Myosin Heavy-Chain Messenger Ribonucleic Acid (mRNA) Expression and Fibre Cross-Sectional Area in Masseter, Digastric, Gastrocnemius and Soleus Muscles of Young and Adult Rats
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Approval
2.2. Subjects
2.3. Methods
2.3.1. RNA Analysis
2.3.2. Immunofluorescence Analysis
2.3.3. Morphometric Analysis
2.3.4. Statistical Analysis
3. Results
3.1. Body Weight
3.2. RNA Analysis
3.2.1. Masseter Muscle
3.2.2. Digastric Muscle
3.2.3. Gastrocnemius/Soleus Muscles
3.3. Morphometric Analysis
4. Discussion
5. Conclusions
- There is a difference in the functional profile between the masticatory and the limb muscles.
- For the masseter and digastric muscles, there is an increase in Myh4 (MyHC-IIb) expression between young and adult rats, and this change is more intense for the masseter muscles. Both the masseter and the digastric muscles also present an increase in Myh1 (MyHC-IIx) expression from young to adult rats, similarly to the limb muscles.
- For the masticatory muscles, the fibre cross-sectional area is generally smaller in the young rats compared to the adult rats; however, this difference is less pronounced than in the limb muscles.
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kiliaridis, S. Masticatory muscle influence on craniofacial growth. Acta Odontol. Scand. 1995, 53, 196–202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pepicelli, A.; Woods, M.; Briggs, C. The mandibular muscles and their importance in orthodontics: A contemporary review. Am. J. Orthod. Dentofac. Orthop. 2005, 128, 774–780. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Odman, A.M.; Hunt, N.P.; Matloub Moawad, H.A.; Sinanan, A.C.M.; Kiliaridis, S.; Lewis, M.P. Molecular changes in detrained & retrained adult jaw muscle. Eur. J. Orthod. 2013, 35, 659–663. [Google Scholar] [PubMed]
- Kiliaridis, S.; Engström, C.; Thilander, B. Histochemical analysis of masticatory muscle in the growing rat after prolonged alteration in the consistency of the diet. Arch. Oral Biol. 1988, 33, 187–193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goldspink, D.F. The influence of activity on muscle size and protein turnover. J. Physiol. 1977, 264, 283–296. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ţarcă, E.; Cojocaru, E.; Luca, A.C.; Trandafir, L.M.; Roşu, S.T.; Munteanu, V.; Țarcă, V.; Budacu, C.C.; Costea, C.F. Unusual case of masseter muscle hypertrophy in adolescence—Case report and literature overview. Diagnostics 2022, 12, 505. [Google Scholar] [CrossRef] [Scilit]
- Rowe, R.W.; Goldspink, G. Muscle fibre growth in five different muscles in both sexes of mice. J. Anat. 1969, 104, 519–530. [Google Scholar]
- Grünheid, T.; Langenbach, G.E.; Korfage, J.A.; Zentner, A.; van Eijden, T.M. The adaptive response of jaw muscles to varying functional demands. Eur. J. Orthod. 2009, 31, 596–612. [Google Scholar] [CrossRef] [Scilit]
- Lewis, M.; Hunt, N.; Shah, R. Masticatory Muscle Structure and Function. In Craniofacial Muscles; McLoon, L., Andrade, F., Eds.; Springer: New York, NY, USA, 2012. [Google Scholar]
- Buschang, P.H.; Baume, R.M. A craniofacial growth maturity gradient for males and females between 4 and 16 years of age. Am. J. Phys. Anthropol. 1983, 61, 373–381. [Google Scholar] [CrossRef] [Scilit]
