Elimination of Reprogramming Transgenes Facilitates the Differentiation of Induced Pluripotent Stem Cells into Hepatocyte-like Cells and Hepatic Organoids
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. hiPSC Generation Kit and Antibodies
2.2. Cell Culture
2.3. Generation of Transgene-Free hiPSCs
2.4. Live-Staining of Cells and Alkaline Phosphatase (ALP) Assay
2.5. Western Blotting
2.6. Genomic DNA Purification and Quantitative Real-Time PCR (qPCR)
2.7. Immunocytochemistry
2.8. Karyotyping of Transgene-Free hiPSCs
2.9. Formation of Embryoid Body (EB) and In Vitro Trilineage Differentiation
2.10. Generation and Expansion of hHOs Differentiated from hiPSCs
2.11. Hepatic Differentiation from hiPSC-Derived HOs
2.12. Statistical Analysis
3. Results
3.1. Generation and Characterization of hiPSCs from Fibroblasts Using an Excisable Polycistronic Lentiviral System
3.2. Transgene-Free hiPSCs Showed Enhanced Direct Differentiation to DE and Hepatocyte-like Cells
3.3. Enhanced Generation of hHOs from Transgene-Free hiPSCs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lin, H.M.; Kauffman, H.M.; McBride, M.A.; Davies, D.B.; Rosendale, J.D.; Smith, C.M.; Edwards, E.B.; Daily, O.P.; Kirklin, J.; Shield, C.F.; et al. Center-specific graft and patient survival rates: 1997 United Network for Organ Sharing (UNOS) report. JAMA 1998, 280, 1153–1160. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Fox, I.J.; Daley, G.Q.; Goldman, S.A.; Huard, J.; Kamp, T.J.; Trucco, M. Stem cell therapy. Use of differentiated pluripotent stem cells as replacement therapy for treating disease. Science 2014, 345, 1247391. [Google Scholar] [CrossRef] [PubMed]
- Bae, S.H. Clinical application of stem cells in liver diseases. Korean J. Hepatol. 2008, 14, 309–317. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.; Kang, K.; Lee, S.B.; Seo, D.; Yoon, S.; Kim, S.J.; Jang, K.; Jung, Y.K.; Lee, K.G.; Factor, V.M.; et al. Small molecule-mediated reprogramming of human hepatocytes into bipotent progenitor cells. J. Hepatol. 2019, 70, 97–107. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.; Kim, Y.W.; Lee, S.B.; Kang, K.; Yoon, S.; Choi, D.; Park, S.H.; Jeong, J. Hepatic patch by stacking patient-specific liver progenitor cell sheets formed on multiscale electrospun fibers promotes regenerative therapy for liver injury. Biomaterials 2021, 274, 120899. [Google Scholar] [CrossRef]
- Huch, M.; Gehart, H.; van Boxtel, R.; Hamer, K.; Blokzijl, F.; Verstegen, M.M.; Ellis, E.; van Wenum, M.; Fuchs, S.A.; de Ligt, J.; et al. Long-term culture of genome-stable bipotent stem cells from adult human liver. Cell 2015, 160, 299–312. [Google Scholar] [CrossRef]
- Caiazza, C.; Parisi, S.; Caiazzo, M. Liver Organoids: Updates on Disease Modeling and Biomedical Applications. Biology 2021, 10, 835. [Google Scholar] [CrossRef]
- Ramli, M.N.B.; Lim, Y.S.; Koe, C.T.; Demircioglu, D.; Tng, W.; Gonzales, K.A.U.; Tan, C.P.; Szczerbinska, I.; Liang, H.; Soe, E.L.; et al. Human Pluripotent Stem Cell-Derived Organoids as Models of Liver Disease. Gastroenterology 2020, 159, 1471–1486.e1412. [Google Scholar] [CrossRef]
- Mun, S.J.; Ryu, J.S.; Lee, M.O.; Son, Y.S.; Oh, S.J.; Cho, H.S.; Son, M.Y.; Kim, D.S.; Kim, S.J.; Yoo, H.J.; et al. Generation of expandable human pluripotent stem cell-derived hepatocyte-like liver organoids. J. Hepatol. 2019, 71, 970–985. [Google Scholar] [CrossRef]
- Olgasi, C.; Cucci, A.; Follenzi, A. iPSC-Derived Liver Organoids: A Journey from Drug Screening, to Disease Modeling, Arriving to Regenerative Medicine. Int. J. Mol. Sci. 2020, 21, 6215. [Google Scholar] [CrossRef]
