Impact of Soybean Bioactive Peptides on Growth, Lipid Metabolism, Antioxidant Ability, Molecular Responses, and Gut Microbiota of Oriental River Prawn (Macrobrachium nipponense) Fed with a Low-Fishmeal Diet
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Site
2.2. Diet Preparation and Proximate Composition Analysis
2.3. Feeding Trial and Experimental Conditions
2.4. Sample Collection
2.5. Growth Performance Calculations
- Initial biomass (IBM, g/tank), total prawn weight in each tank before the feeding trial
- Final biomass (FBM, g/tank), total prawn weight in each tank after the feeding trial
- Biomass increase (BMI, g/tank) = Final biomass − Initial biomass
- Final body weight (FBW, g/prawn) = Final biomass/Final number of prawns
- Survival (SR, %) = 100 × (Final prawn number/Initial prawn number)
- Feed conversion ratio (FCR) = Feed intake (g/tank)/Biomass increase
2.6. Biochemical ParametersAnalysis
2.6.1. Lipid Contents in Hepatopancreas and Hemolymph Detection
2.6.2. Antioxidant Capacity Detection
2.7. RT-PCR Detection
2.8. Analysis of Gut Microbiota
2.8.1. DNA Extraction and Illumina MiSeq
2.8.2. Richness, Diversity, and Composition Analysis of Gut Microbiota
2.8.3. LEfSe Analysis of Gut Microbiota
2.9. Evaluation Analysis
2.10. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Biochemical Parameters
3.2.1. Lipid Contents in Hepatopancreas and Hemolymph
3.2.2. Hepatopancreatic Antioxidative Capacity
3.3. Relative Expression of Genes Related with Lipid Metabolism and Immunity
3.4. Analysis of the Gut Microbiota
3.4.1. Richness, Diversity, and Composition of the Gut Microbiota
3.4.2. LEfSe Analysis of Gut Microbiota to Identify Biomarker
3.5. Correlation Analysis
4. Discussion
4.1. SBPs Improved Growth Performance
4.2. Biochemical Parameters in Hepatopancreas and Hemolymph
4.2.1. SBPs Reduced Lipid Accumulation in Hepatopancreas and Hemolymph
4.2.2. SBPs Improved Antioxidant Capacity
4.3. Relative Expression of Genes Related Lipid Metabolism and Immunity
4.4. SBPs Altered the Gut Microbiota
4.4.1. SBPs Altered the Richness, Diversity, and Composition of the Gut Microbiota
4.4.2. Biomarkers of the Gut Microbiota
4.5. Correlation Analysis of the Gut Microbiota
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hardy, R.W. Utilization of plant proteins in fish diets: Effects of global demand and supplies of fishmeal. Aquacult. Res. 2010, 41, 770–776. [Google Scholar] [CrossRef]
- Yaghoubi, M.; Mozanzadeh, M.T.; Marammazi, J.G.; Safari, O.; Gisbert, E. Dietary replacement of fish meal by soy products (soybean meal and isolated soy protein) in silvery-black porgy juveniles (Sparidentex hasta). Aquaculture 2016, 464, 50–59. [Google Scholar] [CrossRef]
- Miao, S.Y.; Zhao, C.Z.; Zhu, J.Y.; Hu, J.T.; Dong, X.J.; Sun, L.S. Dietary soybean meal affects intestinal homoeostasis by altering the microbiota, morphology and inflammatory cytokine gene expression in northern snakehead. Sci. Rep. 2018, 8, 113. [Google Scholar] [CrossRef]
