus lemon L.), mandarin (Citrus reticulata L.), grapefruit (Citrus paradisi L.) and orange (Citrus sinensis L.) essential oils. Food Control 2008, 19, 1130–1138. [Google Scholar] [CrossRef] [Scilit]
- Hirota, R.; Roger, N.N.; Nakamura, H.; Song, H.S.; Sawamura, M.; Suganuma, N. Anti-inflammatory effects of limonene from yuzu (Citrus junos Tanaka) essential oil on eosinophils. J. Food Sci. 2010, 75, H87–H92. [Google Scholar] [CrossRef] [Scilit]
- Giarratana, F.; Muscolino, D.; Panebianco, F.; Patania, A.; Beninati, C.; Ziino, G.; Giuffrida, A. Activity of R(þ) limonene against Anisakis larvae. Ital. J. Food Saf. 2015, 4, 209–211. [Google Scholar] [CrossRef] [Scilit]
- Giarratana, F.; Muscolino, D.; Beninati, C.; Ziino, G.; Giuffrida, A.; Panebianco, A. Activity of R (+) limonene on the maximum growth rate of fish spoilage organisms and related effects on shelf-life prolongation of fresh gilthead sea bream fillets. Int. J. Food Microbiol. 2016, 237, 109–113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- da Cunha, J.A.; Heinzmann, B.M.; Baldisserotto, B. The effects of essential oils and their major compounds on fish bacterial pathogens–a review. J. Appl. Microbiol. 2018, 125, 328–344. [Google Scholar] [CrossRef] [Scilit]
- de Almeida, A.A.; Costa, J.P.; de Carvalho, R.B.; de Sousa, D.P.; de Freitas, R.M. Evaluation of acute toxicity of a natural compound (+)-limonene epoxide and its anxiolytic-like action. Brain. Res. 2012, 1448, 56–62. [Google Scholar] [CrossRef] [Scilit]
- Satou, T.; Miyahara, N.; Murakami, S.; Hayashi, S.; Koike, K. Differences in the effects of essential oil from Citrus junosand (+)-limonene on emotional behavior in mice. J. Essent. Oil. Res. 2012, 24, 493–500. [Google Scholar] [CrossRef] [Scilit]
- Lima, N.G.; De Sousa, D.P.; Pimenta, F.C.F.; Alves, M.F.; De Souza, F.S.; Macedo, R.O.; Cardoso, R.B.; de Morais, L.C.S.L.; Melo Diniz, M.d.F.F.; De Almeida, R.N. Anxiolytic-like activity and GC–MS analysis of (R)-(+)-limonene fragrance, a natural compound found in foods and plants. Pharmacol. Biochem. Behav. 2013, 103, 450–454. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alkanat, M.; Alkanat, H.Ö. D-Limonene reduces depression-like behaviour and enhances learning and memory through an anti-neuroinflammatory mechanism in male rats subjected to chronic restraint stress. Eur. J. Neurosci. 2024, 60, 4491–4502. [Google Scholar] [CrossRef] [Scilit]
- Becker, A.G.; Luz, R.K.; Mattioli, C.C.; Nakayama, C.L.; de Souza e Silva, W.; de Oliveira Paes Leme, F.; de Mendonça Mendes, H.C.P.; Heinzmann, B.M.; Baldisserotto, B. Can the essential oil of Aloysia triphylla have anesthetic effect and improve the physiological parameters of the carnivorous freshwater catfish Lophiosilurus alexandri after transport? Aquaculture 2017, 481, 184–190. [Google Scholar] [CrossRef] [Scilit]
- Lopes, J.M.; Sousa, C.F.; Schindler, B.; Pinheiro, C.G.; Salbego, J.; Siqueira, J.C.; Heinzmann, B.M.; Baldisserotto, B. Essential oils from Citrus x aurantium and Citrus x latifolia (Rutaceae) have anesthetic activity and are effective in reducing ion loss in silver catfish (Rhamdia quelen). Neotrop. Ichthyol. 2018, 16, e170152. [Google Scholar] [CrossRef] [Scilit]
