Next Article in Journal
Unraveling Ferroptosis: A New Frontier in Combating Renal Fibrosis and CKD Progression
Previous Article in Journal
Lifecycle Completion and Reproductive Improvement of Chrysoperla carnea (Stephens) (Neuroptera: Chrysopidae), Following a Prey Shift Routine During Larval Development
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Impact of Soybean Bioactive Peptides on Growth, Lipid Metabolism, Antioxidant Ability, Molecular Responses, and Gut Microbiota of Oriental River Prawn (Macrobrachium nipponense) Fed with a Low-Fishmeal Diet

1
Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, China
2
Key Laboratory of Aquatic Animal Nutrition and Health, Freshwater Fisheries Research Center, Chinese Academy of Fishery Science, Wuxi 214081, China
3
Jiangsu FIELD Technology Co., Ltd., Huaian 223001, China
*
Author to whom correspondence should be addressed.
Biology 2025, 14(1), 11; https://doi.org/10.3390/biology14010011
Submission received: 9 November 2024 / Revised: 3 December 2024 / Accepted: 16 December 2024 / Published: 26 December 2024

Simple Summary

Low-fishmeal diets cause lipid accumulation and oxidative stress, inhibiting growth in aquatic animals. Soybean bioactive peptides (SBPs) have shown great potential in improving growth, antioxidant capacity, and immunomodulation. Therefore, this study investigated the effects of dietary SBPs on the growth, lipid metabolism, antioxidant status, immune response, and gut microbiota of oriental river prawn fed with a low-fishmeal diet. The results showed that SBPs could alleviate growth inhibition and lipid oxidative stress by affecting microbiota in the gut, such as increasing the potential probiotic Rikenellaceae_RC9_gut_group abundance and decreasing the abundance of the conditional pathogen Pseudomonas.

Abstract

The substitution of fishmeal with high-level soybean meal in the diet of crustaceans usually induces lipid accumulation and oxidative stress in the hepatopancreas. Therefore, it is essential to alleviate these adverse effects. In the present study, SBPs were used to alleviate the negative effects of a fishmeal decrease on the growth performance, lipid metabolism, antioxidant capacity, and gut microbiota of oriental river prawn (Macrobrachium nipponense) in an 8-week feeding trial. Three isonitrogenic and isolipidic diets were prepared as follows: R (reference diet with 32% fishmeal), CT (control diet with 22% fishmeal), and SBP (22% fishmeal with 1.25 g/kg soybean bioactive peptides). The prawns (initial biomass per tank 17 g) were randomly divided into three groups with four replicates. The results showed that the low-fishmeal diet induced the following: (1) the inhibition of growth performance and survival of prawns; (2) an increase in triglyceride content in the hepatopancreas and hemolymph and downregulation of carnitine palmitoyl transferase 1 (cpt1) gene expression; (3) a reduction in antioxidant enzymes’ activities and their genes expression levels and an increase malondialdehyde (MDA) content; and (4) an increase in the abundance of the conditional pathogen Pseudomonas in the gut. SBPs supplementation in the CT diet effectively alleviated most of the above adverse effects. SBPs enhanced inducible nitric oxide synthase (iNOS) activity to synthesize nitric oxide (NO) by activating the imd-relish pathway. Most importantly, SBPs increased the potential probiotic Rikenellaceae_RC9_gut_group abundance and decreased the abundance of the conditional pathogen Pseudomonas in the gut. In conclusion, SBPs supplementation can improve low-fishmeal-diet-induced growth inhibition by regulating the gut microbiota composition to ameliorate lipid deposition and oxidative stress and strengthen immune status in oriental river prawn.

Graphical Abstract

1. Introduction

Fishmeal is always the major protein source in aquatic feed due to its balanced amino acid composition, high digestibility, and palatability. A shortage of fishmeal supply is emerging as the global aquaculture industry continues to expand [1]. Therefore, finding a high-quality and affordable protein source to replace fishmeal is becoming an inevitable necessity. Soybean meal has shown promising potential as a fishmeal replacement because of its reasonable amino acid composition, easy availability, and economical price [2]. However, over-substitution of fishmeal with soybean meal generally leads to poor growth performance and unhealthy immune status due to the existence of anti-nutritional factors [3]. Adverse effects induced by soybean meal on antioxidant capacity, immune response, and gut microbiota composition have been widely reported in fish such as turbot (Scophthalmus maximus) [4], Atlantic salmon (Salmo salar L.) [5], gilthead sea bream (Sparus aurata L.) [6], rainbow trout (Oncorhynchus mykiss) [7], and northern snakehead (Channa argus Cantor, 1842) [3], etc. Poor growth performance was observed in Chinese mitten crab (Eriocheir sinensis) [8], swimming crab (Portunus pelagicus) [9], and oriental river prawn (Macrobrachium nipponense) [10] due to low-fishmeal diets. However, studies on the effects of low-fishmeal diets on antioxidant and immune functions, as well as the gut microbiota, in crustaceans are still lacking.
The gut microbiota, considered a virtual organ, plays an important role in host metabolism and physiological functions [11], such as digestion and immunomodulation [12,13]. Diet is the most prominent factor affecting gut microbiota homeostasis. Once the balance is destroyed, it will have a negative impact on the host’s health [14]. Previous reports have shown that gut microbiota dysbiosis exhibits a strong correlation with lipid metabolism disorder or oxidative stress in the liver, and the disorder can be prevented after restoring the balance [15], which suggests that the gut microbiota serves as a mediator in regulating lipid metabolism and oxidative stress [16]. Meanwhile, the microbiota can make an axis with a number of extraintestinal organs. Among them, the theory of the “gut liver axis” has been widely assessed since it was put forward [17]. The metabolism and immune regulatory pathways in the liver can be well explained based on the symbiotic relationship between the gut microbiota and the liver [18]. In crustaceans, the hepatopancreas is an important location in regulating metabolism and immune responses [19]. Therefore, it is necessary to focus on the “gut microbiota hepatopancreas axis” in studies of crustaceans.
Peptides derived from plant protein sources, generally possessing 2 to 20 amino acids and a molecular weight < 6000 Da [20], have immunomodulatory and antioxidant biological activities due to their amino acid composition, sequence, molecular weight, and hydrophobicity [21]. Soybeans can be chosen as a preferable source to obtain bioactive peptides because of their favorable price and high protein content. Some reports have pointed out that soybean bioactive peptides (SBPs) exhibit positive effects on growth and digestive performance [22], antioxidant capacity [23], and immunomodulation [21] in both in vivo and in vitro experiments in mammals and fish. All the results showed that SBPs have unlimited possibilities as a diet additive for aquatic animals. However, more studies are needed to provide evidence and data support.
Oriental river prawn (Macrobrachium nipponense) is a popularly farmed species in China, known for its rich nutritional value and short maturation cycles, which is also sensitive to the ratio of fishmeal to soybean meal in its diet based on our previous study [10]. In this study, a fishmeal level of 22% is set as the low fishmeal threshold value since our previous study showed that the dietary fishmeal level of oriental river prawn should not be less than 25% [10,24]. A diet with 32% fishmeal (reference group, R), a diet with 22% fishmeal (control group, CT), and a CT diet supplemented with soybean bioactive peptides (SBPs) were used to evaluate the impact of SBPs on growth, lipid metabolism, antioxidant capacity, molecular responses, and gut microbiota of oriental river shrimp fed a low-fishmeal diet. Meanwhile, the correlations between the hepatopancreatic physiological and molecular parameters and gut microbiota were revealed to identify the possible mechanism. We hypothesized that supplementing SBPs in the low-fishmeal diet can promote lipid decomposition and enhance antioxidant and immune functions, as well as improve gut microbiota structure, in prawn. It will promote the growth performance of prawn to a certain extent and provide a reference for the SBPs application in aquaculture.

2. Materials and Methods

2.1. Study Site

The experiment was conducted in the indoor facility of Dapu breeding farm of the Freshwater Fisheries Research Center (31°19′35.35588″ N and 119°45′13.63901″ E), Chinese Academy of Fishery Sciences, Wuxi, China, for 8 weeks.

2.2. Diet Preparation and Proximate Composition Analysis

In this study, three isonitrogen (40% crude protein) and isolipid (8% crude lipid) diets, including the reference diet (R, with 32% fishmeal), control diet (CT, with 22% fishmeal), and soybean bioactive peptides’ diet (SBP, with 22% fishmeal supplied 0.125% SBPs), were designed using Microsoft Excel®. The composition and nutrient levels of experimental diets were shown in Table 1. The protein sources in the diets were fishmeal, soybean meal, rapeseed meal, peanut meal and blood meal, lipid sources were fish oil and soybean oil, and carbohydrate source was α-starch. SBP diet was formulated by supplying 1.25 g/kg SBPs based on CT diet, whose fishmeal level was reduced from 32% to 22% compared with the R diet. SBPs (Tian le tai, provided by Jiangsu FIELD Technology Co., Ltd., Huaian, China) was obtained by enzymolysis with soybean protease. The main components were shown in Table 2. Stachyose and raffinose in SBPs were detected by high-performance liquid chromatography (HPLC) method. The relative molecular weight distribution of peptides detected as Jiang et al. [25]. The small peptides with molecular weight 180–500 account about 32%.
After all ingredients were crushed and sieved through an 80-mesh, the powders of the raw materials were weighed and mixed thoroughly. Then, the mixture was mixed well with lipid sources and water (250 mL/kg diet) when the SBPs were added to the stiff dough with water. The wet pellets (1.0 mm) were produced by squeezing the dough through twin screw extruder (F-26, Guangzhou Huazhong Optical Mechanical and Electrical Technology Co., Ltd., Guangzhou, China). Finally, after 15 h air-drying at room temperature (about 30 °C), the diets were stored in a −20 °C refrigerator until use. The proximate composition of experimental diets was measured based on standard AOAC methods [26].