- Tan, C.; Zhou, H.H.; Wang, X.; Mai, K.S.; He, G. Resveratrol attenuates oxidative stress and inflammatory response in turbot fed with soybean meal based diet. Fish Shellfish Immunol. 2019, 91, 130–135. [Google Scholar] [CrossRef] [PubMed]
- Krogdahl, Å.; Bakke-McKellep, A.M.; Baeverfjord, G. Effects of graded levels of standard soybean meal on intestinal structure, mucosal enzyme activities, and pancreatic response in Atlantic salmon (Salmo salar L.). Aquacult. Nutr. 2003, 9, 361–371. [Google Scholar] [CrossRef]
- Parma, L.; Candela, M.; Soverini, M.; Turroni, S.; Consolandi, C.; Brigidi, P.; Mandrioli, L.; Sirri, R.; Fontanillas, R.; Gatta, P.P.; et al. Next-generation sequencing characterization of the gut bacterial community of gilthead sea bream (Sparus aurata L.) fed low fishmeal based diets with increasing soybean meal levels. Anim. Feed Sci. Tech. 2016, 222, 204–216. [Google Scholar] [CrossRef]
- Merrifield, D.L.; Dimitroglou, A.; Bradley, G.; Baker, R.T.M.; Davies, S.J. Soybean meal alters autochthonous microbial populations, microvilli morphology and compromises intestinal enterocyte integrity of rainbow trout, Oncorhynchus mykiss, (Walbaum). J. Fish Dis. 2009, 32, 755–766. [Google Scholar] [CrossRef] [PubMed]
- Luo, Z.; Li, X.D.; Wang, W.M.; Tan, X.Y.; Liu, X. Partial replacement of fish meal by a mixture of soybean meal and rapeseed meal in practical diets for juvenile Chinese mitten crab Eriocheir sinensis: Effects on growth performance and in vivo digestibility. Aquacult. Res. 2011, 42, 1615–1622. [Google Scholar] [CrossRef]
- Taher, S.; Romano, N.; Arshad, A.; Ebrahimi, M.; Teh, J.C.; Ng, W.K.; Kumar, V. Assessing the feasibility of dietary soybean meal replacement for fishmeal to the swimming crab, Portunus pelagicus, juveniles. Aquaculture 2017, 469, 88–94. [Google Scholar] [CrossRef]
- Zhou, Q.L.; Jiang, S.F.; Xiong, Y.W.; Liu, B.; Sun, C.X.; Jiang, Z.T.; Fu, H.T. Fishmeal level affects growth performance of Macrobrachium nipponense via regulating protein and lipid metabolism. Aquacult. Int. 2020, 28, 1771–1785. [Google Scholar] [CrossRef]
- Fan, Y.; Pedersen, O. Gut microbiota in human metabolic health and disease. Nat. Rev. Microbiol. 2021, 19, 55–71. [Google Scholar] [CrossRef]
- O’Hara, A.M.; Shanahan, F. The gut flora as a forgotten organ. EMBO J. 2006, 7, 688–693. [Google Scholar] [CrossRef]
- Milosevic, I.; Vujovic, A.; Barac, A.; Djelic, M.; Korac, M.; Radovanovic Spurnic, A.; Gmizic, I.; Stevanovic, O.; Djordjevic, V.; Lekic, N.; et al. Gut-Liver Axis, Gut Microbiota, and Its Modulation in the Management of Liver Diseases: A Review of the Literature. Int. J. Mol. Sci. 2019, 20, 395. [Google Scholar] [CrossRef] [PubMed]
- Chapman, J.A.; Stewart, C.J. Methodological challenges in neonatal microbiome research. Gut Microbes 2023, 15, 2183687. [Google Scholar] [CrossRef]
- Leung, C.; Rivera, L.; Furness, J.B.; Angus, P.W. The role of the gut microbiota in NAFLD. Nat. Rev. Gastroenterol. Hepatol. 2016, 13, 412–425. [Google Scholar] [CrossRef]