- Parodi, T.V.; Gressler, L.T.; Silva, L.D.L.; Becker, A.G.; Schmidt, D.; Caron, B.O.; Baldisserotto, B. Chemical composition of the essential oil of Aloysia triphylla under seasonal influence and its anaesthetic activity in fish. Aquac. Res. 2020, 51, 2515–2524. [Google Scholar] [CrossRef] [Scilit]
- Szaszkiewicz, J.; Leigh, S.; Hamilton, T.J. Robust behavioural effects in response to acute, but not repeated, terpene administration in Zebrafish (Danio rerio). Sci. Rep. 2021, 11, 19214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McFarland, W.N. A study of the effects of anesthetics on the behavior and physiology of fishes. Publ. Inst. Mar. Sci. 1959, 6, 22–55. [Google Scholar]
- Keppler, D.; Decker, K. Glycogen Determination with Amyloglucosidase. In Methods of Enzymatic Analysis; Bergmeyer, H.U., Ed.; Academic Press: New York, NY, USA, 1974; pp. 1127–1131. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [Scilit]
- Zander, K.; Feucht, Y. Consumers’ willingness to pay for sustainable seafood made in Europe. J. Int. Food Agribus. Mark. 2018, 30, 251–275. [Google Scholar] [CrossRef] [Scilit]
- Toni, M.; Manciocco, A.; Angiulli, E.; Alleva, E.; Cioni, C.; Malavasi, S. Review: Assessing fish welfare in research and aquaculture, with a focus on European directives. Animal 2019, 13, 161–170. [Google Scholar] [CrossRef] [Scilit]
- Dara, M.; Carbonara, P.; La Corte, C.; Parrinello, D.; Cammarata, M.; Parisi, M.G. Fish Welfare in Aquaculture: Physiological and Immunological Activities for Diets, Social and Spatial Stress on Mediterranean Aqua Cultured Species. Fishes 2023, 8, 414. [Google Scholar] [CrossRef] [Scilit]
- Sampaio, F.D.; Freire, C.A. An overview of stress physiology of fish transport: Changes in water quality as a function of transport duration. Fish Fish. 2016, 17, 1055–1072. [Google Scholar] [CrossRef] [Scilit]
- Dable-Tupas, G.; Tulika, V.; Jain, V.; Maheshwari, K.; Brakad, D.D.; Naresh, P.N.; Suruthimeenakshi, S. Bioactive Compounds of Nutrigenomic Importance. In Role of Nutrigenomics in Modern-Day Healthcare and Drug Discovery; Dable-Tupas, G., Egbuna, G., Eds.; Elsevier: Amsterdam, The Netherlands, 2023; pp. 301–342. [Google Scholar] [CrossRef] [Scilit]
- Summerfel, R.C.; Smith, L.S. Anaesthetic surgery related Techniques. In Methods for Biology; Shreck, C.B., Moyle, P.B., Eds.; America Fisheries Society: Bethesda, MD, USA, 1990; pp. 213–273. [Google Scholar]
- Pirhonen, J.; Schreck, C.B. Effects of anaesthesia with MS-222, clove oil and CO2 on feed intake and plasma cortisol in steelhead trout (Oncorhynchus mykiss). Aquaculture 2003, 220, 507–514. [Google Scholar] [CrossRef] [Scilit]
- Martins, C.I.; Galhardo, L.; Noble, C.; Damsgård, B.; Spedicato, M.T.; Zupa, W.; Beauchaud, M.; Kulczykowska, E.; Massabuau, J.C.; Carter, T.; et al. Behavioural indicators of welfare in farmed fish. Fish Physiol. Biochem. 2012, 38, 17–41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jetter, C.N.; Crossman, J.A.; Martins, E.G. Movement behaviour of endangered white sturgeon Acipenser transmontanus responds to changing environmental conditions below a dam. Endang. Species Res. 2023, 50, 295–309. [Google Scholar] [CrossRef] [Scilit]