- Abed, G.S.; Buschang, P.H.; Taylor, R.; Hinton, R.J. Maturation and functional related differences in rat craniofacial growth. Arch. Oral Biol. 2007, 52, 1018–1025. [Google Scholar] [CrossRef] [Scilit]
- Percie du Sert, N.; Ahluwalia, A.; Alam, S.; Avey, M.T.; Baker, M.; Browne, W.J.; Clark, A.; Cuthill, I.C.; Dirnagl, U.; Emerson, M.; et al. Reporting animal research: Explanation and elaboration of the ARRIVE guidelines 2.0. PLoS Biol. 2020, 18, e3000411. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sano, R.; Tanaka, E.; Korfage, J.A.; Langenbach, G.E.; Kawai, N.; van Eijden, T.M.; Tanne, K. Heterogeneity of fibre characteristics in the rat masseter and digastric muscles. J. Anat. 2007, 211, 464–470. [Google Scholar]
- Meng, H.; Janssen, P.M.; Grange, R.W.; Yang, L.; Beggs, A.H.; Swanson, L.C.; Cossette, S.A.; Frase, A.; Childers, M.K.; Granzier, H.; et al. Tissue triage and freezing for models of skeletal muscle disease. J. Vis. Exp. 2014, 15, 51586. [Google Scholar]
- Sardone, V.; Ellis, M.; Torelli, S.; Feng, L.; Chambers, D.; Eastwood, D.; Sewry, C.; Phadke, R.; Morgan, J.E.; Muntoni, F. A novel high-throughput immunofluorescence analysis method for quantifying dystrophin intensity in entire transverse sections of Duchenne muscular dystrophy muscle biopsy samples. PLoS ONE 2018, 13, e0194540. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sawano, S.; Komiya, Y.; Ichitsubo, R.; Ohkawa, Y.; Nakamura, M.; Tatsumi, R.; Ikeuchi, Y.; Mizunoya, W. A One-Step Immunostaining Method to Visualize Rodent Muscle Fibre Type within a Single Specimen. PLoS ONE 2016, 11, e0166080. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bloemberg, D.; Quadrilatero, J. Rapid determination of myosin heavy chain expression in rat, mouse, and human skeletal muscle using multicolor immunofluorescence analysis. PLoS ONE 2012, 7, e35273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Larson, L.; Lioy, J.; Johnson, J.; Medler, S. Transitional Hybrid Skeletal Muscle Fibres in Rat Soleus Development. J. Histochem. Cytochem. 2019, 67, 891–900. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kawai, N.; Sano, R.; Korfage, J.A.; Nakamura, S.; Tanaka, E.; van Wessel, T.; Langenbach, G.E.; Tanne, K. Functional characteristics of the rat jaw muscles: Daily muscle activity and fibre type composition. J. Anat. 2009, 215, 656–662. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gojo, K.; Abe, S.; Ide, Y. Characteristics of myofibres in the masseter muscle of mice during postnatal growth period. Anat. Histol. Embryol. 2002, 31, 105–112. [Google Scholar] [CrossRef] [Scilit]
- Suzuki, K.; Abe, S.; Kim, H.J.; Usami, A.; Iwanuma, O.; Okubo, H.; Ide, Y. Changes in the muscle fibre properties of the mouse temporal muscle after weaning. Anat. Histol. Embryol. 2007, 36, 103–106. [Google Scholar] [CrossRef] [Scilit]