- Tomasello, G.; Mazzola, M.; Leone, A.; Sinagra, E.; Zummo, G.; Farina, F.; Damiani, P.; Cappello, F.; Gerges Geagea, A.; Jurjus, A.; et al. Nutrition, oxidative stress and intestinal dysbiosis: Influence of diet on gut microbiota in inflammatory bowel diseases. Biomed. Pap. 2016, 160, 461–466. [Google Scholar] [CrossRef]
- Konturek, P.C.; Harsch, I.A.; Konturek, K.; Schink, M.; Konturek, T.; Neurath, M.F.; Zopf, Y. Gut–Liver Axis: How Do Gut Bacteria Influence the Liver? Med. Sci. 2018, 6, 79. [Google Scholar] [CrossRef] [PubMed]
- Kho, Z.Y.; Lal, S.K. The Human Gut Microbiome—A Potential Controller of Wellness and Disease. Front. Microbiol. 2018, 9, 1835. [Google Scholar] [CrossRef]
- Gu, W.B.; Liu, Z.P.; Zhou, Y.L.; Li, B.; Wang, L.Z.; Dong, W.R.; Chen, Y.Y.; Shu, M.A. The nuclear factor interleukin 3-regulated (NFIL3) transcription factor involved in innate immunity by activating NF-kappa B pathway in mud crab Scylla paramamosain. Dev. Comp. Immunol. 2019, 101, 10. [Google Scholar] [CrossRef] [PubMed]
- Galland, F.; de Espindola, J.S.; Lopes, D.S.; Taccola, M.F.; Pacheco, M.T.B. Food-derived bioactive peptides: Mechanisms of action underlying inflammation and oxidative stress in the central nervous system. Food Chem. Adv. 2022, 1, 100087. [Google Scholar] [CrossRef]
- Wen, L.R.; Jiang, Y.M.; Zhou, X.S.; Bi, H.M.; Yang, B. Structure identification of soybean peptides and their immunomodulatory activity. Food Chem. 2021, 359, 129970. [Google Scholar] [CrossRef] [PubMed]
- Song, Z.D.; Li, H.Y.; Wang, J.Y.; Li, P.Y.; Sun, Y.Z.; Zhang, L.M. Effects of fishmeal replacement with soy protein hydrolysates on growth performance, blood biochemistry, gastrointestinal digestion and muscle composition of juvenile starry flounder (Platichthys stellatus). Aquaculture 2014, 426, 96–104. [Google Scholar] [CrossRef]
- Amakye, W.K.; Hou, C.; Xie, L.; Lin, X.; Gou, N.; Yuan, E.; Ren, J. Bioactive anti-aging agents and the identification of new anti-oxidant soybean peptides. Food Biosci. 2021, 42, 101194. [Google Scholar] [CrossRef]
- Zhou, Q.L.; Xiong, Y.; Li, P.; Saidyleigh, M.; Yang, C.; Li, J.; Sun, C.; Zheng, X.; Liu, B.; Jiang, S.; et al. Effects of animal protein feedstuffs partially replacing fishmeal in the diet of Macrobrachium nipponense. Aquacult. Res. 2022, 53, 6227–6238. [Google Scholar] [CrossRef]
- Jiang, K.; Liu, B.; Sun, C.; Zhou, Q.; Zheng, X.; Liu, M.; Xu, G.; Jin, W.; Tian, H.; Hu, H. Promotion of improved intestinal barrier health by soybean-derived bioactive peptides in Chinese mitten crab (Eriocheir sinensis) fed a low fishmeal diet. Br. J. Nutr. 2024, 131, 974–986. [Google Scholar] [CrossRef]
- AOAC. Official Methods of Analysis of AOAC International, 8th ed.; Association of Official Analytical Chemists: Washington, DC, USA, 2005. [Google Scholar] [CrossRef]