- Cook, D.G.; Iftikar, F.I.; Baker, D.W.; Hickey, A.J.R.; Herbert, N.A. Low-O2 acclimation shifts the hypoxia avoidance behaviour of snapper (Pagrus auratus) with only subtle changes in aerobic and anaerobic function. J. Exp. Biol. 2013, 216, 369–378. [Google Scholar] [CrossRef] [Scilit]
- Gomez Isaza, D.F.; Cramp, R.L.; Franklin, C.E. Exposure to nitrate increases susceptibility to hypoxia in fish. Physiol. Biochem. Zool. 2021, 94, 124–142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mocho, J.P.; Lang, F.; Valentin, G.; Bedu, S.; McKimm, R.; Ramos, J.; Torres, Y.S.; Wheatley, S.E.; Higgins, J.; von Krogh, K.; et al. A multi-site assessment of anesthetic overdose, hypothermic shock, and electrical stunning as methods of euthanasia for zebrafish (Danio rerio) embryos and larvae. Biology 2022, 11, 546. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khan, S.; Qayoom, I.; Balkhi, M.H.; Abubakr, A.; Rashid, S.; Alsaffar, R.M.; Rehman, M.U. Behavioural incongruities in juvenile Cyprinus carpio exposed to organophosphate compounds. Heliyon 2022, 8, e11227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Egan, R.J.; Bergner, C.L.; Hart, P.C.; Cachat, J.M.; Canavello, P.R.; Elegante, M.F.; Elkhayat, S.I.; Bartels, B.K.; TieN, A.K.; Tien, D.H.; et al. Understanding behavioral and physiological phenotypes of stress and anxiety in zebrafish. Behav. Brain Res. 2009, 205, 38–44. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Félix, L.; Correia, R.; Sequeira, R.; Ribeiro, C.; Monteiro, S.; Antunes, L.; Silva, J.; Venâncio, C.; Valentim, A. MS-222 and Propofol Sedation during and after the Simulated Transport of Nile tilapia (Oreochromis niloticus). Biology 2021, 10, 1309. [Google Scholar] [CrossRef] [Scilit]
- Cerqueira, M.; Millot, S.; Felix, A.; Silva, T.; Oliveira, G.A.; Oliveira, C.C.; Rey, S.; MacKenzie, S.; Oliveira, R. Cognitive appraisal in fish: Stressor predictability modulates the physiological and neurobehavioural stress response in sea bass. Proc. Biol. Sci. B 2020, 287, 20192922. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Almeida, A.P.G.; Correia, T.G.; Heinzmann, B.M.; Val, A.L.; Baldisserotto, B. Stress-reducing and anesthetic effects of the essential oils of Aloysia triphylla and Lippia alba on Serrasalmus eigenmanni (Characiformes: Serrasalmidae). Neotrop. Ichthyol. 2019, 17, e190021. [Google Scholar] [CrossRef] [Scilit]
- Tang, S.; Thorarensen, H.; Brauner, C.J.; Wood, C.M.; Farrell, A.P. Modeling the accumulation of CO2 during high density, re-circulating transport of adult Atlantic salmon, Salmo salar, from observations aboard a sea-going commercial live-haul vessel. Aquaculture 2009, 296, 102–109. [Google Scholar] [CrossRef] [Scilit]
- Mazandarani, M.; Hoseini, S.M.; Dehghani Ghomshani, M. Effects of linalool on physiological responses of Cyprinus carpio (Linnaeus, 1758) and water physico-chemical parameters during transportation. Aquac. Res. 2017, 48, 5775–5781. [Google Scholar] [CrossRef] [Scilit]
- Bonga, S.W. The stress response in fish. Physiol. Rev. 1997, 77, 591–625. [Google Scholar] [CrossRef] [Scilit]