2.3. Feeding Trial and Experimental Conditions

All juvenile oriental river prawns were provided by the breeding farm of Freshwater Fisheries Research Center, Wuxi, China. After 14 days acclimation feeding with commercial diet (36% crude protein and 6% crude lipid), 720 healthy prawns with similar size were selected and randomly stocked in 12 tanks (100 cm height × 180 cm diameter) with 60 individuals per tank. The initial biomass of prawns per tank was about 17 g. Four replicates per diet were randomly distributed.
All prawns in each tank were fed three times daily (7:30, 12:30, and 17:00) for 8 weeks. The daily feeding amount is 3% of the biomass in tank. The residue was removed one hour after feeding and subsequently dried in an oven at 65 °C to calculate the feed intake. During the feeding trail, we exchanged about one-tenth of the total water volume in the tank every week. Water conditions were maintained as follows: water temperature: 25–28 °C, pH: 7.0–8.5, ammonia nitrogen: <0.2 mg/L, dissolved oxygen: ≥5.0 mg/L.

2.4. Sample Collection

At the end of the feeding trial, all prawns were fasted for 24 h. The number and weight of all prawns in each tank were measured. Six prawns per tank were randomly selected and put on the ice for anesthesia. The hemolymph was collected from the pericardial sinus using a 1 mL sterile syringe with anticoagulant (6.6 g trisodium citrate, 2.4 g citric acid, 7.35 g glucose and double-distilled water to 500 mL). The hemolymph and anticoagulant were mixed at a ratio of 1:1 (v:v) and centrifuged (4 °C 4000 rpm for 10 min) to collect the supernatant. Three pooled hemolymph samples were obtained per tank for biochemical analysis of lipid content determination. Hepatopancreas and gut samples were collected too. A total of six prawns per tank were randomly obtained to collect hepatopancreas samples. Three hepatopancreas samples were put into Eppendorf tubes and stored at −80 °C for further analyzing the lipid content, antioxidant enzymes, and immune parameters. Another three hepatopancreas samples were preserved in RNAios plus (Takara, Dalian, China) for relative gene expression detection. Six gut samples from the same tank were pooled as one sample (four pooled samples per treatment) for gut microbiota sequencing detection.

2.5. Growth Performance Calculations

Growth performance parameters were calculated according to Hasanthi and Lee [27], as follows:
  • Initial biomass (IBM, g/tank), total prawn weight in each tank before the feeding trial
  • Final biomass (FBM, g/tank), total prawn weight in each tank after the feeding trial
  • Biomass increase (BMI, g/tank) = Final biomass − Initial biomass
  • Final body weight (FBW, g/prawn) = Final biomass/Final number of prawns
  • Survival (SR, %) = 100 × (Final prawn number/Initial prawn number)
  • Feed conversion ratio (FCR) = Feed intake (g/tank)/Biomass increase

2.6. Biochemical ParametersAnalysis

2.6.1. Lipid Contents in Hepatopancreas and Hemolymph Detection

The hepatopancreas (about 0.1 g) was homogenized in 0.9 mL of sterile 0.85% saline and then centrifuged at 4 °C, 3000 rpm for 10 min to obtain the supernatant. Total protein concentration was detected based on the Coomassie brilliant blue method by commercial kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). Then, triglyceride (TG) and total cholesterol (TC) contents in the hepatopancreas were detected using kits from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The TG and TC contents in the hemolymph were detected by an automatic biochemical analyzer (Mindray BS-400, Shenzhen Mindray Bio-Medical Electronics Co., Ltd., Shenzhen, China) using the corresponding commercial kits.

2.6.2. Antioxidant Capacity Detection

The activities of superoxide dismutase (SOD), glutathione peroxidase (GPX), catalase (CAT), and inducible nitric oxide synthase (iNOS), as well as the contents of malondialdehyde (MDA) and nitric oxide (NO), in the hepatopancreas were detected with kits from Nanjing Jiancheng Bioengineering Institute (Nangjing, China).

2.7. RT-PCR Detection

The total RNA extraction from the hepatopancreas sample, the extracted RNA’s quantity and quality estimation, and reverse transcription to cDNA were conducted as described in our previous study [28]. The cDNA was synthesized following the ExScript™ RT-PCR kit’s instruction (Dalian Takara Co., Ltd., Dalian, China). The cDNAs were amplified by PCR with TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) Kit using a CFX 96 Real-time PCR Detection System (Bio-rad, Hercules, CA, USA). The β-actin was used as house-keeping gene, and the sequences of all primers were synthesized by Shanghai Generay Biotech Co., Ltd. (Shanghai, China) and were listed in Table 3. The 2−ΔΔCT method was used to quantify the relative gene expression.

2.8. Analysis of Gut Microbiota

2.8.1. DNA Extraction and Illumina MiSeq

The E.Z.N.A.® Soil DNA Kit (Omega Bio-Tek, Norcross, GA, USA) was used to directly extract total DNA of microbes from pooled gut samples. The V3-V4 region of microbial 16S rRNA gene was amplified by polymerase chain reaction (PCR) using universal primer 338 F (5′-ACTCCTACGGGAGGCAGCAG-3′) and 806 R (5′-GGAC TACHVGGGTWTCTAAT-3′). The purified library was built and sequenced using an Illumina MiSeq platform (Illumina, San Diego, CA, USA) after the PCR products were quantified, combined, and purified.
To obtain clean reads for further analysis, raw data after sequencing were merged by FLASH (version 1.2.11) [35]. And then, chimeric sequences were detected and removed to obtain high-quality clean tags using VSEARCH (version 2.13.4) [36]. UPARSE (version 7.1) was used to cluster high-quality sequences into amplicon sequence variants (ASVs) for bioinformatics analysis based on a 97% sequence similarity level. According to the Ribosomal Database Project (RDP) database [37], taxonomic classifications were annotated after selecting representative sequence of ASVs and screening each ASV.

2.8.2. Richness, Diversity, and Composition Analysis of Gut Microbiota

Alpha-diversity indices (Observed species, Chao 1, Shannon), which reflected richness and diversity of gut microbial community in each sample, were analyzed using QIIME2 (version 2022.11). The Venn diagram and percent stacked column chart were conducted to display the shared and unique phyla or genera in each group and the species composition in each sample, respectively. The differences in species complexity among groups were assessed by principal coordinates analysis (PCoA) performed with R package (version 4.4.2).

2.8.3. LEfSe Analysis of Gut Microbiota

The specific taxa microbes, i.e., biomarkers in different groups were identified by applying linear discrimination analysis effect size (LEfSe) using nonparametric Kruskal–Wallis and Wilcoxon rank-sum tests. The LDA score value threshold was set ≥3. Then, the differential analysis of gut microbes at the genus level was performed using STAMP (Statistical Analysis of Metagenomic Profiling) software (version 2.1.3). The same species of different gut microbes based on both analysis methods were found out and compared.

2.9. Evaluation Analysis

The parameters of lipid metabolism, antioxidant capacity, and dominant genera were submitted to do the Pearson’s correlation analysis. The p-value threshold was set <0.05. The heatmap created using R package (version 4.4.2) represented the correlation ship between microbiota at genus level and other parameters.
The genera whose abundances were in the top 50 in three groups were selected, and submitted to construct interspecies interaction network within group by Pearson’s correlation analysis. The absolute values of coefficient and p-value were ≥0.95 and <0.05 respectively. The visual networks were created using Gephi (version 0.9.7).

2.10. Statistical Analysis

Mean values of parameters of lipid contents, enzyme activities, and gene relative expressions of three samples in the same tank were submitted to SPSS (v.26.0) for statistical analysis. The results were shown as mean ± standard errors. All data were assessed using one-way analysis of variance (ANOVA) with Duncan’s adjustment firstly. Then, Student’s t test was used to assess the difference between two groups. Values with p < 0.05 were regarded as statistically significant.

3. Results

3.1. Growth Performance

As shown in Figure 1, the SR of prawns in the CT group was significantly decreased than that in the R group (p < 0.05), while it increased more in the SBP group than in the CT group to a value similar to that in the R group without significant difference (p > 0.05). The FBW, FBM, and BMI of prawns in the CT group were significantly decreased compared to those in the R group (p < 0.001). The FBW, FBM, and BMI of prawns in the SBP group were significantly increased compared with those in the CT group (p < 0.01), though they were still significantly lower than those in the R group, except FBW (p < 0.01). Conversely, the FCR of prawns in the R and SBP group were significantly lower than that in the CT group (p < 0.01). There was no significant difference in FCR between the R and SBP groups (p > 0.05).

3.2. Biochemical Parameters

3.2.1. Lipid Contents in Hepatopancreas and Hemolymph

The TG contents in the hepatopancreas and hemolymph of prawns fed with CT diet were significantly higher than that fed with R diet (p < 0.01), but TG content reduced significantly in the prawns supplemented with SBPs (p < 0.01) (Figure 2a,c), though the TG content in the hemolymph of prawns in SBP group was still significantly higher than that in the R group (p < 0.05). There was no difference on total cholesterol (TC) contents in the hepatopancreas and hemolymph among all groups (p > 0.05) (Figure 2b,d).