- Hasanthi, M.; Lee, K.J. Dietary niacin requirement of Pacific white shrimp (Litopenaeus vannamei). Aquaculture 2023, 566, 739169. [Google Scholar] [CrossRef]
- Yang, C.; Ye, L.Z.; Liu, B.; Sun, C.X.; Zheng, X.C.; Miao, L.H.; Zhou, Q.L.; Jiang, S.F. Dietary arginine requirements of oriental river prawns (Macrobrachium nipponense) assessed using growth and biomarkers of antioxidant capacity. Aquaculture 2023, 574, 739697. [Google Scholar] [CrossRef]
- Luo, N.; Ding, Z.-L.; Kong, Y.-Q.; Zhang, R.-F.; Zhang, Y.-X.; Wu, C.-L.; Jiang, Z.-Q.; Ye, J.-Y. An evaluation of increasing linolenic acid level in the diet of Macrobrachium nipponense: Lipid deposition, fatty acid composition and expression of lipid metabolism-related genes. Aquacult. Nutr. 2018, 24, 758–767. [Google Scholar] [CrossRef]
- Wang, J.W.; Che, Y.C.; Sun, M.; Guo, Y.Q.; Liu, B.; Li, X.F. Optimal niacin requirement of oriental river prawn Macrobrachium nipponense as determined by growth, energy sensing, and glycolipid metabolism. Aquacult. Nutr. 2022, 2022, 8596427. [Google Scholar] [CrossRef]
- Huang, Y.; Wu, D.; Li, Y.; Chen, Q.; Zhao, Y. Characterization and expression of arginine kinase 2 from Macrobrachium nipponense in response to salinity stress. Dev. Comp. Immunol. 2020, 113, 103804. [Google Scholar] [CrossRef]
- Lv, B.; Liu, B.; Zhou, Q.; Song, C.; Sun, C.; Zhang, H.; Jiang, Z.; Jiang, S.; Liu, M. Effects of different temperatures and protein levels on growth performance, physiological response and expression of immune-related genes of juvenile oriental river prawn (Macrobrachium nipponense). Aquaculture 2021, 536, 736435. [Google Scholar] [CrossRef]
- Song, C.; Liu, B.; Jiang, S.; Xiong, Y.; Sun, C.; Zhou, Q.; Jiang, Z.; Liu, B.; Zhang, H. Anthraquinone extract from Rheum officinale Bail improves growth performance and Toll–Relish signaling-regulated immunity and hyperthermia tolerance in freshwater prawn Macrobrachium nipponense. 3 Biotech. 2020, 10, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Li, T.T.; Ding, Z.F.; Pan, X.T.; Ma, F.T.; Han, K.K.; Wu, L.; Zhao, L.L.; Ren, Q.; Zhang, X.W. Characterization of an immune deficiency (IMD) homolog from the oriental river prawn, Macrobrachium nipponense. Fish Shellfish Immunol. 2018, 83, 115–122. [Google Scholar] [CrossRef] [PubMed]
- Magoč, T.; Salzberg, S.L. FLASH: Fast length adjustment of short reads to improve genome assemblies. Bioinf. 2011, 27, 2957–2963. [Google Scholar] [CrossRef] [PubMed]
- Rognes, T.; Flouri, T.; Nichols, B.; Quince, C.; Mahé, F. VSEARCH: A versatile open source tool for metagenomics. PeerJ 2016, 4, e2584. [Google Scholar] [CrossRef]
- Cole, J.R.; Wang, Q.; Cardenas, E.; Fish, J.; Chai, B.; Farris, R.J.; Kulam-Syed-Mohideen, A.S.; McGarrell, D.M.; Marsh, T.; Garrity, G.M.; et al. The Ribosomal Database Project: Improved alignments and new tools for rRNA analysis. Nucleic Acids Res. 2009, 37, 141–145. [Google Scholar] [CrossRef]
- Yang, J.H.; Mau, J.L.; Ko, P.T.; Huang, L.C. Antioxidant properties of fermented soybean broth. Food Chem. 2000, 71, 249–254. [Google Scholar] [CrossRef]