- Tang, H.; Yonemitsu, I.; Ikeda, Y.; Watakabe, K.; Shibata, S.; Hosomichi, J.; Ono, T. Effects of unilateral nasal obstruction on the characteristics of jaw-closing muscles in growing rats. Angle Orthod. 2019, 89, 102–110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gelhaye, M.; Martrette, J.M.; Legrand-Frossi, C.; Trabalon, M. Myosin heavy chain expression and muscle adaptation to chronic oral breathing in rat. Respir. Physiol. Neurobiol. 2006, 154, 443–452. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Denes, B.J.; Lagou, A.; Dorotheou, D.; Kiliaridis, S. A longitudinal study on timing and velocity of rat molar eruption: Timing of rat molar eruption. Lab. Anim. 2018, 52, 394–401. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Konishi, M.; Iwamoto, S.; Ohara, H.; Shimada, M. Two-dimensional changes of muscle fiber types in growing rat hind limb. Kaibogaku Zasshi. 2000, 75, 267–273. [Google Scholar] [PubMed]
- Widmer, C.G.; English, A.W.; Morris-Wiman, J. Developmental and functional considerations of masseter muscle partitioning. Arch. Oral Biol. 2007, 52, 305–308. [Google Scholar] [CrossRef] [Scilit]
- Kaneko, S.; Iida, R.H.; Suga, T.; Morito, M.; Yamane, A. Age-related changes in rat genioglossus, geniohyoid and masseter muscles. Gerdontology 2014, 31, 56–62. [Google Scholar] [CrossRef] [Scilit]
- Norton, M.; Verstegeden, A.; Maxwell, L.C.; McCarter, R.M. Constancy of masseter muscle structure and function with age in F344 rats. Arch. Oral Biol. 2001, 46, 139–146. [Google Scholar] [CrossRef] [Scilit]
- Kiliaridis, S.; Mejersjö, C.; Thilander, B. Muscle function and craniofacial morphology: A clinical study in patients with myotonic dystrophy. Eur. J. Orthod. 1989, 11, 131–138. [Google Scholar] [CrossRef] [Scilit]
- Gedrange, T.; Büttner, C.; Schneider, M.; Lauer, G.; Mai, R.; Oppitz, R.; Harzer, W. Change of mRNA amount of myosin heavy chain in masseter muscle after orthognathic surgery of patients with malocclusion. J. Craniomaxillofac. Surg. 2006, 34 (Suppl. S2), 110–115. [Google Scholar] [CrossRef] [Scilit]
- Harzer, W.; Worm, M.; Gedrange, T.; Schneider, M.; Wolf, P. Myosin heavy chain mRNA isoforms in masseter muscle before and after orthognathic surgery. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 2007, 104, 486–490. [Google Scholar] [CrossRef] [Scilit]
- Rowlerson, A.; Raoul, G.; Daniel, Y.; Close, J.; Maurage, C.A.; Ferri, J.; Sciote, J.J. Fiber-type differences in masseter muscle associated with different facial morphologies. Am. J. Orthod. Dentofac. Orthop. 2005, 127, 37–46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anehosur, V.; Mehra, A.; Kumar, N. Management of masseter muscle hypertrophy and role of adjunctive surgical procedures. Craniomaxillofac. Trauma Reconstr. Open 2020, 5, 2472751220913147. [Google Scholar] [CrossRef] [Scilit]


| Gene Symbol (Organism) | Official Name | Sequences |
|---|---|---|
| RPLPO (Rat) | Ribosomal Protein Large, PO | Forward CCTTCTCCTTCGGGCTGATC Reverse GGGCTGTAGATGCTGCCATT |
| Myh1 (Rat) | Rattus norvegicus myosin heavy chain 1 | Forward AAGTTCCGCAAGATCCAGCA Reverse TGGATCGATCACTCTTCGCT |
| Myh2 (Rat) | Rattus norvegicus myosin heavy chain 2 | Forward CCAATGAAACCAAGACACCTG Reverse ATCTCTGCTTGAAGTCTGCG |
| Myh4 (Rat) | Rattus norvegicus myosin heavy chain 4 | Forward CGGGTTGAAGACTCTGGCTT Reverse GCTGACACGGTCTGGAAAGA |
| Myh7 (Rat) | Rattus norvegicus myosin heavy chain 7 | Forward AGAGGAGAGGGCGGACATTG Reverse GGCATCCTTAGGGTTGGGTAG |
| Overview of Immunofluorescence MHC Staining Protocol | Time |
|---|---|
| Cut O.C.T.-embedded muscle into 10 µm cross-sections and store at −80 °C | |
| Air dry sections (entire procedure performed at room temperature) | 30 min |
| Block with 2% BSA in PBS | 60 min |