3.2.2. Hepatopancreatic Antioxidative Capacity

The hepatopancreatic MDA content of prawns in the CT group was significantly higher than that in the R and SBP groups (p < 0.05) (Figure 3a). Prawns fed with the CT diet showed significantly lower SOD and GPX activities than those fed with the R diet (p < 0.05) (Figure 3b,c). Moreover, SOD and GPX activities were significantly increased in the prawns fed with SBP diet than those fed with CT diet (p < 0.05). However, the GPX activity of prawns in the SBP group was still lower than that in the R group (p < 0.05) (Figure 3d). SBPs supplementation in the diet significantly increased the CAT activity of prawns compared with those in the R and CT groups (p < 0.05), while no significant difference in CAT activity was found between prawns in R and CT groups (p > 0.05). Similar with CAT activity, SBPs supplementation increased the iNOS activity and NO content in the hepatopancreas than that in the R and CT groups (p < 0.05) (Figure 3e,f).

3.3. Relative Expression of Genes Related with Lipid Metabolism and Immunity

For genes involved in lipid synthesis (Figure 4a), there were no significant differences in the relative expressions of fas and acc genes between R group and CT group, but their relative expressions were significantly downregulated in the SBP group compared with that in the CT group (p < 0.05). The mRNA level of cpt1 (Figure 4b) was significantly inhibited in the prawns fed with CT diet compared with those fed with R diet. After supplementing SBPs in the CT diet, cpt1 expression level was upregulated (p < 0.05). Moreover, SBPs supplementation in the diet significantly upregulated the sr-b I expression level more than that in the R and CT groups (p < 0.05).
As shown in Figure 5a, the mRNA levels of antioxidant enzyme genes, like sod, gpx, and cat, were significantly inhibited in the CT group compared with those in the R and SBP groups (p < 0.05). No significant differences on the relative expression of tlr and dorsal were found in the hepatopancreas of prawns among all groups (p > 0.05). The mRNA levels of imd and relish in the hepatopancreas of prawns fed with SBP were significantly upregulated than those fed with the R and CT diets (p < 0.01) (Figure 5b).

3.4. Analysis of the Gut Microbiota

3.4.1. Richness, Diversity, and Composition of the Gut Microbiota

As presented in Figure 6a–c, there were no significant differences in the observed species, Chao 1 and Shannon indices of gut microbiota in the prawns among all groups. According to the PCoA plot (Figure 6d), there was a clear separation of gut microbiota communities between R and CT groups and the same between the CT and SBP groups. However, the gut microbiota in the SBP group had high similarities with that in the R group. According to the Venn diagrams (Figure 6e,f), compared the gut microbiota of prawns in the R and CT groups, 6 phyla and 221 genera were only observed in the R group, while 4 phyla and 141 genera were only found in the CT group. When the gut microbiota in the CT and SBP groups were compared, 2 distinct phyla and 115 distinct genera were only observed in the CT group, while 7 phyla and 260 genera only appeared in SBP group.
Proteobacteria, Firmicutes, Actinobacteriota, Bacteroidota, and Acidobacteriota were dominant phyla in the gut microbiota of oriental river prawn (Figure 6g,h). The most abundant phylum was Proteobacteria, with a relative abundance ranging from 35.43% ± 11.79% to 52.84% ± 6.48%. Compared with the microbiota in the CT group, the relative abundances of Firmicutes and Bacteroidota were increased in the SBP group. At genus level, Candidatus_Hepatincola (affiliated with Proteobacteria), Aeromonas (affiliated with Proteobacteria), Chloroplast (affiliated with Cyanobacteria), AD3 (affiliated with Firmicutes), and Pseudomonas (affiliated with Proteobacteria) were the most abundant genera. Among them, the relative abundances of Aeromonas and Pseudomonas were increased in the CT group compared with those in the R group. After supplementing SBPs in the CT diet, their relative abundances reduced. Rikenellaceae_RC9_gut_group was a genus accounting a larger proportion in all treatments too. Its relative abundance was improved in the prawn fed with SBP diet compared with prawn fed with CT diet.

3.4.2. LEfSe Analysis of Gut Microbiota to Identify Biomarker

The LEfSe analysis was used to discover the significantly altered microbiota (Figure 7a). There were 36 distinct altered taxonomies in the R group, and 48 distinct altered taxonomies in the CT group when comparing the microbiota between the R and CT groups, while 34 and 50 distinct altered taxonomies were observed in the CT group and the SBP group, respectively, when comparing the microbiota between the CT group and the SBP group. Biomarkers in the CT group, including 2 classes (Planctomycetes, Gammaproteobacteria), 3 orders (Corynebacteriales, Pseudomonadales, Aeromonadales), 5 families (cvE6, Barnesiellaceae, Corynebacteriaceae, Pseudomonadaceae, Aeromonadaceae), and 6 genera (cvE6, Corynebacterium, Barnesiella, Ruminococcus_torques_group, Pseudomonas, Aeromonas), were altered when comparing the microbiota between the CT group and R, SBP groups.
Thereafter, a STAMP analysis was performed to identify and visualize genera with significant differences (Figure 7b). Compared with the R group, the abundances of Aeromonas, Corynebacterium, Pseudomonas, and Barnesiella were enriched significantly (p < 0.05) in the CT group, while the abundances of AD3, Subgroup_2, Acidibacter, WD2101_soil_group, [Eubacterium]_coprostanoligenes_group were significantly downregulated (p < 0.05). Compared with CT group, the abundance of Aeromonas was decreased significantly in the SBP group (p < 0.05), while the abundances of Prevotella, Rikenellaceae_RC9_gut_group, Lactococcus, NK4A214_group, and Subgroup_2, AD3 were increased significantly (p < 0.05).

3.5. Correlation Analysis

The correlations between gut microbiota and lipid metabolism, antioxidant capacity and immune related gene relative expressions were explored (Figure 8). The MDA content and the relative expression level of fas showed positive correlations with the abundance of Aeromonas (p < 0.05); however, the relative expression level of gpx was negatively related with Aeromonas abundance (p < 0.05). The abundances of Subgroup_2, AD3, and WD2101_soil_group were positively related with the GPX activity (p < 0.05), while they were negatively related with the expression level of relish (p < 0.05). The AD3 abundance exhibited negative relationship with hemolymph TG content and the expression level of sr-b I (p < 0.05). For Rikenellaceae_RC9_gut_group, its abundance increase upregulated the expression levels of sr-b I, imd and relish, CAT and iNOS activities, and NO content in the hepatopancreas (p < 0.05). The Lactococcus abundance was positively related with the activities of GPX and the expression levels of cpt1 and gpx (p < 0.05), whereas it was negatively related with the hepatopancreatic TG and MDA contents and hemolymph TG content (p < 0.05). Interestingly, the correlations between the Pseudomonas abundance and the above parameters were contrary to Lactococcus abundance. In addition, the abundance of Pseudomonas showed negative relationship with SOD activity and the expression level of sod. And WD2101_soil_group showed positive relation with the GPX activity and negative relation with the expression level of relish.
From the correlations presented above, Pseudomonas and Rikenellaceae_RC9_gut_group were two very important genera that influenced the lipid metabolism and immunity. Therefore, Pseudomonas and Rikenellaceae_RC9_gut_group were mainly focused to analyze the correlation network with other microbiota to understand the interaction of microbiota at genera level. In the R group (Figure 9a), there were 113 links (edges) in total. Among them, Rikenellaceae_RC9_gut_group abundance was positively correlated with the other 9 genera abundances. There was a positive relation between Pseudomonas and Corynebacterium abundances. In the CT group (Figure 9b), a total of 51 links (edges) were observed. Rikenellaceae_RC9_gut_group abundance was just positively related with Chitinibacter abundance. Pseudomonas abundance was positively related with Lachnoclostridium abundance, while it was negatively related with Rhodobacter abundance. In the SBP group (Figure 9c), there were 68 links (edges). The abundance of Pseudomonas exhibited positive relations with the abundances of WPS-2 and Escherichia-Shigella. Interestingly, Rikenellaceae_RC9_gut_group abundance was negatively related with Lachnoclostridium and Lysobacter abundances.

4. Discussion

4.1. SBPs Improved Growth Performance

SBPs exhibited potential benefits in mammals, including antioxidant [38] and immunomodulatory [39]. Undoubtedly, the improvements on antioxidant and immune functions were beneficial to the growth of animals. In this study, the effects on growth of SBPs were explored in oriental river prawn fed with a low fishmeal diet firstly. Previous study showed that the growth performance of prawn could be adversely affected when the fishmeal level in the diet was less than 25% due to soybean meal substitution [10], which was supported in this study. However, after supplying SBPs (1.25 g/kg diet) to the CT diet, the growth and feed utilization of prawn were increased. It might be because the SBPs may trigger the digestive enzyme activities, facilitating the digestion of feed nutrients, as demonstrated in study of Chinese mitten crab [25]. This study suggested that SBPs could improve the growth not only as fishmeal substitute but also as diet supplementation [40]. Host growth may be affected by a diverse range of factors, including metabolism, antioxidant, and immune status, etc. Therefore, this study investigated the relevant indicators on metabolism and antioxidant functions further.