- Wang, S.; Wang, X.; Tan, Z.; Su, Y.; Liu, J.; Chang, M.; Yan, F.; Chen, J.; Chen, T.; Li, C.; et al. Human ESC-derived expandable hepatic organoids enable therapeutic liver repopulation and pathophysiological modeling of alcoholic liver injury. Cell Res. 2019, 29, 1009–1026. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, K.; Tanabe, K.; Ohnuki, M.; Narita, M.; Ichisaka, T.; Tomoda, K.; Yamanaka, S. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007, 131, 861–872. [Google Scholar] [CrossRef] [PubMed]
- Ghodsizadeh, A.; Taei, A.; Totonchi, M.; Seifinejad, A.; Gourabi, H.; Pournasr, B.; Aghdami, N.; Malekzadeh, R.; Almadani, N.; Salekdeh, G.H.; et al. Generation of liver disease-specific induced pluripotent stem cells along with efficient differentiation to functional hepatocyte-like cells. Stem Cell Rev. Rep. 2010, 6, 622–632. [Google Scholar] [CrossRef] [PubMed]
- Oh, Y. Patient-specific pluripotent stem cell-based Parkinson’s disease models showing endogenous alpha-synuclein aggregation. BMB Rep. 2019, 52, 349–359. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.B.; Seo, D.; Choi, D.; Park, K.Y.; Holczbauer, A.; Marquardt, J.U.; Conner, E.A.; Factor, V.M.; Thorgeirsson, S.S. Contribution of hepatic lineage stage-specific donor memory to the differential potential of induced mouse pluripotent stem cells. Stem Cells 2012, 30, 997–1007. [Google Scholar] [CrossRef]
- Stadtfeld, M.; Nagaya, M.; Utikal, J.; Weir, G.; Hochedlinger, K. Induced pluripotent stem cells generated without viral integration. Science 2008, 322, 945–949. [Google Scholar] [CrossRef]
- Yu, J.; Hu, K.; Smuga-Otto, K.; Tian, S.; Stewart, R.; Slukvin, I.I.; Thomson, J.A. Human induced pluripotent stem cells free of vector and transgene sequences. Science 2009, 324, 797–801. [Google Scholar] [CrossRef]
- Woltjen, K.; Michael, I.P.; Mohseni, P.; Desai, R.; Mileikovsky, M.; Hamalainen, R.; Cowling, R.; Wang, W.; Liu, P.; Gertsenstein, M.; et al. piggyBac transposition reprograms fibroblasts to induced pluripotent stem cells. Nature 2009, 458, 766–770. [Google Scholar] [CrossRef]
- Papapetrou, E.P.; Sadelain, M. Generation of transgene-free human induced pluripotent stem cells with an excisable single polycistronic vector. Nat. Protoc. 2011, 6, 1251–1273. [Google Scholar] [CrossRef]
- Zou, X.Y.; Yang, H.Y.; Yu, Z.; Tan, X.B.; Yan, X.; Huang, G.T. Establishment of transgene-free induced pluripotent stem cells reprogrammed from human stem cells of apical papilla for neural differentiation. Stem Cell Res. Ther. 2012, 3, 43. [Google Scholar] [CrossRef]
- Steichen, C.; Luce, E.; Maluenda, J.; Tosca, L.; Moreno-Gimeno, I.; Desterike, C.; Dianat, N.; Goulinet-Mainot, S.; Awan-Toor, S.; Burks, D.; et al. Messenger RNA-versus retrovirus-based induced pluripotent stem cell reprogramming strategies: Analysis of genomic integrity. Stem Cells Transl. Med. 2014, 6, 686–691. [Google Scholar] [CrossRef] [PubMed]
- Lister, R.; Pelizzola, M.; Kida, Y.S.; Hawkins, R.D.; Nery, J.R.; Hon, G.; Antosiewicz-Bourget, J.; O’Malley, R.; Castanon, R.; Klugman, S.; et al. Hotspots of aberrant epigenomic reprogramming in human induced pluripotent stem cells. Nature 2011, 471, 68–73. [Google Scholar] [CrossRef] [PubMed]
- Sommer, C.A.; Sommer, A.G.; Longmire, T.A.; Christodoulou, C.; Thomas, D.D.; Gostissa, M.; Alt, F.W.; Murphy, G.J.; Kotton, D.N.; Mostoslavsky, G. Excision of reprogramming transgenes improves the differentiation potential of iPS cells generated with a single excisable vector. Stem Cells 2010, 28, 64–74. [Google Scholar] [CrossRef] [PubMed]