- Mejia, E.G.; Dia, V.P. Lunasin and lunasin-like peptides inhibit inflammation through suppression of NF-kB pathway in the macrophage. Peptides 2009, 30, 2388–2398. [Google Scholar] [CrossRef]
- Zhao, Z.X.; Song, C.Y.; Xie, J.; Ge, X.P.; Liu, B.; Xia, S.L.; Yang, S.; Wang, Q.; Zhu, S.H. Effects of fish meal replacement by soybean peptide on growth performance, digestive enzyme activities, and immune responses of yellow catfish Pelteobagrus fulvidraco. Fish. Sci. 2016, 82, 665–673. [Google Scholar] [CrossRef]
- Niu, Y.; Wan, X.L.; Zhang, L.L.; Wang, C.; He, J.T.; Bai, K.W.; Zhang, X.H.; Zhao, L.G.; Wang, T. Effect of different doses of fermented Ginkgo biloba leaves on serum biochemistry, antioxidant capacity hepatic gene expression in broilers. Anim. Feed Sci. Technol. 2019, 248, 132–140. [Google Scholar] [CrossRef]
- Lim, S.J.; Kim, S.S.; Ko, G.Y.; Song, J.W.; Oh, D.H.; Kim, J.D.; Kim, J.U.; Lee, K.J. Fish meal replacement by soybean meal in diets for Tiger puffer, Takifugu rubripes. Aquaculture 2011, 313, 165–170. [Google Scholar] [CrossRef]
- Liaset, B.; Madsen, L.; Hao, Q.; Criales, G.; Mellgren, G.; Marschall, H.U.; Hallenborg, P.; Espe, M.; Frøyland, L.; Kristiansen, K. Fish protein hydrolysate elevates plasma bile acids and reduces visceral adipose tissue mass in rats. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2009, 1791, 254–262. [Google Scholar] [CrossRef] [PubMed]
- Caponio, G.R.; Wang, D.Q.; Di Ciaula, A.; De Angelis, M.; Portincasa, P. Regulation of cholesterol metabolism by bioactive components of soy proteins: Novel translational evidence. Int. J. Mol. Sci. 2020, 22, 227. [Google Scholar] [CrossRef] [PubMed]
- Xu, R.; Wang, T.; Ding, F.F.; Zhou, N.N.; Qiao, F.; Chen, L.Q.; Du, Z.Y.; Zhang, M.L. Lactobacillus plantarum Ameliorates High-Carbohydrate Diet-Induced Hepatic Lipid Accumulation and Oxidative Stress by Upregulating Uridine Synthesis. Antioxidants 2022, 11, 1238. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.H.; Mui, J.J. Comparison of dietary inclusion of commercial and fermented soybean meal on oxidative status and non-specific immune responses in white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol. 2017, 63, 208–212. [Google Scholar] [CrossRef]
- César, A.P.; Lopes, F.E.; Azevedo, F.F.; Pinto, Y.O.; Andrade, C.R.; Mesquita, F.P.; Silva, G.O.; Freitas, C.D.; Souza, P.F. Antioxidant peptides from plants: A review. Phytochem. Rev. 2024, 23, 95–104. [Google Scholar] [CrossRef]
- Yu, T.; Guo, J.; Zhu, S.; Zhang, X.; Zhu, Z.Z.; Cheng, S.; Cong, X. Protective effects of selenium-enriched peptides from Cardamine violifolia on D-galactose-induced brain aging by alleviating oxidative stress, neuroinflammation, and neuron apoptosis. J. Funct. Foods 2020, 75, 104277. [Google Scholar] [CrossRef]