4.2. Biochemical Parameters in Hepatopancreas and Hemolymph

4.2.1. SBPs Reduced Lipid Accumulation in Hepatopancreas and Hemolymph

It is well known that deposition of protein and lipid is the main reason for growth. Therefore, some parameters on lipid metabolism in the hepatopancreas of oriental river prawn were evaluated. Nutritional metabolism of animals can be determined by hemolymph biochemical parameters [41]. The triglyceride contents in the liver and plasma of fish were decreased because of suppression of soybean product on lipogenic enzyme activities [42]. However, the triglyceride contents of the hepatopancreas and hemolymph were increased in this study when soybean meal replaced fishmeal at high levels. A similar result was found in silvery-black porgy [2]. This may be attributed to the unbalanced amino acid profiles of soybean meal, especially the low level of taurine and glycine, which participated in the synthesis of bile acids to decrease triglyceride [43]. With the SBPs supplementation, TG contents in the hepatopancreas and hemolymph were decreased. The reason may be that the higher digestibility of SBPs may stimulate the digestive enzymes. Some SBPs had been proven to inhibit pancreatic lipase activity [40]. Moreover, SBPs were found to have the ability to inhibit the reabsorption of bile acids in the digestive system to reduce the lipid level [44]. In this study, the abundance of Pseudomonas and Lactococcus was found to be positively and negatively related with the TG contents in the hepatopancreas and hemolymph, respectively, indicating that the change in gut microbiota composition was one of the factors contributing to the TG variation.

4.2.2. SBPs Improved Antioxidant Capacity

Lipid accumulation in the hepatopancreas may cause oxidative damage, which weakens the antioxidant and immune systems [45]. This can be proven to some extent by the fact that prawns in the CT group obtained the lowest survival rate among the three groups. Then, some antioxidant activities in the hepatopancreas were determined in this study. The MDA content, as a biomarker of lipid peroxidation, was increased significantly due to the fishmeal decrease in the diet. This finding was similar with the studies of white shrimp (Litopenaeus vannamei) [46] and turbot [4]. The antioxidant enzymes’ activities, such as SOD and GPX, in the CT group were inhibited to some extent. This may be due to the overconsumption of antioxidant enzymes to prevent the oxidation caused by anti-nutritional factors in soybean meal [4]. And it might also relate to the selenium status in the diet [46]. With the addition of SBPs, the activities of SOD, GPX, and CAT were improved. Some plant-protein-derived peptides could activate the antioxidant system and prevent lipid peroxidation to decrease the peroxidation products, such as MDA [47]. It was proved that amino acids, such as histidine, tryptophan, phenylalanine, proline, glycine, lysine, isoleucine, and valine, possess strong scavenging activity of free radicals; however, peptides are more effective as antioxidants than amino acids because they play a better role in free radical scavenging, metal complexing, and aldehyde-adducting activity [47]. Studies have also proven in animals that peptides from plant sources, including soybean, could reduce the MDA content and increase the antioxidant enzymes’ (SOD, CAT, GPX) activities [48]. Particularly for invertebrates without an adaptive immune system, the innate immune system is essential for survival [49]. There are some substances that could activate the immune system in plant-derived peptides. Taking the components of SBPs in this study as an example, stachyose [50] and raffinose [51] had been proven to exhibit the effect of enhancing animal immune systems. Most importantly, several peptides derived from soybean had immunomodulatory activity [21]. There were no significant differences in the immunologic factors assessed in this study between the R and CT groups. This may be due to the fact that the level of soybean meal instead of fishmeal did not exceed the tolerance of prawn’s immune system. Nevertheless, the iNOS activity and NO content were increased significantly after SBPs supplementation. A previous study revealed that this phenomenon was to prevent the immune system from overreacting [21].

4.3. Relative Expression of Genes Related Lipid Metabolism and Immunity

The mechanism of lipid metabolism at a molecular level was investigated in this study, which is closely related to the antioxidant and immune status in vivo [45]. The fatty acid synthesis genes, such as fas and acc, in the hepatopancreas would be upregulated due to the low fishmeal in the diet according to the previous report on oriental river prawn [10]. Their expression levels were increased in the CT group than the R group in this study too, but without significant difference. Some of SBPs, such as KNPQLR, EITPEKNPQLR, and RKQEEDEDEEQQRE, had been proven to be the fatty acid synthase inhibitory peptides [52]. Therefore, the expression levels of fas and acc in the prawns’ hepatopancreas were significantly downregulated due to the SBPs supplementation in this study. Moreover, as a key factor in lipid catabolism, cpt1 was significantly inhibited in the CT group compared with the R and SBP groups. This may explain the significant reduction in TG content in hepatopancreas and hemolymph in the R and SBP groups. From the relationship heatmap, it could be clearly observed that the upregulation of cpt1 and the downregulation of fas were partly due to the abundances of Aeromonas and Pseudomonas decrease as well as the abundance of Lactococcus increase. These results indicated that lipid metabolism in hepatopancreas was partly regulated by the gut microbiota.
The reasons of antioxidant enzymes and immune factors changes are revealed at the molecular level too. The genes expression levels of sod and gpx in the CT group were downregulated to some extent. With the addition of SBPs, the gene expressions of sod, gpx, and cat were activated. The changing trends on the expression level of these antioxidant enzyme’s genes were consistent with the variations in the corresponding enzymes’ activities too. The transcription factor NF-κB activation was a prerequisite for the increase in iNOS activity [32]. Thus, the expression levels of imd and relish, as family members in the NF-κB signaling pathway, were improved with the SBPs supplement in this study, partly leading to the iNOS activity and NO content increase. The Rikenellaceae_RC9_gut_group may participate in regulating imd-relish pathway based on the correlation analysis in this study.

4.4. SBPs Altered the Gut Microbiota

4.4.1. SBPs Altered the Richness, Diversity, and Composition of the Gut Microbiota

The balance of the gut microbiota is closely related to animal health, which plays a crucial role in metabolism and immunity to maintain the homeostasis of the internal environment [53]. In this study, there was a clear difference in the gut microbiota community composition in CT group compared with the R and SBP groups based on the β-diversity analysis. It was proven by the interaction of the microbiota. Links were considered as a sign of complexity in the gut microbiota [54]. The minimum links in the CT group revealed a reduction in the complexity of the gut microbiota ecology. After supplementing SBPs, the number of links was increased. The complex network contributed to resisting the invasion of external strains [55]. It is necessary to find the key genera, which determine the complex of gut microbiota, in further study.
At the phylum level, the dominant phyla in all groups were Proteobacteria, Firmicutes, Actinobacteriota, Bacteroidota, and Acidobacteriota, respectively, which was similar with studies of white shrimp [56]. Among them, the highest abundance phylum was Proteobacteria, consistent with the result of Ding et al. [57]. The composition of gut microbial communities varies in response to diet, environmental conditions, and other factors [58]. In this study, the abundances of Firmicutes and Bacteroidota in the SBP group were higher than those in the CT group. These two phyla have been found to be involved in keeping gut immune homeostasis and enhancing animal health [59]. Therefore, results in this study supported that SBPs supplementation can be benefit gut health in prawns. Among the top 50 genera, the relative abundances of conditional pathogens, such as Aeromonas and Pseudomonas [60], were significantly higher in CT group than those in the other two groups. It was similar with the report that Aeromonas in the Atlantic salmon (Salmo salar) gut was increased, while soybean meal replaced fish meal in diet with a high level [61]. Moreover, Aeromonadaceae was found to be related to gut microbiota community dysbiosis [48].

4.4.2. Biomarkers of the Gut Microbiota

Based on LEfSe analysis, the genera Corynebacterium and Ruminococcus_torques_group were the biomarkers in the prawn fed the CT diet, and they had been proven to be opportunistic pathogens [62] that break gut barrier integrity [63]. According to the results of STAMP analysis, the alter trend in AD3 and Subgroup_2 abundances was opposite to that of Aeromonas. It could be inferred that these two genera are potential probiotics combined with the health status of prawn. In addition, SBPs supplementation significantly increased the Rikenellaceae_RC9_gut_group and Lactococcus abundances in the gut. Noticeably, the Rikenellaceae_RC9_gut_group affiliated with the family Rikenellaceae was found to be positively related with acetate production [64]. Acetate can reduce lipid deposition by synthesizing uridine as the most abundant short-chain fatty acids in the gut [45]. Rikenellaceae_RC9_gut_group was proved to be related to lipid reduction [65]. There are few studies on the effects of Lactococcus on crustaceans. But it was reported as a safe microbe since they can enhance fish development and health [66].

4.5. Correlation Analysis of the Gut Microbiota

Two genera, Pseudomonas and Rikenellaceae_RC9_gut_group, are focused on in the correlation analysis. In the gut microbiota ecological networks, Rikenellaceae_RC9_gut_group showed positive correlations with the other nine genera in the R group. However, the complex of the network was weakened clearly in the CT group. At the same time, the network of Pseudomonas was enhanced with its abundance increasing in the CT group. After supplementing SBPs in the CT diet, the Rikenellaceae_RC9_gut_group showed negative correlations with the other two genera. It is worth noting that Rikenellaceae_RC9_gut_group exhibited negative correlation with Lachnoclostridium in the SBP group when Pseudomonas was positively correlated with Lachnoclostridium in the CT group. It was supposed that the decrease in the fishmeal in this study would disrupt the balance of the gut microbiota, and SBPs supply can increase the abundance of potential probiotic Rikenellaceae_RC9_gut_group to inhibit conditional pathogen Pseudomonas and restore the gut environmental homeostasis to a certain extent. According to the correlation analysis and the theory of “gut-liver axis” [67], the variation in gut microbiota ecological networks was an important factor affecting the metabolism and immunity in the hepatopancreas. But a modulatory mechanism is required for further study.

