Field-Deployable Recombinase Polymerase Amplification Assay for Specific, Sensitive and Rapid Detection of the US Select Agent and Toxigenic Bacterium, Rathayibacter toxicus
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Source of Cultures, Infected Plant Samples, and DNA Isolation
2.2. Gene Selection and RPA Primer and Probe Design
2.3. RPA, Endpoint PCR, and Artificial Positive Control
2.4. RPA and Endpoint PCR Specificity and Sensitivity Assays
2.5. Hand-Held RPA Amplification
2.6. In-Field Performance
2.7. Comparative Plant Inhibitory Effect
3. Results
3.1. Primer and Probe Design and in Silico Specificity
3.2. Specificity Assays
3.3. Sensitivity Assays
3.4. Plant Inhibitory Effect
3.5. On-Site Detection of R. toxicus
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- McKay, A.C.; Ophel, K.M. Toxigenic Clavibacter/Anguina associations infecting grass seedheads. Annu. Rev. Phytopathol. 1993, 31, 151–167. [Google Scholar] [CrossRef] [PubMed]
- McKay, A.C.; Ophel, K.M.; Reardon, T.B.; Gooden, J.M. Livestock deaths associated with Clavibacter toxicus/Auguina sp. infection in seedheads of Agrostis auenacea and Polypogon monspeliensis. Plant Dis. 1993, 77, 635–641. [Google Scholar] [CrossRef] [Scilit]
- Riley, I.T.; Ophel, K.M. Clavibacter toxicus sp. nov., the bacterium responsible for annual ryegrass toxicity in Australia. Int. J. Syst. Bacteriol. 1992, 42, 64–68. [Google Scholar] [CrossRef] [Scilit]
- Edgar, J.A.; Frahn, J.L.; Cockrum, P.A.; Anderton, N.; Jago, M.V.; Culvenor, C.C.J.; Jones, A.J.; Murray, K.; Shaw, K.J. Corynetoxins causative agents of annual ryegrass toxicity; their identification as tunicamycin group antibiotics. J. Chem. Soc., Chem. Commun. 1982, 4, 222–224. [Google Scholar] [CrossRef] [Scilit]
- Finnie, J. Review of corynetoxins poisoning of livestock, a neurological disorder produced by a nematode-bacterium complex. Aust. Veter. J. 2006, 84, 271–277. [Google Scholar] [CrossRef] [Scilit]
- Allen, J. Annual ryegrass toxicity—An animal disease caused by toxins produced by a bacterial plant pathogen. Microbiol. Aust. 2012, 33, 18–21. [Google Scholar] [CrossRef] [Scilit]
- Grewar, J.; Allen, J.; Guthrie, A. Annual ryegrass toxicity in Thoroughbred horses in Ceres in the Western Cape Province, South Africa. J. S. Afr. Veter. Assoc. 2009, 80, 220–223. [Google Scholar] [CrossRef] [Scilit]
- Riley, I.T. Anguina Tritici is a potential vector of Clavibacter toxicus. Australas. Plant Pathol. 1992, 21, 147–149. [Google Scholar] [CrossRef] [Scilit]
- Riley, I.; McKay, A. Invasion of some grasses by Anguina funesta (Nematoda: Anguinidae) Juveniles. Nematologica 1991, 37, 447–454. [Google Scholar] [CrossRef] [Scilit]
- Murray, T.D.; Schroeder, B.; Schneider, W.L.; Luster, D.G.; Sechler, A.; Rogers, E.E.; Subbotin, S.A. Rathayibacter toxicus, other Rathayibacter species inducing bacterial head blight of grasses, and the potential for livestock poisonings. Phytopathology 2017, 107, 804–815. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yasuhara-Bell, J.; Stack, J.P. Panel of three loop-mediated isothermal amplification assays differentiates Rathayibacter toxicus populations RT-I, RT-II, RT-III, RT-IV and RT-V. J. Plant Pathol. 2019, 101, 707–717. [Google Scholar] [CrossRef] [Scilit]
- Arif, M.; Busot, G.Y.; Mann, R.; Rodoni, B.; Stack, J.P. In-field detection of the select agent Rathayibacter toxicus using loop-mediated isothermal amplification. Phytopathology 2016, 106, S4.1. [Google Scholar]