- Zhang, M.; Sun, Y.; Chen, K.; Yu, N.; Zhou, Z.; Chen, L.; Du, Z.; Li, E. Characterization of the intestinal microbiota in Pacific white shrimp, Litopenaeus vannamei, fed diets with different lipid sources. Aquaculture 2014, 434, 449–455. [Google Scholar] [CrossRef]
- Ta, X.; Wang, B.; Bai, J.; Yu, J.; Chen, H.; Wang, C. The source, extraction, purification, physiological function, and application of stachyose in the food industry. Food Chem. 2024, 461, 140791. [Google Scholar] [CrossRef]
- Zeng, Z.; Zhang, Y.; He, J.; Yu, J.; Mao, X.; Zheng, P.; Luo, Y.; Luo, J.; Huang, Z.; Yu, B.; et al. Effects of soybean raffinose on growth performance, digestibility, humoral immunity and intestinal morphology of growing pigs. Anim. Nutr. 2021, 7, 393–399. [Google Scholar] [CrossRef]
- Villaluenga, C.; Rupasinghe, S.; Schuler, M.; Mejia, E. Peptides from purified soybean b-conglycinin inhibit fatty acid synthase by interaction with the thioesterase catalytic domain. FEBS J 2010, 277, 1481–1493. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.; Tian, B.; Zhang, Z.; Yang, K.; Cai, M.; Hu, W.; Guo, Y.; Xia, Q.; Wu, W. Positive effects of dietary fiber from sweet potato [Ipomoea batatas (L.) Lam.] peels by different extraction methods on human fecal microbiota in vitro fermentation. Front. Nutr. 2022, 9, 986667. [Google Scholar] [CrossRef]
- Zhou, L.; Chen, C.; Xie, J.; Xu, C.; Zhao, Q.; Qin, J.G.; Chen, L.; Li, E. Intestinal bacterial signatures of the “cotton shrimp-like” disease explain the change of growth performance and immune responses in Pacific white shrimp (Litopenaeus vannamei). Fish Shellfish Immunol. 2019, 92, 629–636. [Google Scholar] [CrossRef]
- Nie, L.; Zhou, Q.J.; Qiao, Y.; Chen, J. Interplay between the gut microbiota and immune responses of ayu (Plecoglossus altivelis) during Vibrio anguillarum infection. Fish Shellfish Immunol. 2017, 68, 479–487. [Google Scholar] [CrossRef] [PubMed]
- Landsman, A.; St-Pierre, B.; Rosales-Leija, M.; Brown, M.; Gibbons, W. Impact of aquaculture practices on intestinal bacterial profiles of Pacific whiteleg shrimp Litopenaeus vannamei. Microorganisms 2019, 7, 93. [Google Scholar] [CrossRef] [PubMed]
- Ding, Z.; Chen, X.; Kong, Y.; Shao, X.; Zhang, Y.; Ye, J. Dietary manganese requirement and its effects on antioxidant enzyme activities, intestinal morphology and microbiota in oriental river prawn Macrobrachium nipponense (De Haan). Aquaculture 2020, 516, 734622. [Google Scholar] [CrossRef]
- Cornejo-Granados, F.; Lopez-Zavala, A.A.; Gallardo-Becerra, L.; Mendoza-Vargas, A.; Sánchez, F.; Vichido, R.; Brieba, L.G.; Viana, M.T.; Sotelo-Mundo, R.R.; Ochoa-Leyva, A. Microbiome of Pacific Whiteleg shrimp reveals differential bacterial community composition between Wild, Aquacultured and AHPND/EMS outbreak conditions. Sci. Rep. 2017, 7, 11783. [Google Scholar] [CrossRef]
- Kang, C.; Wang, B.; Kaliannan, K.; Wang, X.; Lang, H.; Hui, S.; Huang, L.; Zhang, Y.; Zhou, M.; Chen, M. Gut Microbiota Mediates the Protective Effects of Dietary Capsaicin against Chronic Low-Grade Inflammation and Associated Obesity Induced by High-Fat Diet. MBio 2017, 8, e00470-17. [Google Scholar] [CrossRef]