- Jerez-Cepa, I.; Fernández-Castro, M.; Del Santo O’Neill, T.J.; Martos-Sitcha, J.A.; Martínez-Rodríguez, G.; Mancera, J.M.; Ruiz-Jarabo, I. Transport and recovery of gilthead seabream (Sparus aurata L.) sedated with clove oil and MS-222: Effects on stress axis regulation and intermediary metabolism. Front. Physiol. 2019, 10, 612. [Google Scholar] [CrossRef] [Scilit]
- Silkin, Y.A.; Silkina, E.N. Effect of hypoxia on physiological-biochemical blood parameters in some marine fish. J. Evol. Biochem. Physiol. 2005, 41, 527–532. [Google Scholar] [CrossRef] [Scilit]
- Martemyanov, V.I. The regularities of changes in the sodium ion levels in fish erythrocytes during adaptation to a temperature. Biol. Bull. Russ. Acad. Sci. 2009, 36, 412–416. [Google Scholar] [CrossRef] [Scilit]
- Kwong, R.W.; Perry, S.F. Cortisol regulates epithelial permeability and sodium losses in zebrafish exposed to acidic water. J. Endocrinol. 2013, 217, 253–264. [Google Scholar] [CrossRef] [Scilit]
- Guh, Y.J.; Lin, C.H.; Hwang, P.P. Osmoregulation in zebrafish: Ion transport mechanisms and functional regulation. EXCLI J. 2015, 14, 627. [Google Scholar] [CrossRef] [Scilit]
- Lin, C.H.; Hu, H.J.; Hwang, P.P. Cortisol regulates sodium homeostasis by stimulating the transcription of sodium-chloride transporter (NCC) in zebrafish (Danio rerio). Mol. Cell. Endocrinol. 2016, 422, 93–102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, Y.C.; Chu, K.F.; Hwang, L.Y.; Lee, T.H. Cortisol regulation of Na+, K+-ATPase β1 subunit transcription via the pre-receptor 11β-hydroxysteroid dehydrogenase 1-like (11β-Hsd1L) in gills of hypothermal freshwater milkfish, Chanos chanos. J. Steroid Biochem. Mol. Biol. 2019, 192, 105381. [Google Scholar] [CrossRef] [Scilit]
- Parodi, T.V.; Cunha, M.A.; Becker, A.G.; Zeppenfeld, C.C.; Martins, D.I.; Koakoski, G.; Gil Barcellos, L.; Heinzmann, B.M.; Baldisserotto, B. Anesthetic activity of the essential oil of Aloysia triphylla and effectiveness in reducing stress during transport of albino and gray strains of silver catfish, Rhamdia quelen. Fish Physiol. Biochem. 2014, 40, 323–334. [Google Scholar] [CrossRef] [Scilit]
- Tran, S.; Chatterjee, D.; Gerlai, R. An integrative analysis of ethanol tolerance and withdrawal in zebrafish (Danio rerio). Behav. Brain Res. 2015, 276, 161–170. [Google Scholar] [CrossRef] [Scilit]
- Rucinque, D.S.; Ferreira, P.F.; Leme, P.R.P.; Lapa-Guimaraes, J.; Viegas, E.M.M. Ocimum americanum and Lippia alba essential oils as anaesthetics for Nile tilapia: Induction, recovery of apparent unconsciousness and sensory analysis of fillets. Aquaculture 2021, 531, 735902. [Google Scholar] [CrossRef] [Scilit]
- Urbinati, E.C.; Carneiro, P.C.F. Sodium chloride added to transport water and physiological responses of matrinxã Brycon amazonicus (Teleost: Characidae). Acta Amaz. 2006, 36, 569–572. [Google Scholar] [CrossRef] [Scilit]
- Zeppenfeld, C.C.; Toni, C.; Becker, A.G.; dos Santos Miron, D.; Parodi, T.V.; Heinzmann, B.M.; Gil Barcellos, L.J.; Koakoski, G.; Santos da Rosa, J.G.; Loro, V.L.; et al. Physiological and biochemical responses of silver catfish, Rhamdia quelen, after transport in water with essential oil of Aloysia triphylla (L’Herit) Britton. Aquaculture 2014, 418, 101–107. [Google Scholar] [CrossRef] [Scilit]