5. Conclusions

In summary, SBPs supplementation in a low-fishmeal diet can increase the abundance of potential probiotic Rikenellaceae_RC9_gut_group to decrease the conditional pathogen Pseudomonas abundance in the gut. The changes in these bacteria boosted antioxidant enzymes activities, weakened oxidative stress, and activated the imd-relish pathway to raise the immune status via the gut–hepatopancreas axis. This suggests that SBPs is an effective additive with benefit to prawn growth and health.

Author Contributions

Conceptualization, Q.Z. and B.L.; methodology, C.Y., L.P., D.X., P.C., and H.H.; investigation, C.Y., P.C., and H.H.; data curation, C.Y., C.S., X.Z., and Q.Z.; validation, L.P., D.X., C.S., X.Z., P.C., and H.H.; writing—original draft, C.Y.; writing—review and editing, C.Y., Q.Z., C.S., X.Z., P.C., and H.H.; supervision, Q.Z. and B.L.; funding acquisition, Q.Z. and B.L. All authors have read and agreed to the published version of the manuscript.

Funding

This effort was financially sustained by the Natural Science Foundation of Jiangsu Province (grant number: BK20231138), the earmarked fund for Jiangsu Agricultural Industry Technology System (grant number: JATS [2023]470), China Agriculture Research System of MOF and MARA (grant number: CARS-48), Central Public-interest Scientific Institution Basal Research Fund, CAFS (grant number: 2023TD63).

Institutional Review Board Statement

This study was approved by the Animal Care and Use Committee of Nanjing Agricultural University (Nanjing, China) (permit number: SYXK (Su) 2011–0036).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data will be made available on request. The 16S rRNA sequencing data in this study have been uploaded URL: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1105913 (accessed on 29 April 2024) with accession number of PRJNA1105913.

Conflicts of Interest

This research work was conducted in Wuxi Fisheries College, Nanjing Agricultural University and Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences. Peng Chen and He Hu are employed by Jiangsu FIELD Technology Co., Ltd. They declared the conflicts of interest: No conflicts of interest are related to Jiangsu FIELD Technology Co., Ltd. Moreover, the other authors declare no conflicts of interest.