- Fernández-Bravo, A.; López-Fernández, L.; Figueras, M.J. The Metallochaperone Encoding Gene hypA Is Widely Distributed among Pathogenic Aeromonas spp. and Its Expression Is Increased under Acidic pH and within Macrophages. Microorganisms 2019, 7, 415. [Google Scholar] [CrossRef]
- Navarrete, P.; Fuentes, P.; De la Fuente, L.; Barros, L.; Magne, F.; Opazo, R.; Ibacache, C.; Espejo, R.; Romero, J. Short-term effects of dietary soybean meal and lactic acid bacteria on the intestinal morphology and microbiota of Atlantic salmon (Salmo salar). Aquacult. Nutr. 2013, 19, 827–836. [Google Scholar] [CrossRef]
- Hu, R.; He, Z.; Liu, M.; Tan, J.; Zhang, H.; Hou, D.X.; He, J.; Wu, S. Dietary protocatechuic acid ameliorates inflammation and up-regulates intestinal tight junction proteins by modulating gut microbiota in LPS-challenged piglets. J. Anim. Sci. Biotechnol. 2020, 11, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Deaver, J.A.; Eum, S.Y.; Toborek, M. Circadian disruption changes gut microbiome taxa and functional gene composition. Front. Microbiol. 2018, 9, 737. [Google Scholar] [CrossRef] [PubMed]
- Ravelo, A.D.; Arce-Cordero, J.A.; Lobo, R.R.; Liu, T.; Jeong, K.C.; Faciola, A. Effects of partially replacing dietary corn with sugars in a dual-flow continuous culture system on the ruminal microbiome. Transl. Anim. Sci. 2023, 7, txad011. [Google Scholar] [CrossRef]
- Lan, Y.; Sun, Q.; Ma, Z.; Peng, J.; Zhang, M.; Wang, C.; Zhang, X.; Yan, X.; Chang, L.; Hou, X.; et al. Seabuckthorn polysaccharide ameliorates high-fat diet-induced obesity by gut microbiota-SCFAs-liver axis. Food Funct. 2022, 13, 2925–2937. [Google Scholar] [CrossRef] [PubMed]
- Sequeiros, C.; Garcés, M.E.; Vallejo, M.; Marguet, E.R.; Olivera, N.L. Potential aquaculture probiont Lactococcus lactis TW34 produces nisin Z and inhibits the fish pathogen Lactococcus garvieae. Arch. Microbiol. 2015, 197, 449–458. [Google Scholar] [CrossRef] [PubMed]
- Miura, K.; Ohnishi, H. Role of gut microbiota and toll-like receptors in nonalcoholic fatty liver disease. World J. Gastroenterol. 2014, 20, 7381–7391. [Google Scholar] [CrossRef] [PubMed]
Ingredients | R | CT | SBP |
---|---|---|---|
Fishmeal a | 32.00 | 22.00 | 22.00 |
Soybean meal a | 10.00 | 24.00 | 24.00 |
Rapeseed meal a | 10.00 | 10.00 | 10.00 |
Peanut meal a | 10.00 | 10.00 | 10.00 |
Blood meal a | 6.00 | 6.00 | 6.00 |
α-starch b | 23.20 | 18.70 | 18.575 |
Fish oil a | 2.00 | 2.25 | 2.25 |
Soybean oil a | 2.00 | 2.25 | 2.25 |
Monocalcium phosphate a | 2.00 | 2.00 | 2.00 |
Choline chloride c | 0.30 | 0.30 | 0.30 |
Vitamin and mineral premix c | 1.00 | 1.00 | 1.00 |
Bentonite c | 1.00 | 1.00 | 1.00 |
Salt | 0.50 | 0.50 | 0.50 |
Soybean bioactive peptides d | 0.00 | 0.00 | 0.125 |
Proximate Composition | |||
Dry matter | 91.53 | 92.32 | 92.43 |
Crude protein | 39.75 | 39.84 | 39.91 |