- Biswal, A.; Srivastava, P.P.; Krishna, G.; Paul, T.; Pal, P.; Gupta, S.; Varghese, T.; Jayant, M. An Integrated biomarker approach for explaining the potency of exogenous glucose on transportation induced stress in Labeo rohita fingerlings. Sci. Rep. 2021, 11, 5713. [Google Scholar] [CrossRef] [Scilit]
- Santos, E.L.R.; Rezende, F.P.; Moron, S.E. Stress-related physiological and histological responses of tambaqui (Colossoma macropomum) to transportation in water with tea tree and clove essential oil anesthetics. Aquaculture 2020, 523, 735164. [Google Scholar] [CrossRef] [Scilit]
- Mirzargar, S.S.; Taheri Mirghaed, A.; Hoseini, S.M.; Ghelichpour, M.; Shahbazi, M.; Yousefi, M. Biochemical responses of common carp, Cyprinus carpio, to transportation in plastic bags using thymol as a sedative agent. Aquac. Res. 2022, 53, 191–198. [Google Scholar] [CrossRef] [Scilit]
- Wang, Q.; Mei, J.; Cao, J.; Xie, J. Effects of Melissa officinalis L. essential oil in comparison with anaesthetics on gill tissue damage, liver metabolism and immune parameters in sea bass (Lateolabrax maculatus) during simulated live transport. Biology 2021, 11, 11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Robertson, L.; Thomas, P.; Arnold, C.R. Plasma cortisol and secondary stress responses of cultured red drum (Sciaenops ocellatus) to several transportation procedures. Aquaculture 1988, 68, 115–130. [Google Scholar] [CrossRef] [Scilit]
- Gilmour, K.M. Mineralocorticoid receptors and hormones: Fishing for answers. Endocrinology 2005, 146, 44–46. [Google Scholar] [CrossRef] [Scilit]
- Manna, P.R.; Dyson, M.T.; Stocco, D.M. Regulation of the steroidogenic acute regulatory protein gene expression: Present and future perspectives. Mol. Hum. Reprod. 2009, 15, 321–333. [Google Scholar] [CrossRef] [Scilit]
- Cerny, M.A.; Csengery, A.; Schmenk, J.; Frederick, K. Development of CYP11B1 and CYP11B2 assays utilizing homogenates of adrenal glands: Utility of monkey as a surrogate for human. J. Steroid Biochem. Mol. Biol. 2015, 154, 197–205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Theodoridi, A.; Dinarello, A.; Badenetti, L.; Pavlidis, M.; Dalla Valle, L.; Tsalafouta, A. Knockout of the hsd11b2 gene extends the cortisol stress response in both zebrafish larvae and adults. Int. J. Mol. Sci. 2021, 22, 12525. [Google Scholar] [CrossRef] [Scilit]




| Behavioural Parameters | Definition |
|---|---|
| Time at the bottom | Time spent in the lower half of the aquaria |
| Time leaning down | Time in which the fish leaned with the head down at 45 degrees or more |
| Time leaning up | Time in which the fish leaned with the head up at 45 degrees or more |
| Freezing time | Time in which the fish did not move the body, only the fins to maintain equilibrium |
| Distance travelled | Distance travelled in straight lines within the aquarium |
| Mean speed | Distance travelled/time |
| Number of complete turns | Number of times the fish performed a complete turn |