- Luster, D.G.; McMahon, M.B.; Carter, M.L.; Sechler, A.J.; Rogers, E.E.; Schroeder, B.K.; Murray, T.D. Immunoreagents for development of a diagnostic assay specific for Rathayibacter toxicus. Food Agric. Immunol. 2020, 31, 231–242. [Google Scholar] [CrossRef] [Scilit]
- Arif, M.; Busot, G.Y.; Mann, R.; Rodoni, B.; Stack, J.P. Multiple internal controls enhance reliability for PCR and real time PCR detection of Rathayibacter toxicus. Sci. Rep. 2021, 11, 8365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Panno, S.; Matić, S.; Tiberini, A.; Caruso, A.G.; Bella, P.; Torta, L.; Stassi, R.; Davino, A.S. Loop mediated isothermal amplification: Principles and applications in plant virology. Plants 2020, 9, 461. [Google Scholar] [CrossRef] [Scilit]
- Larrea-Sarmiento, A.; Stack, J.P.; Alvarez, A.M.; Arif, M. Multiplex recombinase polymerase amplification assay developed using unique genomic regions for rapid on-site detection of genus Clavibacter and C. nebraskensis. Sci. Rep. 2021, 11, 12017. [Google Scholar] [CrossRef] [Scilit]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, E63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Little, M.C.; Andrews, J.; Moore, R.; Bustos, S.; Jones, L.; Embres, C.; Durmowicz, G.; Harris, J.; Berger, D.; Yanson, K.; et al. Strand displacement amplification and homogeneous real-time detection incorporated in a second-generation DNA probe system, BDProbeTecET. Clin. Chem. 1999, 45, 777–784. [Google Scholar] [CrossRef] [Scilit]
- Vincent, M.; Xu, Y.; Kong, H. Helicase-dependent isothermal DNA amplification. EMBO Rep. 2004, 5, 795–800. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Ness, J.; Van Ness, L.K.; Galas, D.J. Isothermal reactions for the amplification of oligonucleotides. Proc. Natl. Acad. Sci. USA 2003, 100, 4504–4509. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dean, F.B.; Nelson, J.R.; Giesler, T.L.; Lasken, R.S. Rapid amplification of plasmid and phage DNA using Phi 29 DNA polymerase and multiply-primed rolling circle amplification. Genome Res. 2001, 11, 1095–1099. [Google Scholar] [CrossRef] [Scilit]
- Piepenburg, O.; Williams, C.H.; Stemple, D.L.; Armes, N.A. DNA Detection using recombination proteins. PLoS Biol. 2006, 4, e204. [Google Scholar] [CrossRef] [Scilit]
- Ocenar, J.; Arizala, D.; Boluk, G.; Dhakal, U.; Gunarathne, S.; Paudel, S.; Dobhal, S.; Arif, M. Development of a robust, field-deployable loop-mediated isothermal amplification (LAMP) assay for specific detection of potato pathogen Dickeya dianthicola targeting a unique genomic region. PLoS ONE 2019, 14, e0218868. [Google Scholar] [CrossRef] [Scilit]
- Dobhal, S.; Larrea-Sarmiento, A.; Alvarez, A.M.; Arif, M. Development of a loop-mediated isothermal amplification assay for specific detection of all known subspecies of Clavibacter michiganensis. J. Appl. Microbiol. 2019, 126, 388–401. [Google Scholar] [CrossRef] [Scilit]
- Jia, B.; Li, X.; Liu, W.; Lu, C.; Lu, X.; Ma, L.; Li, Y.-Y.; Wei, C. GLAPD: Whole genome based LAMP primer design for a set of target genomes. Front. Microbiol. 2019, 10, 2860. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, F.A.; Larrea-Sarmiento, A.; Alvarez, A.M.; Arif, M. Genome-informed diagnostics for specific and rapid detection of Pectobacterium species using recombinase polymerase amplification coupled with a lateral flow device. Sci. Rep. 2018, 8, 15972. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boluk, G.; Dobhal, S.; Crockford, A.B.; Melzer, M.; Alvarez, A.M.; Arif, M. Genome-informed recombinase polymerase amplification assay coupled with a lateral flow device for in-field detection of Dickeya species. Plant Dis. 2020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arif, M.; Opit, G.; Yerbafría, A.; Dobhal, S.; Li, Z.; Kucerova, Z.; Ochoa-Corona, F.M. Array of synthetic oligonucleotides to generate unique multi target artificial positive control and molecular probes based discrimination of Liposcelis species. PLoS ONE 2015, 10, e0129810. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dobhal, S.; Olson, J.D.; Arif, M.; Suarez, J.A.G.; Ochoa-Corona, F.M. A simplified strategy for sensitive detection of Rose rosette virus compatible with three RT-PCR chemistries. J. Virol. Methods 2016, 232, 47–56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arif, M.; Busot, G.Y.; Mann, R.; Rodoni, B.; Liu, S.; Stack, J.P. Emergence of a new population of Rathayibacter toxicus: An ecologically complex, geographically isolated bacterium. PLoS ONE 2016, 11, e0156182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yasuhara-Bell, J.; Arif, M.; Busot, G.Y.; Mann, R.; Rodoni, B.; Stack, J.P. Comparative genomic analysis confirms five genetic populations of the select agent, Rathayibacter toxicus. Microorganisms 2020, 8, 366. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Darling, A.E.; Mau, B.; Perna, N.T. progressiveMauve: Multiple genome alignment with gene gain, loss and rearrangement. PLoS ONE 2010, 5, e11147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alikhan, N.-F.; Petty, N.K.; Ben Zakour, N.L.; Beatson, S.A. BLAST Ring Image Generator (BRIG): Simple prokaryote genome comparisons. BMC Genom. 2011, 12, 402. [Google Scholar] [CrossRef] [Scilit]
- Rozen, S.; Skaletsky, H.J. Primer3 on the WWW for general users and for biologist programmers. In Bioinformatics Methods and Protocols: Methods in Molecular Biology; Krawetz, S., Misener, S., Eds.; Humana Press: Totowa, NJ, USA, 2000; pp. 365–386. [Google Scholar]
- Arif, M.; Ochoa-Corona, F.M. Comparative assessment of 5′ A/T-rich overhang sequences with optimal and sub-optimal primers to increase PCR yields and sensitivity. Mol. Biotechnol. 2012, 55, 17–26. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Larrea-Sarmiento, A.; Alvarez, A.M.; Stack, J.P.; Arif, M. Synergetic effect of non-complementary 5′ AT-rich sequences on the development of a multiplex TaqMan real-time PCR for specific and robust detection of Clavibacter michiganensis and C. michiganensis subsp. nebraskensis. PLoS ONE 2019, 14, e0218530. [Google Scholar] [CrossRef] [Scilit]
- Arizala, D.; Arif, M. Genome-wide analyses revealed remarkable heterogeneity in pathogenicity determinants, antimicrobial compounds, and CRISPR-Cas systems of complex phytopathogenic genus Pectobacterium. Pathogens 2019, 8, 247. [Google Scholar] [CrossRef] [Scilit]
- Deng, H.; Gao, Z. Bioanalytical applications of isothermal nucleic acid amplification techniques. Anal. Chim. Acta 2015, 853, 30–45. [Google Scholar] [CrossRef] [Scilit]







| Species | Strain Name | Year | Host | Geographical Location | Results PCR | Results RPA |
|---|---|---|---|---|---|---|
| Rathayibacter toxicus | SA03-02 | 2014 | ARG | Corny Point, SA | + | + |
| R. toxicus | SA03-03 | 2014 | ARG | Corny Point, SA | + | + |
| R. toxicus | SA03-04 | 2014 | ARG | Corny Point, SA | + | + |