References

  1. Hardy, R.W. Utilization of plant proteins in fish diets: Effects of global demand and supplies of fishmeal. Aquacult. Res. 2010, 41, 770–776. [Google Scholar] [CrossRef]
  2. Yaghoubi, M.; Mozanzadeh, M.T.; Marammazi, J.G.; Safari, O.; Gisbert, E. Dietary replacement of fish meal by soy products (soybean meal and isolated soy protein) in silvery-black porgy juveniles (Sparidentex hasta). Aquaculture 2016, 464, 50–59. [Google Scholar] [CrossRef]
  3. Miao, S.Y.; Zhao, C.Z.; Zhu, J.Y.; Hu, J.T.; Dong, X.J.; Sun, L.S. Dietary soybean meal affects intestinal homoeostasis by altering the microbiota, morphology and inflammatory cytokine gene expression in northern snakehead. Sci. Rep. 2018, 8, 113. [Google Scholar] [CrossRef]
  4. Tan, C.; Zhou, H.H.; Wang, X.; Mai, K.S.; He, G. Resveratrol attenuates oxidative stress and inflammatory response in turbot fed with soybean meal based diet. Fish Shellfish Immunol. 2019, 91, 130–135. [Google Scholar] [CrossRef] [PubMed]
  5. Krogdahl, Å.; Bakke-McKellep, A.M.; Baeverfjord, G. Effects of graded levels of standard soybean meal on intestinal structure, mucosal enzyme activities, and pancreatic response in Atlantic salmon (Salmo salar L.). Aquacult. Nutr. 2003, 9, 361–371. [Google Scholar] [CrossRef]
  6. Parma, L.; Candela, M.; Soverini, M.; Turroni, S.; Consolandi, C.; Brigidi, P.; Mandrioli, L.; Sirri, R.; Fontanillas, R.; Gatta, P.P.; et al. Next-generation sequencing characterization of the gut bacterial community of gilthead sea bream (Sparus aurata L.) fed low fishmeal based diets with increasing soybean meal levels. Anim. Feed Sci. Tech. 2016, 222, 204–216. [Google Scholar] [CrossRef]
  7. Merrifield, D.L.; Dimitroglou, A.; Bradley, G.; Baker, R.T.M.; Davies, S.J. Soybean meal alters autochthonous microbial populations, microvilli morphology and compromises intestinal enterocyte integrity of rainbow trout, Oncorhynchus mykiss, (Walbaum). J. Fish Dis. 2009, 32, 755–766. [Google Scholar] [CrossRef] [PubMed]
  8. Luo, Z.; Li, X.D.; Wang, W.M.; Tan, X.Y.; Liu, X. Partial replacement of fish meal by a mixture of soybean meal and rapeseed meal in practical diets for juvenile Chinese mitten crab Eriocheir sinensis: Effects on growth performance and in vivo digestibility. Aquacult. Res. 2011, 42, 1615–1622. [Google Scholar] [CrossRef]
  9. Taher, S.; Romano, N.; Arshad, A.; Ebrahimi, M.; Teh, J.C.; Ng, W.K.; Kumar, V. Assessing the feasibility of dietary soybean meal replacement for fishmeal to the swimming crab, Portunus pelagicus, juveniles. Aquaculture 2017, 469, 88–94. [Google Scholar] [CrossRef]
  10. Zhou, Q.L.; Jiang, S.F.; Xiong, Y.W.; Liu, B.; Sun, C.X.; Jiang, Z.T.; Fu, H.T. Fishmeal level affects growth performance of Macrobrachium nipponense via regulating protein and lipid metabolism. Aquacult. Int. 2020, 28, 1771–1785. [Google Scholar] [CrossRef]
  11. Fan, Y.; Pedersen, O. Gut microbiota in human metabolic health and disease. Nat. Rev. Microbiol. 2021, 19, 55–71. [Google Scholar] [CrossRef]
  12. O’Hara, A.M.; Shanahan, F. The gut flora as a forgotten organ. EMBO J. 2006, 7, 688–693. [Google Scholar] [CrossRef]
  13. Milosevic, I.; Vujovic, A.; Barac, A.; Djelic, M.; Korac, M.; Radovanovic Spurnic, A.; Gmizic, I.; Stevanovic, O.; Djordjevic, V.; Lekic, N.; et al. Gut-Liver Axis, Gut Microbiota, and Its Modulation in the Management of Liver Diseases: A Review of the Literature. Int. J. Mol. Sci. 2019, 20, 395. [Google Scholar] [CrossRef] [PubMed]
  14. Chapman, J.A.; Stewart, C.J. Methodological challenges in neonatal microbiome research. Gut Microbes 2023, 15, 2183687. [Google Scholar] [CrossRef]
  15. Leung, C.; Rivera, L.; Furness, J.B.; Angus, P.W. The role of the gut microbiota in NAFLD. Nat. Rev. Gastroenterol. Hepatol. 2016, 13, 412–425. [Google Scholar] [CrossRef]
  16. Tomasello, G.; Mazzola, M.; Leone, A.; Sinagra, E.; Zummo, G.; Farina, F.; Damiani, P.; Cappello, F.; Gerges Geagea, A.; Jurjus, A.; et al. Nutrition, oxidative stress and intestinal dysbiosis: Influence of diet on gut microbiota in inflammatory bowel diseases. Biomed. Pap. 2016, 160, 461–466. [Google Scholar] [CrossRef]
  17. Konturek, P.C.; Harsch, I.A.; Konturek, K.; Schink, M.; Konturek, T.; Neurath, M.F.; Zopf, Y. Gut–Liver Axis: How Do Gut Bacteria Influence the Liver? Med. Sci. 2018, 6, 79. [Google Scholar] [CrossRef] [PubMed]
  18. Kho, Z.Y.; Lal, S.K. The Human Gut Microbiome—A Potential Controller of Wellness and Disease. Front. Microbiol. 2018, 9, 1835. [Google Scholar] [CrossRef]
  19. Gu, W.B.; Liu, Z.P.; Zhou, Y.L.; Li, B.; Wang, L.Z.; Dong, W.R.; Chen, Y.Y.; Shu, M.A. The nuclear factor interleukin 3-regulated (NFIL3) transcription factor involved in innate immunity by activating NF-kappa B pathway in mud crab Scylla paramamosain. Dev. Comp. Immunol. 2019, 101, 10. [Google Scholar] [CrossRef] [PubMed]
  20. Galland, F.; de Espindola, J.S.; Lopes, D.S.; Taccola, M.F.; Pacheco, M.T.B. Food-derived bioactive peptides: Mechanisms of action underlying inflammation and oxidative stress in the central nervous system. Food Chem. Adv. 2022, 1, 100087. [Google Scholar] [CrossRef]
  21. Wen, L.R.; Jiang, Y.M.; Zhou, X.S.; Bi, H.M.; Yang, B. Structure identification of soybean peptides and their immunomodulatory activity. Food Chem. 2021, 359, 129970. [Google Scholar] [CrossRef] [PubMed]
  22. Song, Z.D.; Li, H.Y.; Wang, J.Y.; Li, P.Y.; Sun, Y.Z.; Zhang, L.M. Effects of fishmeal replacement with soy protein hydrolysates on growth performance, blood biochemistry, gastrointestinal digestion and muscle composition of juvenile starry flounder (Platichthys stellatus). Aquaculture 2014, 426, 96–104. [Google Scholar] [CrossRef]
  23. Amakye, W.K.; Hou, C.; Xie, L.; Lin, X.; Gou, N.; Yuan, E.; Ren, J. Bioactive anti-aging agents and the identification of new anti-oxidant soybean peptides. Food Biosci. 2021, 42, 101194. [Google Scholar] [CrossRef]
  24. Zhou, Q.L.; Xiong, Y.; Li, P.; Saidyleigh, M.; Yang, C.; Li, J.; Sun, C.; Zheng, X.; Liu, B.; Jiang, S.; et al. Effects of animal protein feedstuffs partially replacing fishmeal in the diet of Macrobrachium nipponense. Aquacult. Res. 2022, 53, 6227–6238. [Google Scholar] [CrossRef]
  25. Jiang, K.; Liu, B.; Sun, C.; Zhou, Q.; Zheng, X.; Liu, M.; Xu, G.; Jin, W.; Tian, H.; Hu, H. Promotion of improved intestinal barrier health by soybean-derived bioactive peptides in Chinese mitten crab (Eriocheir sinensis) fed a low fishmeal diet. Br. J. Nutr. 2024, 131, 974–986. [Google Scholar] [CrossRef]
  26. AOAC. Official Methods of Analysis of AOAC International, 8th ed.; Association of Official Analytical Chemists: Washington, DC, USA, 2005. [Google Scholar] [CrossRef]
  27. Hasanthi, M.; Lee, K.J. Dietary niacin requirement of Pacific white shrimp (Litopenaeus vannamei). Aquaculture 2023, 566, 739169. [Google Scholar] [CrossRef]
  28. Yang, C.; Ye, L.Z.; Liu, B.; Sun, C.X.; Zheng, X.C.; Miao, L.H.; Zhou, Q.L.; Jiang, S.F. Dietary arginine requirements of oriental river prawns (Macrobrachium nipponense) assessed using growth and biomarkers of antioxidant capacity. Aquaculture 2023, 574, 739697. [Google Scholar] [CrossRef]
  29. Luo, N.; Ding, Z.-L.; Kong, Y.-Q.; Zhang, R.-F.; Zhang, Y.-X.; Wu, C.-L.; Jiang, Z.-Q.; Ye, J.-Y. An evaluation of increasing linolenic acid level in the diet of Macrobrachium nipponense: Lipid deposition, fatty acid composition and expression of lipid metabolism-related genes. Aquacult. Nutr. 2018, 24, 758–767. [Google Scholar] [CrossRef]
  30. Wang, J.W.; Che, Y.C.; Sun, M.; Guo, Y.Q.; Liu, B.; Li, X.F. Optimal niacin requirement of oriental river prawn Macrobrachium nipponense as determined by growth, energy sensing, and glycolipid metabolism. Aquacult. Nutr. 2022, 2022, 8596427. [Google Scholar] [CrossRef]
  31. Huang, Y.; Wu, D.; Li, Y.; Chen, Q.; Zhao, Y. Characterization and expression of arginine kinase 2 from Macrobrachium nipponense in response to salinity stress. Dev. Comp. Immunol. 2020, 113, 103804. [Google Scholar] [CrossRef]
  32. Lv, B.; Liu, B.; Zhou, Q.; Song, C.; Sun, C.; Zhang, H.; Jiang, Z.; Jiang, S.; Liu, M. Effects of different temperatures and protein levels on growth performance, physiological response and expression of immune-related genes of juvenile oriental river prawn (Macrobrachium nipponense). Aquaculture 2021, 536, 736435. [Google Scholar] [CrossRef]
  33. Song, C.; Liu, B.; Jiang, S.; Xiong, Y.; Sun, C.; Zhou, Q.; Jiang, Z.; Liu, B.; Zhang, H. Anthraquinone extract from Rheum officinale Bail improves growth performance and Toll–Relish signaling-regulated immunity and hyperthermia tolerance in freshwater prawn Macrobrachium nipponense. 3 Biotech. 2020, 10, 1–11. [Google Scholar] [CrossRef] [PubMed]
  34. Li, T.T.; Ding, Z.F.; Pan, X.T.; Ma, F.T.; Han, K.K.; Wu, L.; Zhao, L.L.; Ren, Q.; Zhang, X.W. Characterization of an immune deficiency (IMD) homolog from the oriental river prawn, Macrobrachium nipponense. Fish Shellfish Immunol. 2018, 83, 115–122. [Google Scholar] [CrossRef] [PubMed]
  35. Magoč, T.; Salzberg, S.L. FLASH: Fast length adjustment of short reads to improve genome assemblies. Bioinf. 2011, 27, 2957–2963. [Google Scholar] [CrossRef] [PubMed]
  36. Rognes, T.; Flouri, T.; Nichols, B.; Quince, C.; Mahé, F. VSEARCH: A versatile open source tool for metagenomics. PeerJ 2016, 4, e2584. [Google Scholar] [CrossRef]
  37. Cole, J.R.; Wang, Q.; Cardenas, E.; Fish, J.; Chai, B.; Farris, R.J.; Kulam-Syed-Mohideen, A.S.; McGarrell, D.M.; Marsh, T.; Garrity, G.M.; et al. The Ribosomal Database Project: Improved alignments and new tools for rRNA analysis. Nucleic Acids Res. 2009, 37, 141–145. [Google Scholar] [CrossRef]
  38. Yang, J.H.; Mau, J.L.; Ko, P.T.; Huang, L.C. Antioxidant properties of fermented soybean broth. Food Chem. 2000, 71, 249–254. [Google Scholar] [CrossRef]
  39. Mejia, E.G.; Dia, V.P. Lunasin and lunasin-like peptides inhibit inflammation through suppression of NF-kB pathway in the macrophage. Peptides 2009, 30, 2388–2398. [Google Scholar] [CrossRef]
  40. Zhao, Z.X.; Song, C.Y.; Xie, J.; Ge, X.P.; Liu, B.; Xia, S.L.; Yang, S.; Wang, Q.; Zhu, S.H. Effects of fish meal replacement by soybean peptide on growth performance, digestive enzyme activities, and immune responses of yellow catfish Pelteobagrus fulvidraco. Fish. Sci. 2016, 82, 665–673. [Google Scholar] [CrossRef]
  41. Niu, Y.; Wan, X.L.; Zhang, L.L.; Wang, C.; He, J.T.; Bai, K.W.; Zhang, X.H.; Zhao, L.G.; Wang, T. Effect of different doses of fermented Ginkgo biloba leaves on serum biochemistry, antioxidant capacity hepatic gene expression in broilers. Anim. Feed Sci. Technol. 2019, 248, 132–140. [Google Scholar] [CrossRef]
  42. Lim, S.J.; Kim, S.S.; Ko, G.Y.; Song, J.W.; Oh, D.H.; Kim, J.D.; Kim, J.U.; Lee, K.J. Fish meal replacement by soybean meal in diets for Tiger puffer, Takifugu rubripes. Aquaculture 2011, 313, 165–170. [Google Scholar] [CrossRef]
  43. Liaset, B.; Madsen, L.; Hao, Q.; Criales, G.; Mellgren, G.; Marschall, H.U.; Hallenborg, P.; Espe, M.; Frøyland, L.; Kristiansen, K. Fish protein hydrolysate elevates plasma bile acids and reduces visceral adipose tissue mass in rats. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2009, 1791, 254–262. [Google Scholar] [CrossRef] [PubMed]
  44. Caponio, G.R.; Wang, D.Q.; Di Ciaula, A.; De Angelis, M.; Portincasa, P. Regulation of cholesterol metabolism by bioactive components of soy proteins: Novel translational evidence. Int. J. Mol. Sci. 2020, 22, 227. [Google Scholar] [CrossRef] [PubMed]
  45. Xu, R.; Wang, T.; Ding, F.F.; Zhou, N.N.; Qiao, F.; Chen, L.Q.; Du, Z.Y.; Zhang, M.L. Lactobacillus plantarum Ameliorates High-Carbohydrate Diet-Induced Hepatic Lipid Accumulation and Oxidative Stress by Upregulating Uridine Synthesis. Antioxidants 2022, 11, 1238. [Google Scholar] [CrossRef] [PubMed]
  46. Lin, Y.H.; Mui, J.J. Comparison of dietary inclusion of commercial and fermented soybean meal on oxidative status and non-specific immune responses in white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol. 2017, 63, 208–212. [Google Scholar] [CrossRef]
  47. César, A.P.; Lopes, F.E.; Azevedo, F.F.; Pinto, Y.O.; Andrade, C.R.; Mesquita, F.P.; Silva, G.O.; Freitas, C.D.; Souza, P.F. Antioxidant peptides from plants: A review. Phytochem. Rev. 2024, 23, 95–104. [Google Scholar] [CrossRef]
  48. Yu, T.; Guo, J.; Zhu, S.; Zhang, X.; Zhu, Z.Z.; Cheng, S.; Cong, X. Protective effects of selenium-enriched peptides from Cardamine violifolia on D-galactose-induced brain aging by alleviating oxidative stress, neuroinflammation, and neuron apoptosis. J. Funct. Foods 2020, 75, 104277. [Google Scholar] [CrossRef]
  49. Zhang, M.; Sun, Y.; Chen, K.; Yu, N.; Zhou, Z.; Chen, L.; Du, Z.; Li, E. Characterization of the intestinal microbiota in Pacific white shrimp, Litopenaeus vannamei, fed diets with different lipid sources. Aquaculture 2014, 434, 449–455. [Google Scholar] [CrossRef]
  50. Ta, X.; Wang, B.; Bai, J.; Yu, J.; Chen, H.; Wang, C. The source, extraction, purification, physiological function, and application of stachyose in the food industry. Food Chem. 2024, 461, 140791. [Google Scholar] [CrossRef]
  51. Zeng, Z.; Zhang, Y.; He, J.; Yu, J.; Mao, X.; Zheng, P.; Luo, Y.; Luo, J.; Huang, Z.; Yu, B.; et al. Effects of soybean raffinose on growth performance, digestibility, humoral immunity and intestinal morphology of growing pigs. Anim. Nutr. 2021, 7, 393–399. [Google Scholar] [CrossRef]
  52. Villaluenga, C.; Rupasinghe, S.; Schuler, M.; Mejia, E. Peptides from purified soybean b-conglycinin inhibit fatty acid synthase by interaction with the thioesterase catalytic domain. FEBS J 2010, 277, 1481–1493. [Google Scholar] [CrossRef] [PubMed]