| Number of crossings | Number of times the fish moved from the upper to the lower half of the aquarium or vice versa |
| Gene | Acronym | Accession Number | Primer Sequence | Amplicon Size (bp) | E (%) | R2 | |
|---|---|---|---|---|---|---|---|
| actb1 | actin beta 1 | XM_030406939.1 | F | AGCCAACAGGGAGAAGATGA | 100 | 98 | 0.999 |
| R | ACCAGAGGCATACAGGGACA | ||||||
| eef1a | eukaryotic elongation factor 1 alpha | AF184170.1 | F | GATGGCACGGTGACAACAT | 200 | 97 | 0.999 |
| R | AGTTCCAATACCGCCGATTT | ||||||
| star | steroidogenic acute regulatory protein | EF640987.1 | F | GAAGACCCGAACAAGACCAA | 138 | 95 | 0.999 |
| R | ATTAGCCATCCTTTGCCTGA | ||||||
| cyp11b1 | cytochrome P450 11B, mitochondrial-like | XM_030394987.1 | F | CTGCTGAAAGGCACAGTCAA | 174 | 98 | 1.000 |
| R | CAGTGGGTCCTCAAACACCT | ||||||
| nr3c1 | glucocorticoid receptor | XM_030437675.1 | F | TCTACTCGGGCTACGACAGC | 181 | 96 | 0.999 |
| R | ATGAGGAAGAGCCAAGAGCA | ||||||
| hsd11b2 | corticosteroid 11-beta-dehydrogenase isozyme 2-like | XM_030415446.1 | F | TCCTGCCCTCCTCATACAAG | 118 | 107 | 0.995 |
| R | TAGTCCTCGCCGTAGTCCTC | ||||||
| nr3c2 | mineralocorticoid receptor | XM_030418022.1 | F | CTGAAGAACCAGGCAGCATT | 194 | 103 | 0.999 |
| R | TGGGACTCACGAAAGGTGTA |
| T0 | T6 | T10 | T20 | p-Value (Two-Way ANOVA) | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CTRL | E | LMN20 | LMN30 | CTRL | E | LMN20 | LMN30 | CTRL | E | LMN20 | LMN30 | CTRL | E | LMN20 | LMN30 | Time | Treatment | Interaction | |
| Time at the bottom (s) | 29.9 ± 0.1 a | 29.8 ± 0.2 ab | 25.6 ± 2.2 ab | 22.3 ± 3.3 b | 29.9 ± 0.8 | 29.8 ± 1.8 | 25.9 ± 2.2 | 22.5 ± 2.3 | 27.3 ± 1.3 ab | 28.8 ± 1.2 a | 21.8 ± 3.8 ab | 17 ± 3.5 b | 29.8 ± 0.2 | 30 ± 0 | 29.4 ± 0.5 | 30 ± 0 | 0.002 | 0.0006 | 0.167 |
| Time leaning down (s) | 16.7 ± 2.4 | 12.9 ± 2.9 | 13.8 ± 3.6 | 16.9 ± 3.7 | 7.8 ± 2.7 | 1.3 ± 0.6 | 6 ± 3.0 | 2.3 ± 0.9 | 4.5 ± 1.6 | 1.22 ± 0.8 | 4.3 ± 1.7 | 1.8 ± 0.7 | 0.7 ± 0.3 | 6.8 ± 3.2 | 1.8 ± 1.2 | 7.6 ± 2.8 | <0.0001 | 0.713 | 0.147 |
| Time leaning up (s) | 0.0 ± 0.0 | 0.0 ± 0.0 | 0.0 ± 0.0 | 0.0 ± 0.0 | 0.0 ± 0.0 | 0.3 ± 0.2 | 0.4 ± 0.3 | 0.9 ± 0.3 | 0.1 ± 0.1 | 0.3 ± 0.3 | 4.8 ± 3.2 | 1.8 ± 0.6 | 0.1 ± 0.1 | 0 ± 0 | 0.7 ± 0.6 | 0 ± 0 | 0.070 | 0.144 | 0.206 |
| Freezing time (s) | 4.8 ± 1.8 a | 2.3 ± 1.2 ab | 0.0 ± 0.0 b | 0.0 ± 0.0 b | 17.6 ± 3.9 a | 4.2 ± 1.9 b | 2.2 ± 1.6 b | 3.1 ± 1.7 b | 13.4 ± 3.8 | 7.9 ± 2.7 | 4 ± 2.1 | 2.9 ± 2.2 | 12.2 ± 3.9 | 9.7 ± 3.9 | 2.4 ± 1.4 | 4.9 ± 2.2 | 0.001 | 0.001 | 0.252 |
| Distance travelled (mm) | 949.5 ± 251.7 | 1305 ± 275.2 | 1243.5 ± 368.9 | 1758.3 ± 115.8 | 325.5 ± 129.1 b | 580 ± 216.0b | 1200.8 ± 368.0 ab | 1737.8 ± 416.7 a | 367.8 ± 147.4 | 510 ± 235.9 | 918. 5± 224.5 | 951 ± 295.7 | 181 ± 73.1 b | 307 ± 154.4 b | 728.3 ± 169.3 ab | 1232.2 ± 301 a | 0.001 | 0.0003 | 0.723 |
| Mean speed (m/s) | 0.03 ± 0.01 | 0.04 ± 0.01 | 0.04 ± 0.01 | 0.06 ± 0.004 | 0.01 ± 0.004 b | 0.02 ± 0.01 ab | 0.04 ± 0.01 ab | 0.05 ± 0.01 a | 0.01 ± 0.005 | 0.02 ± 0.01 | 0.03 ± 0.01 | 0.02 ± 0.01 | 0.01 ± 0.00 b | 0.01 ± 0.01 ab | 0.02 ± 0.01 ab | 0.04 ± 0.01 a | 0.001 | 0.002 | 0.646 |