| R. toxicus | SA03-08 | 2014 | ARG | Corny Point, SA | + | + |
| R. toxicus | SA03-14 | 2014 | ARG | Corny Point, SA | + | + |
| R. toxicus | SA03-15 | 2014 | ARG | Corny Point, SA | + | + |
| R. toxicus | SA03-16 | 2014 | ARG | Corny Point, SA | + | + |
| R. toxicus | SA03-17 | 2014 | ARG | Corny Point, SA | + | + |
| R. toxicus | SA03-18 | 2014 | ARG | Corny Point, SA | + | + |
| R. toxicus | SA03-19 | 2014 | ARG | Corny Point, SA | + | + |
| R. toxicus | SA03-20 | 2014 | ARG | Corny Point, SA | + | + |
| R. toxicus | SA03-21 | 2014 | ARG | Corny Point, SA | + | + |
| R. toxicus | SA03-22 | 2014 | ARG | Corny Point, SA | + | + |
| R. toxicus | SA03-23 | 2014 | ARG | Corny Point, SA | + | + |
| R. toxicus | SA03-24 | 2014 | ARG | Corny Point, SA | + | + |
| R. toxicus | SA03-25 | 2014 | ARG | Corny Point, SA | + | + |
| R. toxicus | SA03-26 | 2014 | ARG | Corny Point, SA | + | + |
| R. toxicus | SA03-27 | 2014 | ARG | Corny Point, SA | + | + |
| R. toxicus | SA03-28 | 2014 | ARG | Corny Point, SA | + | + |
| R. toxicus | SA08-03 | 2014 | ARG | Lake Sunday, SA | + | + |
| R. toxicus | SA08-07 | 2014 | ARG | Lake Sunday, SA | + | + |
| R. toxicus | SA08-08 | 2014 | ARG | Lake Sunday, SA | + | + |
| R. toxicus | SA08-09 | 2014 | ARG | Lake Sunday, SA | + | + |
| R. toxicus | SA08-11 | 2014 | ARG | Lake Sunday, SA | + | + |
| R. toxicus | SA08-13 | 2014 | ARG | Lake Sunday, SA | + | + |
| R. toxicus | SA08-16 | 2014 | ARG | Lake Sunday, SA | + | + |
| R. toxicus | SA19-02 | 2013 | ARG | Yorketown, SA | + | + |
| R. toxicus | SA19-03 | 2013 | ARG | Yorketown, SA | + | + |
| R. toxicus | SA19-04 | 2013 | ARG | Yorketown, SA | + | + |
| R. toxicus | SA19-05 | 2013 | ARG | Yorketown, SA | + | + |
| R. toxicus | SA19-06 | 2013 | ARG | Yorketown, SA | + | + |
| R. toxicus | SA19-07 | 2013 | ARG | Yorketown, SA | + | + |
| R. toxicus | SA19-08 | 2013 | ARG | Yorketown, SA | + | + |
| R. toxicus | SA19-09 | 2013 | ARG | Yorketown, SA | + | + |
| R. toxicus | SA19-10 | 2013 | ARG | Yorketown, SA | + | + |
| R. toxicus | SA19-11 | 2013 | ARG | Yorketown, SA | + | + |
| R. toxicus | SA19-12 | 2013 | ARG | Yorketown, SA | + | + |
| R. toxicus | SA19-13 | 2013 | ARG | Yorketown, SA | + | + |
| R. toxicus | SA19-14 | 2013 | ARG | Yorketown, SA | + | + |
| R. toxicus | SAC3368 | 1981 | ARG | SA | + | + |
| R. toxicus | SAC3387 | 1981 | ARG | SA | + | + |
| R. toxicus | SAC7056 | 1983 | ARG | Murray Bridge, SA | + | + |
| R. toxicus | WAC3371 | 1978 | LCG | Gnowangerup, WA | + | + |
| R. toxicus | WAC3372 | 1978 | BO | Gnowangerup, WA | + | + |
| R. toxicus | WAC3373 | 1978 | PG | Gnowangerup, WA | + | + |
| R. toxicus | WAC3396 | 1980 | Oat | Gnowangerup, WA | + | + |
| R. toxicus | CS1 | SA | + | + | ||
| R. toxicus | CS3 | ARG | WA | + | + | |
| R. toxicus | CS28 | 1978 | ARG | WA | + | + |
| R. toxicus | CS29 | 1981 | ARG | WA | + | + |
| R. toxicus | CS30 | 1980 | Oat | WA | + | + |
| R. toxicus | CS31 | 1981 | Phalaris sp. | WA | + | + |
| R. toxicus | CS32 | 1981 | DC | WA | + | + |
| R. toxicus | CS33 | 1984 | ARG | SA | + | + |
| R. toxicus | CS34 | 1983 | ARG | SA | + | + |
| R. toxicus | CS36 | 1990 | PBG | Gongolgon, NSW | + | + |
| R. toxicus | CS38 | 1990 | ABG | Lucindale, SA | + | + |
| R. toxicus | CS39 | 1990 | ABG | Lucindale, SA | + | + |
| R. toxicus | WA40-18A | 2015 | ARG | WA | + | + |
| R. toxicus | WA40-18B | 2015 | ARG | WA | + | + |
| R. toxicus | WA40-20A | 2015 | ARG | WA | + | + |