Crude lipid | 7.65 | 7.82 | 7.93 |
Ash | 9.94 | 9.81 | 9.78 |
Fiber | 2.65 | 3.30 | 3.31 |
Gross energy (MJ/kg) | 18.50 | 18.70 | 18.75 |
Components (g/L) | Soybean-Derived Bioactive Peptides |
---|---|
Crude protein, ≥ | 40.0 |
Crude fiber, ≥ | 10.0 |
Crude lipid, ≥ | 15 |
Acid soluble protein (% of total protein), ≥ | 30 |
Stachyose, ≤ | 0.5 |
Raffinose, ≤ | 0.5 |
pH | 3.5–4.5 |
Gene | Primer Sequence (5′→3′) | Accession Number /Reference |
---|---|---|
β-actin | F: GTGCCCATCTACGAGGGTTA | [29] |
R: CGTCAGGGAGCTCGTAAGAC | ||
fas | F: CGGTCAGACAAACTACGGCT | [10] |
R: CACTGAATAGCCACCCCAGG | ||
acc | F: CAAGGTCCACTACATGGTCT | [29] |
R: ACTCTTCCCAAACTCTCTCC | ||
cpt1 | F: AATTTTTGACTGGCTTCTCC | [29] |
R: TCCATTCTGGAAATCATCTG | ||
sr-b I | F: TTATCCCTGGTGTGAATGTG | KP658863 |
R: GAACTCTTCCCATTCCAACT | ||
hsl | F: GAAGGCCAGCGCTAATTTCG | MK633965.1 |
R: TCGAACCACCCATGAGAAGC | [30] | |
scd | F: ATAATGTTTGCCCTGCTACA | KU922943.1 |
R: ATGTCATTCTGGAAGGCAAT | [29] | |
sod | F: AGTTTCAGCCGTCTGTTCG | [31] |
R: CACAGTGCTTACATCACCCTTA | ||
gpx | F: CCTGGCTTTCCCCTGTAACC | [31] |
R: ACCGAGTCATCCGAAGGCA | ||
cat | F: GAACTGGGATTTGGTTGGCA | [31] |
R: GGTCCGAGAAAAGGATGGTG | ||
tlr | F: CGACCTCCACGACAACAAGA | [32] |
R: AAAGTTCCTGCACCAATGCG | ||
dorsal | F: TACGACCAACGGACAAGAGC | [33] |
R: CGCATTGTTGCTGTTTCCCA | ||
imd | F: GGCACCAAGCCTTCTTTTCAG | [34] |
R: ATATCCTTCGGGTCGCATTTC | ||
relish | F: TGCCAGACAGCCTTAAACGAT | [33] |
R: CTTGGAGGGTGGGTCATTGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, C.; Liu, B.; Pan, L.; Xia, D.; Sun, C.; Zheng, X.; Chen, P.; Hu, H.; Zhou, Q. Impact of Soybean Bioactive Peptides on Growth, Lipid Metabolism, Antioxidant Ability, Molecular Responses, and Gut Microbiota of Oriental River Prawn (Macrobrachium nipponense) Fed with a Low-Fishmeal Diet. Biology 2025, 14, 11. https://doi.org/10.3390/biology14010011
Yang C, Liu B, Pan L, Xia D, Sun C, Zheng X, Chen P, Hu H, Zhou Q. Impact of Soybean Bioactive Peptides on Growth, Lipid Metabolism, Antioxidant Ability, Molecular Responses, and Gut Microbiota of Oriental River Prawn (Macrobrachium nipponense) Fed with a Low-Fishmeal Diet. Biology. 2025; 14(1):11. https://doi.org/10.3390/biology14010011
Chicago/Turabian StyleYang, Chang, Bo Liu, Liangkun Pan, Dong Xia, Cunxin Sun, Xiaochuan Zheng, Peng Chen, He Hu, and Qunlan Zhou. 2025. "Impact of Soybean Bioactive Peptides on Growth, Lipid Metabolism, Antioxidant Ability, Molecular Responses, and Gut Microbiota of Oriental River Prawn (Macrobrachium nipponense) Fed with a Low-Fishmeal Diet" Biology 14, no. 1: 11. https://doi.org/10.3390/biology14010011
APA StyleYang, C., Liu, B., Pan, L., Xia, D., Sun, C., Zheng, X., Chen, P., Hu, H., & Zhou, Q. (2025). Impact of Soybean Bioactive Peptides on Growth, Lipid Metabolism, Antioxidant Ability, Molecular Responses, and Gut Microbiota of Oriental River Prawn (Macrobrachium nipponense) Fed with a Low-Fishmeal Diet. Biology, 14(1), 11. https://doi.org/10.3390/biology14010011