- Ramos-Mejia, V.; Montes, R.; Bueno, C.; Ayllon, V.; Real, P.J.; Rodriguez, R.; Menendez, P. Residual expression of the reprogramming factors prevents differentiation of iPSC generated from human fibroblasts and cord blood CD34+ progenitors. PLoS ONE 2012, 7, e35824. [Google Scholar] [CrossRef]
- Igawa, K.; Kokubu, C.; Yusa, K.; Horie, K.; Yoshimura, Y.; Yamauchi, K.; Suemori, H.; Yokozeki, H.; Toyoda, M.; Kiyokawa, N.; et al. Removal of reprogramming transgenes improves the tissue reconstitution potential of keratinocytes generated from human induced pluripotent stem cells. Stem Cells Transl. Med. 2014, 3, 992–1001. [Google Scholar] [CrossRef]
- Jeong, J.; Kim, K.N.; Chung, M.S.; Kim, H.J. Functional comparison of human embryonic stem cells and induced pluripotent stem cells as sources of hepatocyte-like cells. Tissue Eng. Regen. Med. 2016, 13, 740–749. [Google Scholar] [CrossRef]
- Taylor, C.; Crosby, I.; Yip, V.; Maguire, P.; Pirmohamed, M.; Turner, R.M. A Review of the Important Role of CYP2D6 in Pharmacogenomics. Genes 2020, 11, 1295. [Google Scholar] [CrossRef]
- Corbett, J.L.; Duncan, S.A. iPSC-Derived Hepatocytes as a Platform for Disease Modeling and Drug Discovery. Front. Med. 2019, 6, 265. [Google Scholar] [CrossRef]
- Marti, M.; Mulero, L.; Pardo, C.; Morera, C.; Carrio, M.; Laricchia-Robbio, L.; Esteban, C.R.; Izpisua Belmonte, J.C. Characterization of pluripotent stem cells. Nat. Protoc. 2013, 8, 223–253. [Google Scholar] [CrossRef]
- Bauwens, C.L.; Peerani, R.; Niebruegge, S.; Woodhouse, K.A.; Kumacheva, E.; Husain, M.; Zandstra, P.W. Control of human embryonic stem cell colony and aggregate size heterogeneity influences differentiation trajectories. Stem Cells 2008, 9, 2300–2310. [Google Scholar] [CrossRef]
- Moo, S.H.; Ju, J.; Park, S.J.; Bae, D.; Chung, H.M.; Lee, S.H. Optimizing human embryonic stem cells differentiation efficiency by screening size-tunable homogenous embryoid bodies. Biomaterials 2014, 23, 5987–5997. [Google Scholar] [CrossRef]
- Pareja, E.; Gomez-Lechon, M.J.; Tolosa, L. Induced pluripotent stem cells for the treatment of liver diseases: Challenges and perspectives from a clinical viewpoint. Ann. Transl. Med. 2020, 8, 566. [Google Scholar] [CrossRef] [PubMed]
- Estève, J.; Blouin, J.M.; Lalanne, M.; Azzi-Martin, L.; Dubus, P.; Bidet, A.; Harambat, J.; Llanas, B.; Moranvillier, I.; Bedel, A.; et al. Generation of induced pluripotent stem cells-derived hepatocyte-like cells for ex vivo gene therapy of primary hyperoxaluria type 1. Stem Cell Res. 2019, 38, 101467. [Google Scholar] [CrossRef] [PubMed]
- Gao, X.; Li, R.; Cahan, P.; Zhao, Y.; Yourick, J.J.; Sprando, R.L. Hepatocyte-like cells derived from human induced pluripotent stem cells using small molecules: Implications of a transcriptomic study. Stem Cell Res. Ther. 2020, 11, 393. [Google Scholar] [CrossRef]
- Di Giorgio, F.P.; Carrasco, M.A.; Siao, M.C.; Maniatis, T.; Eggan, K. Non-cell autonomous effect of glia on motor neurons in an embryonic stem cell-based ALS model. Nat. Neurosci. 2007, 10, 608–614. [Google Scholar] [CrossRef]
- Major, T.; Menon, J.; Auyeung, G.; Soldner, F.; Hockemeyer, D.; Jaenisch, R.; Tabar, V. Transgene excision has no impact on in vivo integration of human iPS derived neural precursors. PLoS ONE 2011, 6, e24687. [Google Scholar] [CrossRef]
- Hu, H.; Gehart, H.; Artegiani, B.; LÖpez-Iglesias, C.; Dekkers, F.; Basak, O.; van Es, J.; Chuva de Sousa Lopes, S.M.; Begthel, H.; Korving, J.; et al. Long-Term Expansion of Functional Mouse and Human Hepatocytes as 3D Organoids. Cell 2018, 175, 1591–1606.e1519. [Google Scholar] [CrossRef]
- Jeong, J.; Kim, T.H.; Kim, M.; Jung, Y.K.; Kim, K.S.; Shim, S.; Jang, H.; Jang, W.I.; Lee, S.B.; Choi, D.; Hanyang University, Seoul, Korea. Unpublished work. 2022.