| R. toxicus | WA40-20B | 2015 | ARG | WA | + | + |
| R. toxicus | WA40-21A | 2015 | ARG | WA | + | + |
| R. toxicus | WA40-21B | 2015 | ARG | WA | + | + |
| R. toxicus | WA40-23A | 2015 | ARG | WA | + | + |
| R. toxicus | WA40-23B | 2015 | ARG | WA | + | + |
| R. toxicus | WA40-23C | 2015 | ARG | WA | + | + |
| R. tritici | WAC7055 | 1991 | Whaet | Carnamah, WA | Negative | Negative |
| R. tritici | WAC9601 | - | RG | Negative | Negative | |
| R. tritici | WAC9602 | - | RG | Negative | Negative | |
| R. rathayi | ICMP 2574 | 1968 | DG | New Zealand | Negative | Negative |
| R. rathayi | WAC3369 | - | ARG | WA | Negative | Negative |
| R. rathayi | ICMP 2579 | - | DG | United Kingdom | Negative | Negative |
| R. iranicus | ICMP 13126 | 1994 | Wheat | Iran | Negative | Negative |
| R. iranicus | ICMP 13127 | 1994 | Wheat | Iran | Negative | Negative |
| R. iranicus | ICMP 12831 | 1994 | Wheat | Iran | Negative | Negative |
| R. iranicus | ICMP 3496 | - | Wheat | - | Negative | Negative |
| R. agropyri | WAC9620 | RG | Negative | Negative | ||
| R. agropyri | WAC9621 | Negative | Negative | |||
| R. agropyri | WAC9622 | Negative | Negative | |||
| R. agropyri | WAC9594 | RG | Negative | Negative | ||
| Dietzia cinnamea | SA03-14M | 2014 | ARG | Corny Point, SA | Negative | Negative |
| Clavibacter nebraskensis | Cmn | - | - | - | Negative | Negative |
| Soil | Non-infested soil | - | - | - | Negative | Negative |
| Host | Healthy ryegrass | - | - | - | Negative | Negative |
| Name | Sequence (5′-3′) | GC % | Length (bp) | Amplicon Size (bp) |
|---|---|---|---|---|
| Rtox-F1 | GACAATTTATCGACGGGTGA | 45.0 | 20 | 170 |
| Rtox-R1 | AGCGGCTCGCTTACAGATT | 52.6 | 19 | |
| RT-RPA-F | AAGTGACGGTGATCGACAATTTATCGACGGGTGAC | 49 | 35 | 189 |
| RT-RPA-R | * BiosG-ATATCAGCGGCTCGCTTACAGATTCTTTGACCGAC | 49 | 35 | |
| RT-RPA-P | ** FAM-CAGATATTTCGGAAGTTGATCACATAGTCG-dSpacer-CGGAACTCAGTGGTGTTTCT-SpacerC3 | 50 | 44 | |
| IC-RPA-F | TAATCCACACGACTCTCGGCAACGGATATCTC | 32 | 50 | 123 |
| IC-RPA-R | * BiosG-CAACTTGCGTTCAAAGACTCGATGGTTCGCG | 31 | 52 | |
| IC-RPA-P | ** FAM-CTCGCATCGATGAAGAACGTAGCGAAATGC-dSpacer-ATACCTGGTGTGAATTGCA-SpacerC3 | 49 | 47 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Arif, M.; Busot, G.Y.; Mann, R.; Rodoni, B.; Stack, J.P. Field-Deployable Recombinase Polymerase Amplification Assay for Specific, Sensitive and Rapid Detection of the US Select Agent and Toxigenic Bacterium, Rathayibacter toxicus. Biology 2021, 10, 620. https://doi.org/10.3390/biology10070620
Arif M, Busot GY, Mann R, Rodoni B, Stack JP. Field-Deployable Recombinase Polymerase Amplification Assay for Specific, Sensitive and Rapid Detection of the US Select Agent and Toxigenic Bacterium, Rathayibacter toxicus. Biology. 2021; 10(7):620. https://doi.org/10.3390/biology10070620
Chicago/Turabian StyleArif, Mohammad, Grethel Y. Busot, Rachel Mann, Brendan Rodoni, and James P. Stack. 2021. "Field-Deployable Recombinase Polymerase Amplification Assay for Specific, Sensitive and Rapid Detection of the US Select Agent and Toxigenic Bacterium, Rathayibacter toxicus" Biology 10, no. 7: 620. https://doi.org/10.3390/biology10070620
APA StyleArif, M., Busot, G. Y., Mann, R., Rodoni, B., & Stack, J. P. (2021). Field-Deployable Recombinase Polymerase Amplification Assay for Specific, Sensitive and Rapid Detection of the US Select Agent and Toxigenic Bacterium, Rathayibacter toxicus. Biology, 10(7), 620. https://doi.org/10.3390/biology10070620