  53. Cao, Y.; Tian, B.; Zhang, Z.; Yang, K.; Cai, M.; Hu, W.; Guo, Y.; Xia, Q.; Wu, W. Positive effects of dietary fiber from sweet potato [Ipomoea batatas (L.) Lam.] peels by different extraction methods on human fecal microbiota in vitro fermentation. Front. Nutr. 2022, 9, 986667. [Google Scholar] [CrossRef]
  54. Zhou, L.; Chen, C.; Xie, J.; Xu, C.; Zhao, Q.; Qin, J.G.; Chen, L.; Li, E. Intestinal bacterial signatures of the “cotton shrimp-like” disease explain the change of growth performance and immune responses in Pacific white shrimp (Litopenaeus vannamei). Fish Shellfish Immunol. 2019, 92, 629–636. [Google Scholar] [CrossRef]
  55. Nie, L.; Zhou, Q.J.; Qiao, Y.; Chen, J. Interplay between the gut microbiota and immune responses of ayu (Plecoglossus altivelis) during Vibrio anguillarum infection. Fish Shellfish Immunol. 2017, 68, 479–487. [Google Scholar] [CrossRef] [PubMed]
  56. Landsman, A.; St-Pierre, B.; Rosales-Leija, M.; Brown, M.; Gibbons, W. Impact of aquaculture practices on intestinal bacterial profiles of Pacific whiteleg shrimp Litopenaeus vannamei. Microorganisms 2019, 7, 93. [Google Scholar] [CrossRef] [PubMed]
  57. Ding, Z.; Chen, X.; Kong, Y.; Shao, X.; Zhang, Y.; Ye, J. Dietary manganese requirement and its effects on antioxidant enzyme activities, intestinal morphology and microbiota in oriental river prawn Macrobrachium nipponense (De Haan). Aquaculture 2020, 516, 734622. [Google Scholar] [CrossRef]
  58. Cornejo-Granados, F.; Lopez-Zavala, A.A.; Gallardo-Becerra, L.; Mendoza-Vargas, A.; Sánchez, F.; Vichido, R.; Brieba, L.G.; Viana, M.T.; Sotelo-Mundo, R.R.; Ochoa-Leyva, A. Microbiome of Pacific Whiteleg shrimp reveals differential bacterial community composition between Wild, Aquacultured and AHPND/EMS outbreak conditions. Sci. Rep. 2017, 7, 11783. [Google Scholar] [CrossRef]
  59. Kang, C.; Wang, B.; Kaliannan, K.; Wang, X.; Lang, H.; Hui, S.; Huang, L.; Zhang, Y.; Zhou, M.; Chen, M. Gut Microbiota Mediates the Protective Effects of Dietary Capsaicin against Chronic Low-Grade Inflammation and Associated Obesity Induced by High-Fat Diet. MBio 2017, 8, e00470-17. [Google Scholar] [CrossRef]
  60. Fernández-Bravo, A.; López-Fernández, L.; Figueras, M.J. The Metallochaperone Encoding Gene hypA Is Widely Distributed among Pathogenic Aeromonas spp. and Its Expression Is Increased under Acidic pH and within Macrophages. Microorganisms 2019, 7, 415. [Google Scholar] [CrossRef]
  61. Navarrete, P.; Fuentes, P.; De la Fuente, L.; Barros, L.; Magne, F.; Opazo, R.; Ibacache, C.; Espejo, R.; Romero, J. Short-term effects of dietary soybean meal and lactic acid bacteria on the intestinal morphology and microbiota of Atlantic salmon (Salmo salar). Aquacult. Nutr. 2013, 19, 827–836. [Google Scholar] [CrossRef]
  62. Hu, R.; He, Z.; Liu, M.; Tan, J.; Zhang, H.; Hou, D.X.; He, J.; Wu, S. Dietary protocatechuic acid ameliorates inflammation and up-regulates intestinal tight junction proteins by modulating gut microbiota in LPS-challenged piglets. J. Anim. Sci. Biotechnol. 2020, 11, 1–12. [Google Scholar] [CrossRef] [PubMed]
  63. Deaver, J.A.; Eum, S.Y.; Toborek, M. Circadian disruption changes gut microbiome taxa and functional gene composition. Front. Microbiol. 2018, 9, 737. [Google Scholar] [CrossRef] [PubMed]
  64. Ravelo, A.D.; Arce-Cordero, J.A.; Lobo, R.R.; Liu, T.; Jeong, K.C.; Faciola, A. Effects of partially replacing dietary corn with sugars in a dual-flow continuous culture system on the ruminal microbiome. Transl. Anim. Sci. 2023, 7, txad011. [Google Scholar] [CrossRef]
  65. Lan, Y.; Sun, Q.; Ma, Z.; Peng, J.; Zhang, M.; Wang, C.; Zhang, X.; Yan, X.; Chang, L.; Hou, X.; et al. Seabuckthorn polysaccharide ameliorates high-fat diet-induced obesity by gut microbiota-SCFAs-liver axis. Food Funct. 2022, 13, 2925–2937. [Google Scholar] [CrossRef] [PubMed]
  66. Sequeiros, C.; Garcés, M.E.; Vallejo, M.; Marguet, E.R.; Olivera, N.L. Potential aquaculture probiont Lactococcus lactis TW34 produces nisin Z and inhibits the fish pathogen Lactococcus garvieae. Arch. Microbiol. 2015, 197, 449–458. [Google Scholar] [CrossRef] [PubMed]
  67. Miura, K.; Ohnishi, H. Role of gut microbiota and toll-like receptors in nonalcoholic fatty liver disease. World J. Gastroenterol. 2014, 20, 7381–7391. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Effects of SBPs on growth performance of oriental river prawn: (a) survival; (b) average final body weight; (c) final biomass; (d) biomass increase; (e) feed conversion ratio. n = 4. * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 1. Effects of SBPs on growth performance of oriental river prawn: (a) survival; (b) average final body weight; (c) final biomass; (d) biomass increase; (e) feed conversion ratio. n = 4. * p < 0.05, ** p < 0.01, *** p < 0.001.
Biology 14 00011 g001
Figure 2. SBPs reduced lipid accumulation in the hepatopancreas of oriental river prawn fed with the low-fishmeal diet. (ad) Assay of the hepatopancreatic and hemolymph triglyceride (TG) and total cholesterol (TC) (n = 4) (* p < 0.05, ** p < 0.01, *** p < 0.001).
Figure 2. SBPs reduced lipid accumulation in the hepatopancreas of oriental river prawn fed with the low-fishmeal diet. (ad) Assay of the hepatopancreatic and hemolymph triglyceride (TG) and total cholesterol (TC) (n = 4) (* p < 0.05, ** p < 0.01, *** p < 0.001).
Biology 14 00011 g002
Figure 3. SBPs improved antioxidative capacity in prawns’ hepatopancreas: (a) malondialdehyde (MDA) content in the hepatopancreas (n = 4). (bd) The hepatopancreatic superoxide dismutase (SOD), glutathione peroxidase (GPX), and catalase (CAT) activities (n = 4). (e,f) The inducible nitric oxide synthase (iNOS) activity and nitric oxide (NO) content in hepatopancreas (n = 4) (* p < 0.05, ** p < 0.01, *** p < 0.001).
Figure 3. SBPs improved antioxidative capacity in prawns’ hepatopancreas: (a) malondialdehyde (MDA) content in the hepatopancreas (n = 4). (bd) The hepatopancreatic superoxide dismutase (SOD), glutathione peroxidase (GPX), and catalase (CAT) activities (n = 4). (e,f) The inducible nitric oxide synthase (iNOS) activity and nitric oxide (NO) content in hepatopancreas (n = 4) (* p < 0.05, ** p < 0.01, *** p < 0.001).
Biology 14 00011 g003
Figure 4. SBPs activated lipid catabolism genes’ expressions in hepatopancreas. (a) Relative expression of lipid synthesis genes in hepatopancreas (n = 4). fas, fatty acid synthase; acc, acetyl-CoA carboxylase; scd, acyl-CoA delta-9 desaturase; (b) Relative expression of lipid catabolism genes in hepatopancreas (n = 4) cpt1, carnitine palmitoyltransferase 1; sr-b I, scavenger receptor class B type I; hsl, hormone-sensitive triglayceride lipase. (* p < 0.05, ** p < 0.01).
Figure 4. SBPs activated lipid catabolism genes’ expressions in hepatopancreas. (a) Relative expression of lipid synthesis genes in hepatopancreas (n = 4). fas, fatty acid synthase; acc, acetyl-CoA carboxylase; scd, acyl-CoA delta-9 desaturase; (b) Relative expression of lipid catabolism genes in hepatopancreas (n = 4) cpt1, carnitine palmitoyltransferase 1; sr-b I, scavenger receptor class B type I; hsl, hormone-sensitive triglayceride lipase. (* p < 0.05, ** p < 0.01).
Biology 14 00011 g004
Figure 5. SBPs upregulated genes’ expressions on antioxidant enzymes and imd/relish in hepatopancreas. (a) Relative expression of genes on antioxidant enzymes in hepatopancreas (n = 4) (b) Relative expression of genes like tlr, dorsal, imd, and relish in hepatopancreas (n = 4) (* p < 0.05, ** p < 0.01, *** p < 0.001).
Figure 5. SBPs upregulated genes’ expressions on antioxidant enzymes and imd/relish in hepatopancreas. (a) Relative expression of genes on antioxidant enzymes in hepatopancreas (n = 4) (b) Relative expression of genes like tlr, dorsal, imd, and relish in hepatopancreas (n = 4) (* p < 0.05, ** p < 0.01, *** p < 0.001).
Biology 14 00011 g005
Figure 6. SBPs ameliorated the gut microbiota composition. (ac) Observed species, Chao1 and Shannon index (n = 4). (d) Principal coordinates analysis between three groups. (e,f) Venn diagram comparing gut microbiota distribution at phylum and genus level. (g,h) Relative abundances of the major taxonomic lineages at phylum and genus level.
Figure 6. SBPs ameliorated the gut microbiota composition. (ac) Observed species, Chao1 and Shannon index (n = 4). (d) Principal coordinates analysis between three groups. (e,f) Venn diagram comparing gut microbiota distribution at phylum and genus level. (g,h) Relative abundances of the major taxonomic lineages at phylum and genus level.
Biology 14 00011 g006
Figure 7. Analysis of microbiota differences between groups: (a) LEfSe analysis between R and CT as well as CT and SBP. Bar chart indicating the log-transformed LDA scores between groups, with a threshold of LDA > 3.0. (b) Bar diagram of altered microbes at genus level in the CT group compared with R group or SBP group; p-value < 0.05 represents a significant difference.
Figure 7. Analysis of microbiota differences between groups: (a) LEfSe analysis between R and CT as well as CT and SBP. Bar chart indicating the log-transformed LDA scores between groups, with a threshold of LDA > 3.0. (b) Bar diagram of altered microbes at genus level in the CT group compared with R group or SBP group; p-value < 0.05 represents a significant difference.
Biology 14 00011 g007
Figure 8. Correlation analyses between genera of gut microbiota and biochemical and molecular indexes. Red or green circles suggest positive or negative relations, respectively. Asterisks within the different circles represent significance, * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 8. Correlation analyses between genera of gut microbiota and biochemical and molecular indexes. Red or green circles suggest positive or negative relations, respectively. Asterisks within the different circles represent significance, * p < 0.05, ** p < 0.01, *** p < 0.001.
Biology 14 00011 g008
Figure 9. Ecological interaction network analysis of gut microbiota at genus level. (ac) Interspecies interaction network of gut microbiota for oriental river prawn fed with different diet. Each node corresponds to a genus. Node colors represent genus belonged to different classes. A red or green edge suggests positive or negative correlations between two individual nodes.
Figure 9. Ecological interaction network analysis of gut microbiota at genus level. (ac) Interspecies interaction network of gut microbiota for oriental river prawn fed with different diet. Each node corresponds to a genus. Node colors represent genus belonged to different classes. A red or green edge suggests positive or negative correlations between two individual nodes.
Biology 14 00011 g009
Table 1. The composition and nutrient levels of experimental diets (%, dry matter).
Table 1. The composition and nutrient levels of experimental diets (%, dry matter).
IngredientsRCTSBP
Fishmeal a32.0022.0022.00
Soybean meal a10.0024.0024.00
Rapeseed meal a10.0010.0010.00
Peanut meal a10.0010.0010.00
Blood meal a6.006.006.00
α-starch b23.2018.7018.575
Fish oil a2.002.252.25
Soybean oil a2.002.252.25
Monocalcium phosphate a2.002.002.00
Choline chloride c0.300.300.30
Vitamin and mineral premix c1.001.001.00
Bentonite c1.001.001.00
Salt0.500.500.50
Soybean bioactive peptides d0.000.000.125
Proximate Composition
Dry matter91.5392.3292.43
Crude protein39.7539.8439.91
Crude lipid7.657.827.93
Ash9.949.819.78
Fiber2.653.303.31
Gross energy (MJ/kg)18.5018.7018.75
Notes: a Provided by Jiangsu Fuyuda Food Products Co., Ltd., Yangzhou, China; b Provided by Foshan Guonong Starch Co., Ltd., Foshan, China; c Provided by Wuxi Hanove Animal Health Products Co., Ltd., Wuxi, China. d Provided by Jiangsu FIELD Technology Co., Ltd., Huaian, China.
Table 2. Main components and levels in soybean-derived bioactive peptides (SBPs).
Table 2. Main components and levels in soybean-derived bioactive peptides (SBPs).
Components (g/L)Soybean-Derived Bioactive Peptides
Crude protein, ≥40.0
Crude fiber, ≥10.0
Crude lipid, ≥15
Acid soluble protein (% of total protein), ≥30
Stachyose, ≤0.5
Raffinose, ≤0.5
pH3.5–4.5
Table 3. Real-time qPCR primer sequence.
Table 3. Real-time qPCR primer sequence.
GenePrimer Sequence (5′→3′)Accession Number
/Reference
β-actinF: GTGCCCATCTACGAGGGTTA[29]
R: CGTCAGGGAGCTCGTAAGAC
fasF: CGGTCAGACAAACTACGGCT[10]
R: CACTGAATAGCCACCCCAGG
accF: CAAGGTCCACTACATGGTCT[29]
R: ACTCTTCCCAAACTCTCTCC
cpt1F: AATTTTTGACTGGCTTCTCC[29]
R: TCCATTCTGGAAATCATCTG
sr-b IF: TTATCCCTGGTGTGAATGTGKP658863
R: GAACTCTTCCCATTCCAACT
hslF: GAAGGCCAGCGCTAATTTCGMK633965.1
R: TCGAACCACCCATGAGAAGC[30]
scdF: ATAATGTTTGCCCTGCTACAKU922943.1
R: ATGTCATTCTGGAAGGCAAT[29]
sodF: AGTTTCAGCCGTCTGTTCG[31]
R: CACAGTGCTTACATCACCCTTA
gpxF: CCTGGCTTTCCCCTGTAACC[31]
R: ACCGAGTCATCCGAAGGCA
catF: GAACTGGGATTTGGTTGGCA[31]
R: GGTCCGAGAAAAGGATGGTG
tlrF: CGACCTCCACGACAACAAGA[32]
R: AAAGTTCCTGCACCAATGCG
dorsalF: TACGACCAACGGACAAGAGC[33]
R: CGCATTGTTGCTGTTTCCCA
imdF: GGCACCAAGCCTTCTTTTCAG[34]
R: ATATCCTTCGGGTCGCATTTC
relishF: TGCCAGACAGCCTTAAACGAT[33]
R: CTTGGAGGGTGGGTCATTGT
Notes: fas, fatty acid synthase; acc, acetyl-CoA carboxylase; cpt1, carnitine palmitoyltransferase 1; sr-b I, scavenger receptor class B type I; hsl, hormone-sensitive triglyceride lipase; scd, acyl-CoA delta-9 desaturase; sod, superoxide dismutase; gpx, glutathione peroxidase; cat, catalase; tlr, Toll-like receptor; imd, immune deficiency.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yang, C.; Liu, B.; Pan, L.; Xia, D.; Sun, C.; Zheng, X.; Chen, P.; Hu, H.; Zhou, Q. Impact of Soybean Bioactive Peptides on Growth, Lipid Metabolism, Antioxidant Ability, Molecular Responses, and Gut Microbiota of Oriental River Prawn (Macrobrachium nipponense) Fed with a Low-Fishmeal Diet. Biology 2025, 14, 11. https://doi.org/10.3390/biology14010011