| Gene | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| OCT4 | GATGTGGTCCGAGTGTGGTT | AGCCTGGGGTACCAAAATGG |
| SOX2 | GCCCTGCAGTACAACTCCAT | GACTTGACCACCGAACCCAT |
| NANOG | TGAACCTCAGCTACAAACAG | TGGTGGTAGGAAGAGTAAAG |
| SOX17 | ACTGCAACTATCCTGACGTG | AGGAAATGGAGGAAGCTGTT |
| FOXA2 | GCAGATACCTCCTACTACCA | GAAGCAGGAGTCTACACAGT |
| CXCR4 | CTTCTACCCCAATGACTTGTGG | AATGTAGTAAGGCAGCCAACAG |
| GATA4 | CTACAGGGGCACTTAACCCA | AGAGCTGAATCGCTCAGAGC |
| ALBUMIN | CACAGAATCCTTGGRGAACAGG | ATGGAAGGTGAATGTTTCAGCA |
| AFP | AGACTGCTGCAGCCAAAGTGA | GTGGGATCGATGCTGGAGTG |
| CK19 | TCCGAACCAAGTTTGAGACG | CCCTCAGCGTACTGATTTCC |
| EPCAM | GAACAATGATGGGCTTTATG | TGAGAATTCAGGTGCTTTTT |
| CD90 | CTAGTGGACCAGAGCCTTCG | ACAGGGACATGAAATCCGTG |
| SOX9 | GAGGAAGTCGGTGAAGAACG | ATCGAAGGTCTCGATGTTGG |
| ITGA6 | TCGCTGGGATCTTGATGCTTGC | TGAGCATGGATCTCAGCCTTGTGA |
| ASGR1 | CAGCAACTTCACAGCCAGCA | AGCTGGGACTCTAGCGACTT |
| HNF4A | CCAAAACCCTCGTCGACATG | GCACATTCTCAAATTCCAGG |
| CYP1A2 | CGGACAGCACTTCCCTGAGA | AGGCAGGTAGCGAAGGATGG |
| CYP3A4 | TTCAGCAAGAAGAACAAGGACAA | GGTTGAAGAAGTCCTCCTAAGC |
| AAT | TATGATGAAGCGTTTAGGC | CAGTAATGGACAGTTTGGGT |
| GAPDH | GGACTCATGACCACAGTCCATGCC | TCAGGGATGACCTTGCCCACAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jeong, J.; Kim, T.H.; Kim, M.; Jung, Y.K.; Kim, K.S.; Shim, S.; Jang, H.; Jang, W.I.; Lee, S.B.; Choi, D. Elimination of Reprogramming Transgenes Facilitates the Differentiation of Induced Pluripotent Stem Cells into Hepatocyte-like Cells and Hepatic Organoids. Biology 2022, 11, 493. https://doi.org/10.3390/biology11040493
Jeong J, Kim TH, Kim M, Jung YK, Kim KS, Shim S, Jang H, Jang WI, Lee SB, Choi D. Elimination of Reprogramming Transgenes Facilitates the Differentiation of Induced Pluripotent Stem Cells into Hepatocyte-like Cells and Hepatic Organoids. Biology. 2022; 11(4):493. https://doi.org/10.3390/biology11040493
Chicago/Turabian StyleJeong, Jaemin, Tae Hun Kim, Myounghoi Kim, Yun Kyung Jung, Kyeong Sik Kim, Sehwan Shim, Hyosun Jang, Won Il Jang, Seung Bum Lee, and Dongho Choi. 2022. "Elimination of Reprogramming Transgenes Facilitates the Differentiation of Induced Pluripotent Stem Cells into Hepatocyte-like Cells and Hepatic Organoids" Biology 11, no. 4: 493. https://doi.org/10.3390/biology11040493
APA StyleJeong, J., Kim, T. H., Kim, M., Jung, Y. K., Kim, K. S., Shim, S., Jang, H., Jang, W. I., Lee, S. B., & Choi, D. (2022). Elimination of Reprogramming Transgenes Facilitates the Differentiation of Induced Pluripotent Stem Cells into Hepatocyte-like Cells and Hepatic Organoids. Biology, 11(4), 493. https://doi.org/10.3390/biology11040493