| Apply 1° antibody | 60 min (IIa, IIx); Overnight (IIb, I) |
| PBS wash | 3 × 5 min |
| Apply 2° antibody | 60 min |
| PBS wash | 3 × 5 min |
| Mount coverslips with DAKO vectashield H-1000 |
| Fibres | Primary Antibody and Concentrations | Incubation Time | Secondary Antibody and Concentration (Dilution) |
|---|---|---|---|
| Fibre Type I | BA-D5 | overnight | Goat anti-mouse IgG2b, Alexa Fluor 488 (1:500) |
| Fibre Type IIa | SC-71 (1:100) | 1 h | Goat anti-mouse IgG1, Alexa Fluor 488 (1:500) |
| Fibre Type IIb | BF-F3 (1:100) | overnight | Goat anti-mouse IgM, Alexa Fluor 555 (1:500) |
| Fibre Type IIx | 6H1 (1:10) | 1 h | Goat anti-mouse IgM Alexa Fluor 555 (1:500) |
| Laminin | Anti-Laminin | 1 h | Goat anti-rabbit IgG, Alexa Fluor 488 or Goat anti-rabbit IgG, Alexa Fluor 555 (1:500) |
| Masseter | Digastric | Gastrocnemius/Soleus | ||||
|---|---|---|---|---|---|---|
| Young | Mean | SD | Mean | SD | Mean | SD |
| I | - | - | 541 | 40 | 707 ** | 71 |
| IIA | 573 ** | 48 | 549 *** | 41 | 735 *** | 132 |
| IIB | - | - | 740 *** | 177 | 1275 *** | 302 |
| IIX | - | - | 557 *** | 48 | 833 *** | 161 |
| Adult | mean | SD | mean | SD | mean | SD |
| I | 722 | 300 | 634 | 89 | 2318 ** | 759 |
| IIA | 1086 ** | 352 | 818 *** | 99 | 2079 *** | 841 |
| IIB | 1596 | 771 | 2114 *** | 363 | 4212 *** | 906 |
| IIX | 1373 | 248 | 1375 *** | 333 | 3096 *** | 632 |
| Young | ANOVA Prob > F | ANOVA Post-Hoc p-Values | ||
|---|---|---|---|---|
| Masseter- Digastric | Masseter- Gastrocnemius/Soleus | Digastric- Gastrocnemius/Soleus | ||
| I | 0.027 | 0.027 | ||
| IIA | <0.001 | 0.808 | 0.001 ** | <0.001 *** |
| IIB | <0.001 | <0.001 *** | ||
| IIX | <0.001 | <0.001 *** | ||
| Adult | ||||
| I | <0.001 | 0.980 | 0.015 | <0.001 *** |
| IIA | 0.002 | 0.661 | 0.012 | 0.002 ** |
| IIB | <0.001 | 0.441 | <0.001 *** | <0.001 *** |
| IIX | <0.001 | 1.000 | <0.001 *** | <0.001 *** |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lagou, A.; Schaub, L.; Ait-Lounis, A.; Denes, B.J.; Kiliaridis, S.; Antonarakis, G.S. Myosin Heavy-Chain Messenger Ribonucleic Acid (mRNA) Expression and Fibre Cross-Sectional Area in Masseter, Digastric, Gastrocnemius and Soleus Muscles of Young and Adult Rats. Biology 2023, 12, 842. https://doi.org/10.3390/biology12060842
Lagou A, Schaub L, Ait-Lounis A, Denes BJ, Kiliaridis S, Antonarakis GS. Myosin Heavy-Chain Messenger Ribonucleic Acid (mRNA) Expression and Fibre Cross-Sectional Area in Masseter, Digastric, Gastrocnemius and Soleus Muscles of Young and Adult Rats. Biology. 2023; 12(6):842. https://doi.org/10.3390/biology12060842
Chicago/Turabian StyleLagou, Aikaterini, Leandra Schaub, Aouatef Ait-Lounis, Balazs J. Denes, Stavros Kiliaridis, and Gregory S. Antonarakis. 2023. "Myosin Heavy-Chain Messenger Ribonucleic Acid (mRNA) Expression and Fibre Cross-Sectional Area in Masseter, Digastric, Gastrocnemius and Soleus Muscles of Young and Adult Rats" Biology 12, no. 6: 842. https://doi.org/10.3390/biology12060842
APA StyleLagou, A., Schaub, L., Ait-Lounis, A., Denes, B. J., Kiliaridis, S., & Antonarakis, G. S. (2023). Myosin Heavy-Chain Messenger Ribonucleic Acid (mRNA) Expression and Fibre Cross-Sectional Area in Masseter, Digastric, Gastrocnemius and Soleus Muscles of Young and Adult Rats. Biology, 12(6), 842. https://doi.org/10.3390/biology12060842