AMA Style

Yang C, Liu B, Pan L, Xia D, Sun C, Zheng X, Chen P, Hu H, Zhou Q. Impact of Soybean Bioactive Peptides on Growth, Lipid Metabolism, Antioxidant Ability, Molecular Responses, and Gut Microbiota of Oriental River Prawn (Macrobrachium nipponense) Fed with a Low-Fishmeal Diet. Biology. 2025; 14(1):11. https://doi.org/10.3390/biology14010011

Chicago/Turabian Style

Yang, Chang, Bo Liu, Liangkun Pan, Dong Xia, Cunxin Sun, Xiaochuan Zheng, Peng Chen, He Hu, and Qunlan Zhou. 2025. "Impact of Soybean Bioactive Peptides on Growth, Lipid Metabolism, Antioxidant Ability, Molecular Responses, and Gut Microbiota of Oriental River Prawn (Macrobrachium nipponense) Fed with a Low-Fishmeal Diet" Biology 14, no. 1: 11. https://doi.org/10.3390/biology14010011

APA Style

Yang, C., Liu, B., Pan, L., Xia, D., Sun, C., Zheng, X., Chen, P., Hu, H., & Zhou, Q. (2025). Impact of Soybean Bioactive Peptides on Growth, Lipid Metabolism, Antioxidant Ability, Molecular Responses, and Gut Microbiota of Oriental River Prawn (Macrobrachium nipponense) Fed with a Low-Fishmeal Diet. Biology, 14(1), 11. https://doi.org/10.3390/biology14010011

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop