The Contribution of Efflux Systems to Levofloxacin Resistance in Stenotrophomonas maltophilia Clinical Strains Isolated in Warsaw, Poland
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains
2.2. Determination of the MICs of Antibiotics with and without Efflux Pump Inhibitors
2.3. RNA Preparation and Quantitative Real-Time PCR (qPCR)
2.4. Amplification and Sequence Analysis of Efflux System Regulatory Genes
2.5. Whole Genome Sequencing (WGS)
3. Results
3.1. Effect of EPIs on the MIC Values of Antibiotics
3.2. Expression of the Efflux Pump Genes
3.3. Analysis of Efflux Systems Regulatory Genes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Al-Anazi, K.A.; Al-Jasser, A.M. Infections caused by Stenotrophomonas maltophilia in recipients of hematopoietic stem cell transplantation. Front. Oncol. 2014, 4, 232. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brooke, J.S. Stenotrophomonas maltophilia: An emerging global opportunistic pathogen. Clin. Microbiol. Rev. 2012, 25, 2–41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jones, B.M.; Wagner, J.L.; Chastain, D.B.; Bookstaver, P.B.; Stover, K.; Lin, J.; Matson, H.; White, N.; Motesh, M.; Bland, C.M. Real-world, multicentre evaluation of the incidence and risk factors for non-susceptible Stenotrophomonas maltophilia isolates. J. Glob. Antimicrob. Resist. 2022, 28, 282–287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, Y.T.; Lin, C.Y.; Chen, Y.H.; Hsueh, P.R. Update of infections caused by Stenotrophomonas maltophilia with particular attention to resistance mechanisms and therapeutic options. Front. Microbiol. 2015, 6, 893. [Google Scholar] [CrossRef] [Scilit]
- Andelković, M.V.; Janković, S.M.; Kostić, M.J.; Živković Zarić, R.S.; Opančina, V.D.; Živić, M.Ž.; Milosavljević, M.J.; Pejčić, A.V. Antimicrobial treatment of Stenotrophomonas maltophilia invasive infections: Systematic review. J. Chemother. 2019, 31, 297–306. [Google Scholar]
- Brooke, J.S. New strategies against Stenotrophomonas maltophilia: A serious worldwide intrinsically drug-resistant opportunistic pathogen. Expert Rev. Anti. Infect. Ther. 2014, 12, 1–4. [Google Scholar] [CrossRef] [Scilit]
- Juhász, E.; Pongrácz, J.; Iván, M.; Kristóf, K. Antibiotic susceptibility of sulfamethoxazole-trimethoprim resistant Stenotrophomonas maltophilia strains isolated at a tertiary care centre in Hungary. Acta Microbiol. Immunol. Hung. 2015, 62, 295–305. [Google Scholar] [CrossRef] [Scilit]
- Al-Jasser, A.M. Stenotrophomonas maltophilia resistant to trimethoprim–sulfamethoxazole: An increasing problem. Ann. Clin. Microbiol. Antimicrob. 2006, 5, 23. [Google Scholar] [CrossRef] [Scilit]
- Gajdacs, M.; Urban, E. Epidemiological trends and resistance associated with Stenotrophomonas maltophilia bacteraemia: A 10-year retrospective cohort study in a tertiary-care hospital in Hungary. Diseases 2019, 7, 41. [Google Scholar] [CrossRef] [Scilit]
- Ko, J.H.; Kang, C.I.; Cornejo-Juárez, P.; Yeh, K.M.; Wang, C.H.; Cho, S.Y.; Gözel, M.G.; Kim, S.H.; Hsueh, P.R.; Sekiya, N.; et al. Fluoroquinolones versus trimethoprim-sulfamethoxazole for the treatment of Stenotrophomonas maltophilia infections: A systematic review and meta-analysis. Clin. Microbiol. Infect. 2019, 25, 546–554. [Google Scholar] [CrossRef] [Scilit]
- Sarzynski, S.H.; Warner, S.; Sun, J.; Matsouaka, R.; Dekker, J.P.; Babiker, A.; Li, W.; Lai, Y.L.; Danner, R.L.; Fowler, V.G., Jr.; et al. Trimethoprim-sulfamethoxazole versus levofloxacin for Stenotrophomonas maltophilia infections: A retrospective comparative effectiveness study of electronic health records from 154 US hospitals. Open Forum Infect. Dis. 2022, 9, ofab644. [Google Scholar] [CrossRef] [Scilit]
- Duan, Z.; Qin, J.; Liu, Y.; Li, C.; Ying, C. Molecular epidemiology and risk factors of Stenotrophomonas maltophilia infections in a Chinese teaching hospital. BMC Microbiol. 2020, 20, 294. [Google Scholar] [CrossRef] [Scilit]
- Zhao, J.; Liu, Y.; Liu, Y.; Wang, D.; Ni, W.; Wang, R.; Liu, Y.; Zhang, B. Frequency and genetic determinants of tigecycline resistance in clinically isolated Stenotrophomonas maltophilia in Beijing, China. Front. Microbiol. 2018, 9, 549. [Google Scholar] [CrossRef] [Scilit]
- Zając, O.M.; Tyski, S.; Laudy, A.E. Phenotypic and molecular characteristics of the MDR efflux pump gene-carrying Stenotrophomonas maltophilia strains isolated in Warsaw, Poland. Biology 2022, 11, 105. [Google Scholar] [CrossRef] [Scilit]
- Alonso, A.; Martinez, J.L. Cloning and characterization of SmeDEF, a novel multidrug efflux pump from Stenotrophomonas maltophilia. Antimicrob. Agents Chemother. 2000, 44, 3079–3086. [Google Scholar] [CrossRef] [Scilit]
- Chang, L.L.; Chen, H.F.; Chang, C.Y.; Lee, T.M.; Wu, W.J. Contribution of integrons, and SmeABC and SmeDEF efflux pumps to multidrug resistance in clinical isolates of Stenotrophomonas maltophilia. J. Antimicrob. Chemother. 2004, 53, 518–521. [Google Scholar] [CrossRef] [Scilit]
- Gould, V.C.; Okazaki, A.; Avison, M.B. Coordinate hyperproduction of SmeZ and SmeJK efflux pumps extends drug resistance in Stenotrophomonas maltophilia. Antimicrob. Agents Chemother. 2013, 57, 655–657. [Google Scholar] [CrossRef] [Scilit]
- Chen, C.H.; Huang, C.C.; Chung, T.C.; Hu, R.M.; Huang, Y.W.; Yang, T.C. Contribution of resistance-nodulation-division efflux pump operon smeU1-V-W-U2-X to multidrug resistance of Stenotrophomonas maltophilia. Antimicrob. Agents Chemother. 2011, 55, 5826–5833. [Google Scholar] [CrossRef] [Scilit]
- Lin, C.W.; Huang, Y.W.; Hu, R.M.; Yang, T.C. SmeOP-tolCsm efflux pump contributes to the multidrug resistance of Stenotrophomonas maltophilia. Antimicrob. Agents Chemother. 2014, 58, 2405–2408. [Google Scholar] [CrossRef] [Scilit]
- Li, L.H.; Zhang, M.S.; Wu, C.J.; Lin, Y.T.; Yang, T.C. Overexpression of SmeGH contributes to the acquired MDR of Stenotrophomonas maltophilia. J. Antimicrob. Chemother. 2019, 74, 2225–2229. [Google Scholar] [CrossRef] [Scilit]
- Al-Hamad, A.; Upton, M.; Burnie, J. Molecular cloning and characterization of SmrA, a novel ABC multidrug efflux pump from Stenotrophomonas maltophilia. J. Antimicrob. Chemother. 2009, 64, 731–734. [Google Scholar] [CrossRef] [Scilit]
- Lin, Y.T.; Huang, Y.W.; Liou, R.S.; Chang, Y.C.; Yang, T.C. MacABCsm, an ABC-type tripartite efflux pump of Stenotrophomonas maltophilia involved in drug resistance, oxidative and envelope stress tolerances and biofilm formation. J. Antimicrob. Chemother. 2014, 69, 3221–3226. [Google Scholar] [CrossRef] [Scilit]
- Dulyayangkul, P.; Calvopiña, K.; Kate, J.; Heesom, K.J.; Avison, M.B. Novel mechanisms of efflux-mediated levofloxacin resistance and reduced amikacin susceptibility in Stenotrophomonas maltophilia. Antimicrob. Agents Chemother. 2021, 65, e01284-e20. [Google Scholar] [CrossRef] [Scilit]
- Huang, Y.W.; Hu, R.M.; Chu, F.Y.; Lin, H.R.; Yang, T.C. Characterization of a major facilitator superfamily (MFS) tripartite efflux pump EmrCABsm from Stenotrophomonas maltophilia. J. Antimicrob. Chemother. 2013, 68, 2498–2505. [Google Scholar] [CrossRef] [Scilit]
- Hu, R.M.; Liao, S.T.; Huang, C.C.; Huang, Y.W.; Yang, T.C. An inducible fusaric acid tripartite efflux pump contributes to the fusaric acid resistance in Stenotrophomonas maltophilia. PLoS ONE 2012, 7, e51053. [Google Scholar] [CrossRef] [Scilit]
- Gil-Gil, T.; Martinez, J.L.; Blanco, P. Mechanisms of antimicrobial resistance in Stenotrophomonas maltophilia: A review of current knowledge. Expert Rev. Anti. Infect. Ther. 2020, 18, 335–347. [Google Scholar] [CrossRef] [Scilit]
- Garcia-Leon, G.; Salgado, F.; Oliveros, J.C.; Sanchez, M.B.; Martinez, J.L. Interplay between intrinsic and acquired resistance to quinolones in Stenotrophomonas maltophilia. Environ. Microbiol. 2014, 16, 1282–1296. [Google Scholar] [CrossRef] [Scilit]
- Garcia-Leon, G.; Hernandez, A.; Hernando-Amado, S.; Alavi, P.; Berg, G.; Martinez, J.L. A function of SmeDEF, the major quinolone resistance determinant of Stenotrophomonas maltophilia, is the colonization of plant roots. Appl. Environ. Microbiol. 2014, 80, 4559–4565. [Google Scholar] [CrossRef] [Scilit]
- Sanchez, P.; Alonso, A.; Martinez, J.L. Cloning and characterization of SmeT, a repressor of the Stenotrophomonas maltophilia multidrug efflux pump SmeDEF. Antimicrob. Agents Chemother. 2002, 46, 3386–3393. [Google Scholar] [CrossRef] [Scilit]
- Sanchez, M.B.; Martinez, J.L. Overexpression of the efflux pumps SmeVWX and SmeDEF is a major cause of resistance to co-trimoxazole in Stenotrophomonas maltophilia. Antimicrob. Agents Chemother. 2018, 62, e00301–e00318. [Google Scholar] [CrossRef] [Scilit]
- Li, X.Z.; Zhang, L.; Poole, K. SmeC, an outer membrane multidrug efflux protein of Stenotrophomonas maltophilia. Antimicrob. Agents Chemother. 2002, 46, 333–343. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Blanco, P.; Corona, F.; Martinez, J.L. Mechanisms and phenotypic consequences of acquisition of tigecycline resistance by Stenotrophomonas maltophilia. J. Antimicrob. Chemother. 2019, 74, 3221–3230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, Y.-W.; Liou, R.-S.; Lin, Y.-T.; Huang, H.-H.; Yang, T.-C. A linkage between SmeIJK efflux pump, cell envelope integrity, and σE-mediated envelope stress response in Stenotrophomonas maltophilia. PLoS ONE 2014, 9, e111784. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sanchez, M.B.; Martinez, J.L. SmQnr contributes to intrinsic resistance to quinolones in Stenotrophomonas maltophilia. Antimicrob. Agents Chemother. 2010, 54, 580–581. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, C.J.; Lu, H.F.; Lin, Y.T.; Zhang, M.S.; Li, L.H.; Yang, T.C. Substantial contribution of SmeDEF, SmeVWX, SmQnr and heat shock response to fluoroquinolone resistance in clinical isolates of Stenotrophomonas maltophilia. Front. Microbiol. 2019, 10, 822. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garcia-Leon, G.; Ruiz de Alegria Puig, C.; Garcia de la Fuente, C.; Martinez-Martinez, L.; Martinez, J.L.; Sanchez, M.B. High-level quinolone resistance is associated with the overexpression of smeVWX in Stenotrophomonas maltophilia clinical isolates. Clin. Microbiol. Infect. 2015, 21, 464–467. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clinical and Laboratory Standards Institute (CLSI). Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically, Approved Standard, Document M07-A9, 9th ed.; Clinical and Laboratory Standards Institute CLSI: Wayne, PA, USA, 2012. [Google Scholar]
- Liofilchem Inc. Liofilchem MTS—MIC Test Strip Guide. 2020. Available online: https://www.liofilchem.com/solutions/clinical/arm/mts-mic-test-strip.html (accessed on 18 September 2021).
- Clinical and Laboratory Standards Institute (CLSI). M100: Performance Standards for Antimicrobial Susceptibility Testing, 32nd ed.; CLSI: Wayne, PA, USA, 2022. [Google Scholar]
- Laudy, A.E.; Kulińska, E.; Tyski, S. The impact of efflux pump inhibitors on the activity of selected non-antibiotic medicinal products against Gram-negative bacteria. Molecules 2017, 22, 114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bernardini, A.; Corona, F.; Dias, R.; Sanchez, M.B.; Martinez, J.L. The inactivation of RNase G reduces the Stenotrophomonas maltophilia susceptibility to quinolones by triggering the heat shock response. Front Microbiol. 2015, 6, 1068. [Google Scholar] [CrossRef] [Scilit]
- Valdezate, S.; Vindel, A.; Echeita, A.; Baquero, F.; Canton, R. Topoisomeraze II and IV quinolone resistance-determining regions in Stenotrophomonas maltophilia clinical isolates with different levels of quinolone susceptibility. Antimicrob. Agents Chemother. 2002, 44, 665–671. [Google Scholar] [CrossRef] [Scilit]
- Rhee, J.Y.; Choi, J.Y.; Soo Ko, K. Efflux pump inhibitor carbonyl cyanide-m-chlorophenylhydrazone (CCCP) enhances bacteriostatic activity of trimethoprim-sulfamethoxazole against clinical Stenotrophomonas maltophilia isolates from Korea. J. Bacteriol. Virol. 2016, 46, 185–192. [Google Scholar] [CrossRef] [Scilit]
- Jia, W.; Wang, J.; Xu, H.; Li, G. Resistance of Stenotrophomonas maltophilia to fluoroquinolones: Prevalence in a university hospital and possible mechanisms. Int. J. Environ. Res. Public Health 2015, 12, 5177–5195. [Google Scholar] [CrossRef] [Scilit]
- Lamers, R.P.; Cavallari, J.F.; Burrows, L.L. The efflux inhibitor phenylalanine-arginine beta-naphthylamide (PAβN) permeabilizes the outer membrane of gram-negative bacteria. PLoS ONE 2013, 8, e60666. [Google Scholar] [CrossRef] [Scilit]
- Laudy, A.E. Non-antibiotics, efflux pumps and drug resistance of Gram-negative rods. Pol. J. Microbiol. 2018, 67, 129–135. [Google Scholar] [CrossRef] [Scilit]
- Osei Sekyere, J.; Amoako, D.G. Carbonyl cyanide m-chlorophenylhydrazine (CCCP) reverses resistance to colistin, but not to carbapenems and tigecycline in multidrug-resistant Enterobacteriaceae. Front. Microbiol. 2017, 8, 228. [Google Scholar] [CrossRef] [Scilit]
- Sanchez, P.; Alonso, A.; Martinez, J.L. Regulatory regions of smeDEF in Stenotrophomonas maltophilia strains expressing different amounts of the multidrug efflux pump SmeDEF. Antimicrob. Agents Chemother. 2004, 48, 2274–2276. [Google Scholar] [CrossRef] [Scilit]
- Sporer, A.J.; Beierschmitt, C.; Bendebury, A.; Zink, K.E.; Price-Whelan, A.; Buzzeo, M.C.; Sanchez, L.M.; Dietrich, L.E.P. Pseudomonas aeruginosa PumA acts on an endogenous phenazine to promote self-resistance. Microbiology 2018, 164, 790–800. [Google Scholar] [CrossRef] [Scilit]
- Wu, C.J.; Huang, Y.W.; Lin, Y.T.; Ning, H.C.; Yang, T.C. Inactivation of SmeSyRy two-component regulatory system inversely regulates the expression of SmeYZ and SmeDEF efflux pumps in Stenotrophomonas maltophilia. PLoS ONE 2016, 11, e0160943. [Google Scholar] [CrossRef] [Scilit]
- Yero, D.; Huedo, P.; Conchillo-Solé, O.; Martínez-Servat, S.; Mamat, U.; Coves, X.; Llanas, F.; Roca, I.; Vila, J.; Schaible, U.E.; et al. Genetic variants of the DSF quorum sensing system in Stenotrophomonas maltophilia influence virulence and resistance phenotypes among genotypically diverse clinical isolates. Front. Microbiol. 2020, 11, 1160. [Google Scholar] [CrossRef] [Scilit]


| Efflux System | Target Gene | Primer | Sequence (5’-3’) | Product Length (bp) | References | Purpose |
|---|---|---|---|---|---|---|
| SmeABC | smeA | A-F | AAGGCCATCGATGGCAAGGC | 146 | Zając et al. [14] | qPCR |
| A-R | TCCGGGTTCGGAATGACCG | |||||
| SmeDEF | smeD | RT-D-F | CGGTCAGCATCCTGATGGA | 73 | Garcia-Leon et al. [28] | qPCR |
| RT-D-R | ACGCTGACTTCGGAGAACTC | |||||
| SmeIJK | smeI | I-F | TTCCGCGAAGGCCAGGAAGT | 107 | Zając et al. [14] | qPCR |
| I-R | TCGTTCTGGCGCTTGGCTG | |||||
| SmeVWX | smeV | V-F | ATGGCACGCAAGGGCGAG | 118 | This study | qPCR |
| V-R | CCTGGTTGTCGAGGAAGTCG | |||||
| SmeGH | smeG | G-F | AAGAACGTGAAGACCGATGGC | 107 | Garcia-Leon et al. [28] modified | qPCR |
| G-R | CCTTCCTTGACCTTCTGCAC | Garcia-Leon et al. [28] | ||||
| Not applicable | gyrA | gyrA-F | CAAGTCGGCG CGTATCGTC | 82 | This study | qPCR-internal control |
| gyrA-R | GCGCACCAGC GTGTCGTA | |||||
| Not applicable | rpoD | rpoD-F | GCCGTACTGCTGGAGCAT | 67 | Bernardini et al. [41] modified | qPCR-internal control |
| rpoD-R | GGTGCACATGATCGAAACGA | Bernardini et al. [41] | ||||
| Not applicable | 16S rDNA | 16S-F | GACCTTGCGCGATTGAATG | 75 | Zhao et al. [13] | qPCR-internal control |
| 16S-R | CGGATCGTCGCCTTGGT | |||||
| Regulatory gene of SmeDEF | smeT | smeT-F1 | CCAGGATCACGGGGCTGTC | 814 | This study | PCR |
| smeT-R1 | TGCCACGCACACGACGGGAA | |||||
| smeT-F2 | ATGGCCCGCAAGACCAAAGAG | 660 | DNA sequencing | |||
| smeT-R2 | TCACGCTTCGGGCAGCGG | |||||
| Regulatory gene of SmeVWX | smeRv | smeRv-F1 | CCCCGACGTCCAGGATCC | 1121 | Gracia-Leon et al. [27] | PCR |
| smeRv-R1 | GCTCGACTCTACAGAAGC |
| No | Isolate | MIC (mg/L) | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| LVX | LVX + CCCP | LVX + RES | LVX+ PAβN | PMB | PMB + CCCP | GEN | GEN + CCCP | GEN + RES | GEN+ PAβN | ||
| 1 | 3/2010 | 4 | 4 | 4 | 4 | 1 | 1 | >256 | 128 | 256 | >256 |
| 2 | 8/2010 | 4 | 1 | 2 | 2 | 3 | 1 | >256 | >256 | >256 | >256 |
| 3 | 9/2010 | 16 | 8 | 8 | 4 | 2 | 1 | >256 | >256 | >256 | >256 |
| 4 | 10/2010 | 4 | 1 | 2 | 2 | 3 | 1 | >256 | >256 | >256 | >256 |
| 5 | 12/2010 | 2 | 2 | 1 | 2 | 1 | 0.5 | 256 | 32 | 256 | 256 |
| 6 | 15/2010 * | 2 | 0.5 | 1 | 2 | 1 | 0.75 | >256 | 16 | >256 | 128 |
| 7 | 16/2010 | 2 | 2 | 1 | 2 | 1 | 0.5 | 256 | 32 | 256 | 256 |
| 8 | 17/2010 | 2 | 2 | 1 | 2 | 1 | 0.5 | 256 | 32 | 256 | 256 |
| 9 | 20/2011 * | 4 | 1 | 1 | 1 | 1 | 1 | 128 | 64 | 128 | 128 |
| 10 | 22/2011 | 1 | 0.5 | 0.5 | 0.5 | 16 | 3 | >256 | 128 | 256 | 256 |
| 11 | 24/2011 | 2 | 2 | 1 | 2 | 1 | 0.5 | 256 | 32 | 256 | 256 |
| 12 | 26/2011 | 2 | 2 | 1 | 2 | 1 | 0.5 | 256 | 32 | 256 | 256 |
| 13 | 31/2011 * | 8 | 2 | 4 | 4 | 16 | 1 | 256 | 256 | 256 | 256 |
| 14 | 32/2011 | 1 | 0.5 | 0.5 | 0.25 | 1 | 0.75 | >256 | 128 | >256 | >256 |
| 15 | 33/2011 | 4 | 1 | 4 | 4 | 0.75 | 0.5 | >256 | 64 | 256 | >256 |
| 16 | 34/2011 | 2 | 2 | 1 | 2 | 1 | 0.5 | 256 | 32 | 256 | 256 |
| 17 | 35/2011 * | 2 | 0.5 | 1 | 1 | 6 | 1 | >256 | 128 | 256 | 128 |
| 18 | 41/2011 * | 16 | 8 | 8 | 4 | 1.5 | 0.75 | >256 | >256 | >256 | >256 |
| 19 | 42/2011 | 4 | 2 | 4 | 4 | 0.5 | 0.38 | 256 | 256 | 64 | 256 |
| 20 | 44/2011 | 8 | 2 | 4 | 2 | 0.5 | 0.5 | 256 | 256 | 256 | 256 |
| 21 | 47/2011 | 8 | 2 | 4 | 2 | 0.5 | 0.5 | 256 | 256 | 256 | 256 |
| 22 | 52/2012 * | 8 | 2 | 4 | 2 | 3 | 0.5 | >256 | >256 | >256 | >256 |
| 23 | 56/2012 | 2 | 2 | 1 | 2 | 1 | 0.5 | 256 | 32 | 256 | 256 |
| 24 | 59/2012 | 2 | 2 | 1 | 2 | 1 | 0.5 | 256 | 32 | 256 | 256 |
| 25 | 61/2012 | 2 | 2 | 1 | 2 | 1 | 0.5 | 256 | 32 | 256 | 256 |
| 26 | 92/2013 | 2 | 2 | 2 | 2 | 1 | 0.38 | 256 | 64 | 256 | 256 |
| 27 | 95/2013 | 2 | 2 | 2 | 2 | 2 | 1 | >256 | 64 | >256 | 256 |
| Isolate | MIC of Levofloxacin [mg/L] (x-Fold Reduction in Levofloxacin MIC in the Presence of EPIs: CCCP, PAβN and Reserpine)/Susceptibility Interpretation | x-Fold Change ± SEM a | ||||
|---|---|---|---|---|---|---|
| smeD | smeA | smeV | smeG | smeI | ||
| 15/2010 | 2 (4, 1, 2)/S | 21.40 ± 5.03 | 0.09 ± 0.07 | 0.08 ± 0.0 | 0.01 ± 0.0 | Not applicable b |
| 20/2011 | 4 (4, 4, 4)/I | 16.25 ± 3.02 | Not applicable b | 0.35 ± 0.04 | 0.01 ± 0.0 | 0.02 ± 0.0 |
| 31/2011 | 8 (4, 2, 2)/R | 3.47 ± 0.78 | 0.03 ± 0.03 | 0.17 ± 0.04 | 2.53 ± 0.46 | 0.01 ± 0.0 |
| 35/2011 | 2 (4, 2, 2)/S | 10.75 ± 2.88 | Not applicable b | 0.0 ± 0.0 | 2.00 ± 0.14 | Not applicable b |
| 41/2011 | 16 (2, 4, 2)/R | 0.80 ± 0.11 | 0.78 ± 0.26 | 60.81 ± 10.27 | 1.55 ± 0.16 | 0.27 ± 0.03 |
| 52/2012 | 8 (4, 4, 2)/R | 15.31 ± 1.37 | 2.09 ± 0.52 | 0.45 ± 0.07 | 2.79 ± 0.50 | 0.01 ± 0.0 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zając, O.M.; Tyski, S.; Laudy, A.E. The Contribution of Efflux Systems to Levofloxacin Resistance in Stenotrophomonas maltophilia Clinical Strains Isolated in Warsaw, Poland. Biology 2022, 11, 1044. https://doi.org/10.3390/biology11071044
Zając OM, Tyski S, Laudy AE. The Contribution of Efflux Systems to Levofloxacin Resistance in Stenotrophomonas maltophilia Clinical Strains Isolated in Warsaw, Poland. Biology. 2022; 11(7):1044. https://doi.org/10.3390/biology11071044
Chicago/Turabian StyleZając, Olga M., Stefan Tyski, and Agnieszka E. Laudy. 2022. "The Contribution of Efflux Systems to Levofloxacin Resistance in Stenotrophomonas maltophilia Clinical Strains Isolated in Warsaw, Poland" Biology 11, no. 7: 1044. https://doi.org/10.3390/biology11071044
APA StyleZając, O. M., Tyski, S., & Laudy, A. E. (2022). The Contribution of Efflux Systems to Levofloxacin Resistance in Stenotrophomonas maltophilia Clinical Strains Isolated in Warsaw, Poland. Biology, 11(7), 1044. https://doi.org/10.3390/biology11071044