| Number of complete turns | 2.6 ± 0.7 | 3.6 ± 0.6 | 2.2 ± 0.42 | 2.9 ± 0.5 | 0.6 ± 0.3 | 0.9 ± 0.3 | 0.7 ± 0.3 | 1.1 ± 0.4 | 0.6 ± 0.2 | 0.8 ± 0.4 | 1.0 ± 0.3 | 0.8 ± 0.3 | 0.2 ± 0.1 | 0.6 ± 0.3 | 0.6 ± 0.3 | 1.7 ± 0.5 | <0.0001 | 0.096 | 0.391 |
| Number of crossings | 0.0 ± 0.0 b | 0.11 ± 0.11 b | 2.0 ± 0.9 ab | 2.9 ± 0.9 a | 0.11 ± 0.11 b | 1.5 ± 0.8 b | 1.6 ± 0.9 b | 5.5 ± 1.6 a | 0.6 ± 0.2 b | 0.0 ± 0.0 b | 1.2 ± 0.5 ab | 3.4 ± 1.1 a | 0.1 ± 0.1 | 0 ± 0 | 0.3 ± 0.2 | 0 ± 0 | 0.004 | <0.0001 | 0.009 |
| T0 | CTRL | E | LMN30 | p-Value | |
|---|---|---|---|---|---|
| O2 (mg/L) | Saturated | 3.70 ± 0.56 | 4.42 ± 1.23 | 6.27 ± 0.45 | 0.178 |
| O2 (%) | Saturated | 50.67 ± 7.62 | 60.80 ± 16.78 | 84.83 ± 6.39 | 0.113 |
| pH | 7.50 | 6.69 ± 0.03 | 6.74 ± 0.02 | 6.73 ± 0.03 | 0.596 |
| Ammonium (NH3) | 0.00 | 0.003 ± 0.00 | 0.004 ± 0.00 | 0.003 ± 0.00 | 0.667 |
| Nitrite (NO2− ppm) | 0.00 | 0.28 ± 0.01 | 0.29 ± 0.03 | 0.26 ± 0.02 | 0.535 |
| PRE | CTRL | E | LMN30 | p-Value | |
|---|---|---|---|---|---|
| Haematocrit (%) | 33.13 ± 1.18 | 36.11 ± 1.05 | 35.52 ± 1.32 | 35.33 ± 0.94 | 0.523 |
| Plasma | |||||
| Protein (mg/mL) | 39.74 ± 1.85 | 43.65 ± 2.10 | 36.74 ± 2.19 | 39.42 ± 1.85 | 0.148 |
| Cholesterol (mg/dL) | 404.0 ± 25.3 | 446.3 ± 20.0 | 449.0 ± 22.8 | 398.6 ± 19.0 | 0.210 |
| Liver | |||||
| Glucose (mg/g tissue) | 0.92 ± 0.17 | 1.27± 0.13 | 1.19 ± 0.13 | 1.22 ± 0.09 | 0.354 |
| Glycogen (mg/g tissue) | 16.77 ± 0.89 | 16.82 ± 0.33 | 17.43 ± 0.54 | 18.12 ± 0.38 | 0.217 |
| Lactate (mg/g tissue) | 0.18 ± 0.01 | 0.17 ± 0.04 | 0.23 ± 0.03 | 0.24 ± 0.03 | 0.314 |
| TAG (mg/g tissue) | 37.32 ± 7.68 | 43.33 ± 4.25 | 47.96 ± 3.74 | 53.30 ± 5.26 | 0.201 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Simó-Mirabet, P.; Caderno, A.; Flores-Llano, M.J.; da Silva, E.G.; Schoenau, W.; Baldisserotto, B.; Martínez-Rodríguez, G.; Mancera, J.M.; Martos-Sitcha, J.A. Evaluation of the Sedative Effect of Limonene to Reduce Stress During Transportation of Gilthead Seabream (Sparus aurata). Biology 2025, 14, 115. https://doi.org/10.3390/biology14020115
Simó-Mirabet P, Caderno A, Flores-Llano MJ, da Silva EG, Schoenau W, Baldisserotto B, Martínez-Rodríguez G, Mancera JM, Martos-Sitcha JA. Evaluation of the Sedative Effect of Limonene to Reduce Stress During Transportation of Gilthead Seabream (Sparus aurata). Biology. 2025; 14(2):115. https://doi.org/10.3390/biology14020115
Chicago/Turabian StyleSimó-Mirabet, Paula, Anyell Caderno, María José Flores-Llano, Elisia Gomes da Silva, William Schoenau, Bernardo Baldisserotto, Gonzalo Martínez-Rodríguez, Juan Miguel Mancera, and Juan Antonio Martos-Sitcha. 2025. "Evaluation of the Sedative Effect of Limonene to Reduce Stress During Transportation of Gilthead Seabream (Sparus aurata)" Biology 14, no. 2: 115. https://doi.org/10.3390/biology14020115
APA StyleSimó-Mirabet, P., Caderno, A., Flores-Llano, M. J., da Silva, E. G., Schoenau, W., Baldisserotto, B., Martínez-Rodríguez, G., Mancera, J. M., & Martos-Sitcha, J. A. (2025). Evaluation of the Sedative Effect of Limonene to Reduce Stress During Transportation of Gilthead Seabream (Sparus aurata). Biology, 14(2), 115. https://doi.org/10.3390/biology14020115

